Skip to main content
Journal of Antimicrobial Chemotherapy logoLink to Journal of Antimicrobial Chemotherapy
. 2018 Jan 19;73(5):1177–1180. doi: 10.1093/jac/dkx531

PBP4 activity and its overexpression are necessary for PBP4-mediated high-level β-lactam resistance

Li Basuino 1,#, Ambre Jousselin 2,#, J Andrew N Alexander 3, Natalie C J Strynadka 3, Mariana G Pinho 2, Henry F Chambers 1, Som S Chatterjee 1,✉
PMCID: PMC5909641  PMID: 29360990

Abstract

Background

PBP4 is typically considered unimportant for conferring high-level β-lactam resistance in Staphylococcus aureus. Mutations in PBP4 have been associated with β-lactam non-susceptibility among natural strains of S. aureus. We have previously shown that PBP4 can mediate high-level β-lactam resistance in laboratory-generated strains passaged in β-lactam antibiotics. Mutations in the pbp4 promoter that up-regulate its expression and missense mutations that surround PBP4’s active site were detected in high frequencies among passaged strains, suggesting PBP4 plays a key role in resistance. How these mutations participate in PBP4’s ability to provide high-level β-lactam resistance is unknown.

Objectives

To determine whether enzymatic activity of PBP4 is required for high-level β-lactam resistance and to investigate how the pbp4-associated mutations provide β-lactam resistance.

Methods

The catalytic activity of PBP4 was disabled through introduction of a serine to alanine point mutation in its active site (Ser-75→Ala) in a representative and well-studied passaged strain, CRB. pbp4 promoter and missense mutations detected in CRB were reconstituted in a WT strain individually and in combination. β-Lactam resistance of the resultant strains was evaluated by population analysis. Bacterial peptidoglycan composition of the pbp4 mutants was evaluated with and without antibiotic treatment using LC.

Results

PBP4 inactivation imparted complete β-lactam susceptibility of CRB. Reconstitution of PBP4 missense mutations alone did not impart β-lactam resistance, but did so in synergism with pbp4 promoter mutation. A similar synergistic interaction of pbp4 mutations was observed in enhanced peptidoglycan cross-linking upon antibiotic treatment.

Conclusions

PBP4’s activity and overexpression both contribute to high-level β-lactam resistance.

Introduction

PBPs, the primary targets of β-lactam antibiotics, perform the final steps of bacterial cell wall biosynthesis.1 High-level resistance to β-lactam drugs in Staphylococcus aureus is generally mediated by PBP2a.2 The hallmark of PBP2a-mediated β-lactam resistance is its lower affinity to the drug, allowing cell wall biosynthesis even in the presence of high concentrations of the drug.2S. aureus possesses four other PBPs (PBP1–4), which are not considered as important as PBP2a for β-lactam resistance and consequently have received little attention.

We have recently shown that S. aureus when passaged in β-lactams can attain high-level, broad-spectrum β-lactam resistance in the absence of mecA (the gene that codes for PBP2a).3,4 Mutations targeting pbp4 were common among the resistant passaged strains.5 Deletion of pbp4 in these strains restored full susceptibility to β-lactams, and mecA-negative WT strains without pbp4 were unable to attain the high-level resistance when passaged in a similar manner.4,6 These results suggested that PBP4 has a vital role in the pathway leading to the observed high-level β-lactam resistance that is independent of PBP2a.

PBPs constitute the core of the bacterial cell wall biosynthesis machinery. How each component participates in cell wall biogenesis is not well understood. The mechanism by which PBP4 mediates resistance in our passaged strains is also unknown. PBP4 could either play an active role through its enzymatic activity or it could also play an accessory role to facilitate stability and/or interactions with the core components of the cell wall biosynthesis machinery or with the components of the cell wall itself.

One of the resistant passaged strains, CRB (COLnex strain resistant to ceftobiprole) has a 36 bp (ATTTATATGATAGAATATTTCTATTGCATTTTTTGT) duplication in the pbp4 promoter region and two missense mutations, Glu-183→Ala and Phe-241→Arg, that surround the PBP4 active site.4,6 Reconstitution of the 36 bp pbp4 promoter mutation in the parental COLnex strain led to PBP4 up-regulation, increased peptidoglycan cross-linking and enhanced β-lactam resistance.6 The role of the PBP4 missense mutations is currently unclear. Since affinity to β-lactams between recombinant PBP4s with or without the missense mutations appears to be similar,6 the mechanism of PBP4-mediated resistance may not be due to low drug binding affinity, in contrast to PBP2a. The fact that PBP4 missense mutations are common among passaged strains,5 and that similar mutations targeting PBP4 were recently reported among ceftaroline-non-susceptible clinical isolates,7 suggested an as-yet unidentified role for these mutations in β-lactam resistance.

In this paper we show that the enzymatic activity of PBP4 is essential for the manifestation of high-level β-lactam resistance independent of PBP2a, and that the PBP4 missense mutations with their promoter mutations synergistically contribute to β-lactam resistance.

Materials and methods

Bacterial strains and plasmids

Bacterial strains were grown in tryptic soy broth (TSB) as previously described.4,6 Allelic replacements were carried out with the plasmid pJB38 as previously described.8 The bacterial strains used in this study are listed in Table S1 (available as Supplementary data at JAC Online). The primers used in this study are listed in Table S2.

Population analysis

Population analyses were done by the agar method as previously described.4 Briefly, a 10 μL volume of serially diluted bacterial culture was spotted onto agar plates containing increasing concentrations of nafcillin (Sigma). The plates were incubated at 37°C for 72 h and were read for cfu determination.

Additional methods used in this study are described in the Supplementary Methods available as Supplementary data at JAC Online.

Results

Activity of PBP4 is necessary for high-level β-lactam resistance of CRB

To determine if the activity of PBP4 is important for high-level β-lactam resistance in the mecA-negative CRB strain, the active site serine at amino acid position 75 of PBP4 was substituted with an alanine residue. Although the resultant mutant, CRB pbp4(Ser-75→Ala), expressed similar amounts of pbp4 compared with CRB, it was completely susceptible to β-lactam antibiotics, comparable to the CRB Δpbp4 strain (Figure 1, Figure S1 and Table S3), indicating that the enzymatic activity of PBP4 was indeed essential for the resistance of CRB.

Figure 1.

Figure 1.

Activity of PBP4 is important to confer β-lactam resistance in strain CRB. Population analysis in nafcillin was carried out with highly resistant CRB (filled circles), its Δpbp4 deletion mutant (open circles) and its PBP4 (S-75→A) substitution mutant (open squares). Two-way ANOVA of the data revealed a significant difference (P < 0.0001) between CRB and the other strains.

pbp4 up-regulation is essential for PBP4-mediated high-level β-lactam resistance

As mentioned above, PBP4 missense mutations were not only common among our passaged strains, but a recent clinical surveillance study also reported similar missense mutations in PBP4.7 Another surveillance study carried out in the Asia-Pacific region identified several ceftaroline-non-susceptible S. aureus strains.9 Ceftaroline non-susceptibility was predominantly due to mutations in PBP2a. Notably, the same study also detected six ceftaroline-non-susceptible strains without any PBP2a mutations. Sequencing of pbp4 revealed identical missense mutations (Thr-189→Ser; Thr-409→Ala) in three out of these six strains. This suggested that missense mutations in PBP4 are associated with β-lactam non-susceptibility or resistance and might play an unidentified role in resistance.

To determine the role of the missense mutations of PBP4 detected in CRB (Glu-183→Ala and Phe-241→Arg), these mutations were reconstituted in the parental COLnex strain (mecA-deleted COLn strain). The resultant mutant strain (COLnex pbp4(Glu-183→Ala and Phe-241→Arg)) did not show enhanced β-lactam resistance (Figure 2 and Table S3). This result was consistent with our previous finding where the same set of mutations failed to confer any β-lactam resistance in the SF8300ex strain (a PBP2a-deleted USA300 background strain).4

Figure 2.

Figure 2.

PBP4 missense mutations provide β-lactam resistance in synergism with its promoter mutation. Population analysis in nafcillin was carried out with COLnex (filled circles), COLnex pbp4(E-183→A and F-241→R) (open triangles), COLnex Ppbp4(CRB) (filled diamonds), COLnex Ppbp4(CRB)pbp4(E-183→A and F-241→R) (open diamonds) and COLnex Ppbp4(CRB)pbp4(E-183→A and F-241→R) (S-75→A) (filled squares). Two-way ANOVA of the data revealed a significant difference (P < 0.0001) between COLnex Ppbp4(CRB), COLnex Ppbp4(CRB)pbp4(E-183→A and F-241→R) and the other strains.

Since PBP4 missense mutations were commonly identified along with pbp4 promoter mutations among our passaged strains,5 and the promoter mutation in CRB led to PBP4 up-regulation,6 we hypothesized that PBP4 up-regulation might be a prerequisite for the missense mutations to manifest resistance. To this end, we reconstituted the Glu-183→Ala and Phe-241→Arg mutations in the COLnex strain bearing the pbp4 promoter mutation (COLnex Ppbp4(CRB)). The resultant strain COLnex Ppbp4(CRB)pbp4(Glu-183→Ala and Phe-241→Arg) showed enhanced β-lactam resistance compared with the COLnex Ppbp4(CRB) strain both through population analysis and in MICs (Figure 2 and Table S3). Further, a Ser-75→Ala mutation in the PBP4 of COLnex Ppbp4(CRB)pbp4(Glu-183→Ala and Phe-241→Arg) rendered it completely β-lactam susceptible, similar to the parental COLnex strain (Figure 2 and Table S3). Thus, although the Glu-183→Ala and Phe-241→Arg mutations can enhance β-lactam resistance, up-regulation of PBP4 is required for detectable levels of resistance and intact enzymatic activity of PBP4 is equally important for the resistance phenotype.

pbp4 mutations are synergistic in producing highly cross-linked cell wall upon β-lactam challenge

We previously observed that COLnex Ppbp4(CRB) has a highly cross-linked (represented by 18+ muropeptide fractions) cell wall pattern that is dramatically reduced by nafcillin treatment.6 This led us to hypothesize that PBP4 overexpression in COLnex Ppbp4(CRB) allowed cells to resist the β-lactam challenge by catalysing the essential cross-linking reaction.6 To evaluate if a synergism similar to the results mentioned above exists in COLnex Ppbp4(CRB)pbp4(Glu-183→Ala and Phe-241→Arg) in producing highly cross-linked cell wall, bacterial peptidoglycans were analysed. The PBP4 missense mutations mediated a decrease in highly cross-linked cell wall when grown in TSB medium in the absence of nafcillin. However, in the presence of nafcillin the same mutations aided the formation of enhanced cell wall cross-linking (Figure S2). Growth curves of these strains showed identical growth in TSB without nafcillin, but nafcillin treatment inhibited COLnex Ppbp4(CRB) more efficiently compared with COLnex Ppbp4(CRB)pbp4(Glu-183→Ala and Phe-241→Arg) (Figure S3). These results support our previous hypothesis that PBP4’s ability to form highly cross-linked cell wall confers the resistance phenotype.6

Discussion

PBP4 is a low molecular weight, non-essential PBP in S. aureus that is usually expressed in minute amounts compared with other PBPs in bacterial membrane proteins labelled with a saturating concentration of bocillin.6 PBP4 has transpeptidase (TPase) activity that is needed to cross-link the peptidyl moieties in newly synthesized bacterial peptidoglycan.6 Our previous and current results suggest that up-regulation of PBP4 (mediated by pbp4 promoter mutation) in mecA-negative strains and its activity are important for β-lactam resistance (Figures 1 and 2).6 PBP4 up-regulation leads to increased cell wall cross-linking as a probable consequence of its increased TPase activity.6 A similar association of PBP4 overproduction leading to increased cell wall cross-linking and β-lactam resistance has been described previously.10

Our current results suggest that PBP4 missense mutations also contribute to PBP4-mediated β-lactam resistance although the phenotype depends on overexpression of PBP4. Notably, the β-lactam-non-susceptible clinical strains described above that bear PBP4 missense mutations lack pbp4 promoter mutations.7,9 Perhaps PBP4 does not mediate the resistance phenotype in these strains or the phenotype varies with strain background. Further studies are needed to precisely decipher the role that PBP4 missense mutations play in resistance. The mechanisms for decreased cell wall cross-linking associated with PBP4 missense mutations in the absence of antibiotic are unknown (Figure S2) and are currently under investigation.

CRB displayed much enhanced β-lactam resistance compared with the strain in which we reconstituted CRB’s pbp4 promoter and missense mutations (COLnex Ppbp4(CRB)pbp4(Glu-183→Ala and Phe-241→Arg)) (Table S3). Thus, other factors in addition to PBP4 are probably involved in the resistance of CRB. Prior genome sequence analysis of CRB revealed a point mutation in gdpP, which encodes a newly identified signalling protein in bacteria that has recently been associated with β-lactam resistance.11,12 In fact, a recent clinical surveillance study has also reported mutations in gdpP in ceftaroline-non-susceptible strains.7 Thus, gdpP could play an important role in the hyper-resistant phenotype of CRB. Our results suggest that PBP4, and its overexpression in particular, can provide an alternative mechanism of resistance to β-lactam resistance in S. aureus.

Supplementary Material

Supplementary Data

Acknowledgements

We are thankful to Daniel F. Sahm for providing the ceftaroline-non-susceptible strains described in Table S1 from the AWARE surveillance programme.

Funding

This work was funded in part by National Institutes of Health (NIH) grant R01-AI100291.

Transparency declarations

None to declare.

Supplementary data

Supplementary Methods, Tables S1 to S3 and Figures S1 to S3 are available as Supplementary data at JAC Online.

References

  • 1. Macheboeuf P, Contreras-Martel C, Job V. et al. Penicillin binding proteins: key players in bacterial cell cycle and drug resistance processes. FEMS Microbiol Rev 2006; 30: 673–91. [DOI] [PubMed] [Google Scholar]
  • 2. Chambers HF, Deleo FR.. Waves of resistance: Staphylococcus aureus in the antibiotic era. Nat Rev Microbiol 2009; 7: 629–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Banerjee R, Gretes M, Basuino L. et al. In vitro selection and characterization of ceftobiprole-resistant methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 2008; 52: 2089–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Chan LC, Gilbert A, Basuino L. et al. PBP 4 mediates high-level resistance to new-generation cephalosporins in Staphylococcus aureus. Antimicrob Agents Chemother 2016; 60: 3934–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Greninger AL, Chatterjee SS, Chan LC. et al. Whole-genome sequencing of methicillin-resistant Staphylococcus aureus resistant to fifth-generation cephalosporins reveals potential non-mecA mechanisms of resistance. PLoS One 2016; 11: e0149541. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Hamilton SM, Alexander JA, Choo EJ. et al. High-level resistance of Staphylococcus aureus to β-lactam antibiotics mediated by penicillin-binding protein 4 (PBP4). Antimicrob Agents Chemother 2017; 61: e02727–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Argudin MA, Dodemont M, Taguemount M. et al. In vitro activity of ceftaroline against clinical Staphylococcus aureus isolates collected during a national survey conducted in Belgian hospitals. J Antimicrob Chemother 2017; 72: 56–9. [DOI] [PubMed] [Google Scholar]
  • 8. Bose JL, Fey PD, Bayles KW.. Genetic tools to enhance the study of gene function and regulation in Staphylococcus aureus. Appl Environ Microbiol 2013; 79: 2218–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Biedenbach DJ, Alm RA, Lahiri SD. et al. In vitro activity of ceftaroline against Staphylococcus aureus isolated in 2012 from Asia-Pacific countries as part of the AWARE surveillance program. Antimicrob Agents Chemother 2015; 60: 343–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Henze UU, Roos M, Berger-Bachi B.. Effects of penicillin-binding protein 4 overproduction in Staphylococcus aureus. Microb Drug Resist 1996; 2: 193–9. [DOI] [PubMed] [Google Scholar]
  • 11. Banerjee R, Gretes M, Harlem C. et al. A mecA-negative strain of methicillin-resistant Staphylococcus aureus with high-level β-lactam resistance contains mutations in three genes. Antimicrob Agents Chemother 2010; 54: 4900–2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Corrigan RM, Grundling A.. Cyclic di-AMP: another second messenger enters the fray. Nat Rev Microbiol 2013; 11: 513–24. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Data

Articles from Journal of Antimicrobial Chemotherapy are provided here courtesy of Oxford University Press

RESOURCES