Abstract
OligoSTORM and OligoDNA-PAINT meld the Oligopaint technology for fluorescent in situ hybridization (FISH) with, respectively, Stochastic Optical Reconstruction Microscopy (STORM) and DNA-based Point Accumulation for Imaging in Nanoscale Topography (DNA-PAINT) to enable in situ single-molecule super-resolution imaging of nucleic acids. Both strategies enable ≤20 nm resolution and are appropriate for imaging nanoscale features of the genomes of a wide range of species, including human, mouse, and fruit fly (Drosophila).
Keywords: Single-molecule, super-resolution, genome, chromosomes, chromatin, FISH, Oligopaint, STORM, DNA-PAINT, OligoSTORM, OligoDNA-PAINT
1 Introduction
Single-molecule-based super-resolution imaging methods can offer resolutions that represent a ten-fold or greater improvement as compared to the diffraction limit, reaching a few tens of nanometers or even below 10 nm [1–4]. These techniques rely on the stochastic switching of individual fluorophores between fluorescent and dark states or the binding and unbinding of individual labeled molecules in order to separate the spatially overlapping images of single molecules in time. This strategy allows the position of numerous individual fluorescent molecules to be determined with high precision from the centroid positions of their images. A super-resolution image is then rendered from a collection of single-molecule localizations. Here we describe how two forms of single-molecule-based super-resolution imaging can be used for the in situ visualization of chromosomal DNA [5, 6]. These technologies, called OligoSTORM and OligoDNA-PAINT, use Oligopaint technology [7, 8] to generate single-stranded oligonucleotide probes for fluorescent in situ hybridization (FISH) and then use the probes in combination with, respectively, Stochastic Optical Reconstruction Microscopy (STORM) [9-11] and DNA-based Point Accumulation for Imaging in Nanoscale Topography (DNA-PAINT) [12– 14] to generate high-resolution images of genomic DNA. Below, we provide brief descriptions of Oligopaints, OligoSTORM, and OligoDNA-PAINT, followed by protocols for generating Oligopaint probes from a library of oligonucleotides (oligos) and preparing samples for imaging by OligoSTORM or OligoDNA-PAINT. As for the actual steps of image acquisition, we refer the reader to published literature for STORM and OligoSTORM [5, 6, 9, 10, 11, 15] and DNA-PAINT and OligoDNA-PAINT [5, 13, 14, 16, 17].
1.1. Oligopaints
Oligopaints are short single-stranded oligos which, when labeled directly or indirectly with a fluorophore, can be used to visualize genomic regions as small as a few kilobases (kbs) to as large as tens of megabses (Mbs) or more [7, 8]. The oligos feature a short region of genomic homology (typically, 30 to 42 bases) flanked by nongenomic sequences, called Mainstreet and Backstreet, and are generated through amplification of oligo libraries that have been computationally designed and then synthesized by traditional column-based or massively parallel array-based methods – in either case, libraries can be readily purchased from commercial vendors (Fig. 1A). The region of genomic homology targets the oligos to genomic loci, wherein the typical number of binding sites in single-copy genomic regions ranges from ∼1 to 20 per kb, depending on the parameters used to select the target sites [7; unpublished data]. Mainstreet and Backstreet are used for a variety for applications, including amplifying, and thus renewing, libraries (e.g., via the incorporation of primer sequences), multiplexing libraries (e.g., through the use of multiple primer pairs), and co-localizing complementary secondary oligos through hybridization [5–7, 18, 19]. Thus, Oligopaint oligos can be made into imaging probes by conjugating them with fluorophores during amplification (Fig. 1B) or targeting them with labeled secondary oligos that are complementary to sequences on Mainstreet or Backstreet (Fig. 1C). Below, we include a protocol for synthesizing Oligopaint probes.
Fig. 1.

Implementation of OligoSTORM and OligoDNA-PAINT using Oligopaints. A) The Mainstreets and Backstreets of Oligopaint oligos consist of nongenomic sequences that can be used for a variety of purposes. For example, inclusion of primer sequences enables oligo amplification, including selective amplification of subsets of the oligo library. B) Oligopaint oligos can be directly labeled with a fluorophore (red circle) via amplification with primers conjugated with a fluorophore. C) Oligopaint oligos can be indirectly labeled via hybridization of labeled secondary oligos to Mainstreet and/or Backstreet. D-F) OligoSTORM can be achieved via a variety of strategies, including labeling Oligopaint oligos (D) or secondary oligos (E) with a photoswitchable reporter (red) or pairing an activator (yellow) conjugated to Mainstreet or Backstreet with a reporter (red) that is carried by a secondary oligo hybridized to Mainstreet or Backstreet (F). G) OligoDNA-PAINT can be achieved via the repeated, transient binding to Mainstreet or Backstreet of short imager strands conjugated with a fluorophore.
1.2. OligoSTORM
STORM enables super-resolution imaging through the switching and localization of single fluorescent molecules [9-11]. It achieves this by permitting only a stochastic subset of fluorophores to be switched on at any given time, such that their images do not substantially overlap. This strategy allows the positions of fluorophores to be determined with very high precision. A variety of photoswitchable fluorophores can be used to achieve stochastic switching, examples that have been used in OligoSTORM including AlexaFluor 647 and AlexaFluor 750 and their respective analogs, Cy5 and Cy7, all of which can exist in two states: a dark state, which does not fluoresce, and a bright or ‘on’ state, which emits fluorescence upon excitation [11, 20, 21]. While these photoswitchable fluorophores, which we call reporters, can be activated from the dark to the fluorescent state through direct UV or near-UV excitation, the rate and efficiency of activation can be substantially increased when they are placed in close proximity to an activator molecule, such as AlexaFluor 405. In OligoSTORM, a variety of labeling and excitation strategies can be used [5, 6], including 1) conjugating Oligopaint oligos with a reporter (Fig. 1D), 2) hybridizing secondary oligos labeled with a reporter to Mainstreet or Backstreet (Fig. 1E), and 3) using a dual-fluorophore system in which, for example, an activator is conjugated to the 5′ end of Mainstreet and a secondary oligo bearing a reporter is hybridized to Mainstreet such that the reporter and the activator are in close proximity (Fig. 1F). In the first two strategies, a 405 nm laser is used to directly switch the reporter to the fluorescent state, while in the third strategy, the 405 nm laser excites the activator, which facilitates activation of the reporter. We have found that the third strategy gives a greater number of localizations and have used it to image chromosomal regions ranging in size from 5 kb to more than a megabase [5, 6; unpublished data]. Below, we provide a protocol for preparing samples for OligoSTORM.
1.3. OligoDNA-PAINT
DNA-PAINT achieves super-resolution imaging through the transient binding of fluorescently labeled oligos, called imager strands, that are freely diffusing in the imaging buffer to complementary strands, called docking strands, present on the target to be imaged [12-14]. Here, one round of binding and dissociation of an imager strand is detected as a single event of fluorescence, wherein the transient spikes in intensity of fluorescence at sites of hybridization permits users to discriminate between the fluorescence of imager strands bound to their target from the fluorescence of unbound imager strands diffusing in the imaging buffer. Imager strands, which are continuously replenished from the buffer, are designed to be short (e.g., 9-10 bases) in order to promote the transient nature of their binding. Additionally, as the concentration of imager strands and thermodynamic stability of the hybridized duplex control the rates of, respectively, binding and dissociation, users can tune the conditions of the imaging buffer to attain a desired blinking rate [13, 14, 16, 17]. Moreover, users can achieve numerous pseudocolors using only one spectral channel via the assignment of orthogonal docking strand sequences to distinct targets and, using a version of DNA-PAINT, called Exchange-PAINT, enable multiple targets to be distinguished via serial imaging [14]. In OligoDNA-PAINT, docking sites for the imager strands can be included in Mainstreet or Backstreet, such that binding of Oligopaint oligos to a genomic target renders that target amenable to super-resolution imaging when imager strands are introduced (Fig. 1G). Using this approach, we have generated super-resolution images of genomic regions ranging in size from 5 kb to more than a megabase [5; unpublished data]. Below, we present a protocol for preparing samples for OligoDNA-PAINT.
1.4. Organization of the protocols
In keeping with the format of the journal, the protocols for synthesizing Oligopaint probes and preparing samples for imaging by OligoSTORM or OligoDNA-PAINT are integrated, such that the Materials for the three protocols are presented together in one section (Section 2), the Methods for the three protocols are presented together in one section (Section 3), and the Notes for the three protocols are presented together in one section (Section 4). Thus, the organization of the protocols appears as follows:
2 Materials
2.1 Materials for synthesizing Oligopaint probes
Oligopaint probes typically consist of ∼100-100,000 or more species of oligos, each carrying either a fluorophore or a binding site for a fluorescently labeled secondary oligo (Figs. 1A-C). In general, they are generated from libraries of oligos that are computationally designed by the user and then synthesized either in-house or by commercial vendors; for libraries with fewer than ∼100-200 species of oligos, users might wish to order the oligos individually (that is, have them synthesized through column-based methods), as this strategy allows the user to control the concentration of each oligo species in the probe and, furthermore, can preclude the need for library amplification. Once a library is obtained, Oligopaint probes can be generated from the library in a variety of ways, all of which produce products that are single-stranded; single-stranded products are preferable to those that can become double-stranded, as the latter can renature after the denaturation step and thus become unavailable to their genomic targets during the hybridization step. There are several strategies for producing Oligopaint probes, including PCR amplification followed by asymmetric nicking and gel purification [5, 7, 8], PCR amplification followed by exonuclease digestion [5], T7 amplification followed by reverse transcription [RT; 5, 6, 18, 19, 22, 23], and rolling-circle amplification followed by cleavage [5, 24]. Depending on the strategy used, the final oligos may carry both Mainstreet and Backstreet or just one. Below, we outline a protocol using T7 amplification, after which the products are reverse transcribed using labeled primers to produce oligos with both Mainstreet and Backstreet and a fluorophore conjugated at the 5′ end [modified from refs. 5–8, 18, 19, 22, 23].
All solutions should be prepared using distilled, deionized water (ddH2O). Take care to avoid nuclease contamination, particularly from DNases. The recipes provided here for stock solutions will support many samples, while the rest are intended for a single sample.
2.1.1. Oligopaints: PCR amplification of Oligopaints library
Phusion Hot-start Master Mix (New England BioLabs).
Forward primer.
Reverse primer with T7 promoter sequence (e.g., TAATACGACTCACTATAGGG) appended to its 5′ end.
Oligopaints library (synthesized either in-house or by a commercial vendor).
A fluorescent intercalating dye for real-time PCR, such as EvaGreen Dye (20× in ddH2O; Biotium) or equivalent.
2.1.2. Oligopaints: PCR cleanup and gel electrophoresis
DNA Clean & Concentrator-5 (DCC-5) kit (Zymo Research).
6× DNA loading dye.
LE Agarose.
Borax solution: 1 g anhydrous sodium tetraborate in 1 liter of ddH2O.
2.1.3. Oligopaints: T7 reaction
HiScribe T7 Quick High Yield RNA Synthesis Kit (New England BioLabs).
RNasin Plus RNase Inhibitor (Promega).
2.1.4. Oligopaints: Reverse transcription (RT)
Maxima H Minus RT Transcriptase (ThermoFisher Scientific).
dNTP Mix – 10 mM each.
15% Mini-PROTEAN TBE-Urea Precast Gels (Bio-Rad).
Urea-loading buffer.
2.1.5. Oligopaints: Probe cleanup
DNA Clean & Concentrator-25 (DCC-25) kit (Zymo Research).
Oligo binding buffer (Zymo).
2.2 Materials for preparing samples for OligoSTORM
As illustrated in Figures 1D–F, OligoSTORM can be implemented in a variety of ways. The following protocol describes the dual-fluorophore version, in which an activator, conjugated to the 5′ end of an Oligopaint oligo, is paired with a reporter carried by a secondary oligo bound to Mainstreet. It outlines the steps of sample preparation, application of Oligopaint oligos, and then the introduction of labeled secondary oligos [modified from refs. 5 and 6].
All solutions should be prepared using distilled, deionized water (ddH2O). Take care to avoid nuclease contamination, particularly from DNases. The recipes provided here for stock solutions will support many samples, while the rest are intended for a single sample.
2.2.1. OligoSTORM: Sample fixation
Coverslip #1.5 (Electron Microscopy Science).
Tissue culture cell suspension.
1× phosphate buffered solution (PBS) pH 7.4 solution: Dilute a 10× PBS pH 7.4 stock solution (137 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, and 2 mM KH2PO4) ten-fold in ddH2O.
Fixation solution: Combine 4 ml 10× PBS pH 7.4, 10 ml 16% (vol/vol) paraformaldehyde, and 26 ml ddH2O (see Note 4.2.1). Vortex vigorously to mix. Always prepare fresh.
2.2.2. OligoSTORM: Sample permeabilization
Borohydride solution: 1 mg/ml sodium borohydride in dH2O, make fresh.
1× PBS.
Permeabilization solution: 1× PBS + 0.5% (vol/vol) Triton X-100 (10 ml 1× PBS + 50 μl Triton X-100). Always prepare fresh.
Kimwipes.
0.1 N HCl (425 μl of 36% HCl in 50 ml = 0.1 M).
RNaseA solution: 100 μg/ml RNaseA in PBS.
2× SSC solution.
Formamide (see Note 4.2.1)
0.1% Tween-20.
2.2.3. OligoSTORM: Sample denaturation and hybridization
Hybridization buffer: 50% formamide, 2× SSC, 0.1% Tween-20, 10% Dextran Sulfate (see Notes 4.2.1 and 2).
Oligopaint oligos (assuming a single sample): ∼100 pmol of Oligopaint oligos per 100 kb of genomic target (see Note 4.2.3).
Reporter-labeled secondary probe: 100 μM solution (see Note 4.2.4).
Heat source for denaturation (see Note 4.2.5).
Hybridization incubator (see Note 4.2.6).
Humidified chamber (see Note 4.2.7).
Glass slide.
2.2.4. OligoSTORM: Post-hybridization washes
2× SSCT solution: 2× SSC + 0.1% vol/vol Tween-20.
2× SSC.
2.2.5. OligoSTORM: Mounting sample
Standard glass slide.
- STORM imaging buffer:
- 400 μl of 2× SSC.
- 100 μl of 50% glucose.
- 10 μl of GLOX buffer: 175 μl 2× SSC, 10 mg glucose oxidase powder, and 25 μl catalase at 16 mg/ml. Can be stored up to 1 week at 4°C).
- 5 μl β-mercaptoethanol.
Nail polish.
2.3 Materials for preparing samples for OligoDNA-PAINT
OligoDNA-PAINT entails repeated, transient binding of labeled imager strands to complementary docking sites within Mainstreet and/or Backstreet (Fig. 1G). Here we describe sample preparation using either coverglass chamber slides or coverslips, application of Oligopaint oligos, and then the introduction of imager strands [modified from refs. 5, 12, 13]. Although not described here, sequential application of different species (sequences) of imager strands in the context of Exchange-PAINT [14] will enable pseudocolors.
All solutions should be prepared using distilled, deionized water (ddH2O). Take care to avoid nuclease contamination, particularly from DNases. The recipes provided here for stock solutions will support many samples, while the rest are intended for a single sample.
2.3.1. OligoDNA-PAINT: Sample fixation
Coverglass chamber slide or #1.5 coverslip (see Note 4.3.1).
Tissue culture cell suspension (see Note 4.3.2).
1× PBS pH 7.4 solution: Dilute a 10× PBS pH 7.4 stock solution (137 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, and 2 mM KH2PO4) ten-fold in ddH2O.
Fixation solution: Combine 4 ml 10× PBS pH 7.4, 10 ml 16% (vol/vol) paraformaldehyde, and 26 ml ddH2O (see Note 4.3.3). Vortex vigorously to mix. Always prepare fresh.
2.3.2. OligoDNA-PAINT: Sample permeabilization
Permeabilization solution: 1× PBS + 0.5% (vol/vol) Triton X-100 (10 ml 1× PBS + 50 μl Triton X-100). Always prepare fresh.
PBT solution: Combine 100 ml 10× PBS pH 7.4, 899 ml ddH2O, and 1 ml Tween-20.
2× SSCT solution: Combine 100 ml 20× SSC stock solution (3 M NaCl, 300 mM sodium citrate), 899 ml ddH2O, and 1 ml Tween-20.
0.1 N HCl (425 μl of 36% HCl in 50 ml = 0.1 N).
4× SSCT solution: Combine 200 ml 20× SSC stock solution (3 M NaCl, 300 mM sodium citrate), 798 ml ddH2O, and 2 ml Tween-20.
Deionized formamide (see Note 4.3.3). Store at 4°C.
2× SSCT + 50% (vol/vol) formamide solution: combine 4× SSCT and deonized formamide in equal proportions. Always prepare fresh (see Note 4.3.3).
2.3.3. OligoDNA-PAINT: Sample denaturation and hybridization
4× hybridization buffer: 40% (wt/vol) dextran sulfate, 8× SSC, 0.8% (vol/vol), Tween-20 (see Note 4.3.4).
Oligopaint oligos (assuming a single sample): enough to reach a concentration of ∼ 1.6 μM in the hybridization mix (see Note 4.3.5).
10 μg/μl RNase A.
Heat source for denaturation (see Note 4.3.6).
Hybridization incubator (see Note 4.3.7).
Humidified chamber (see Note 4.3.8).
Rubber cement if using a coverslip in place of a coverglass chamber slide.
A glass microscope slide if using a coverslip in place of a coverglass chamber slide.
2.3.4. OligoDNA-PAINT: Post-hybridization washes and preparation for imaging
2× SSCT, as described above.
DAPI staining solution: 998 μl 2× SSCT + 2 μl 1 μg/μl 4′,6-diamidino-2-phenylindole.
DNA-PAINT Buffer C: Combine 3 ml 10× PBS, 3 ml 5 M NaCl, and 24 ml ddH2O.
Au particle solution: Combine 20 μl 40 nm Au nanoparticle stock solution (Sigma) and 480 μl DNA-PAINT Buffer C.
Centrifuge with swinging-bucket rotor.
Imager strands (see Note 4.3.9): dilute from concentrated stocks directly into Buffer C to a final concentration of ∼ 0.1 to 10 nM.
A glass microscope slide if using a coverslip in place of a coverglass chamber slide.
3. Methods
3.1. Methods for synthesizing Oligopaint probes
All steps are carried out at room temperature, unless indicated otherwise.
3.1.1. Oligopaints: Limited cycle PCR (50 μl reaction; see Notes 4.1.1 and 2)
- Prepare on ice:
- 15 μl ddH2O.
- 25 μl Phusion Hot-start Master Mix.
- 2.5 μl 10 μM Forward primer.
- 2.5 μl 10 μM Reverse primer with T7 promoter sequence.
- 2.5 μl 1:50 dilution of Oligopaints library (see Note 4.1.3).
- 2.5 μl 20× EvaGreen.
- Run reactions on a real-time PCR machine, stopping the reaction for each tube while it is still in the exponential growth phase (i.e., before it reaches saturation). A calibration run may be necessary to identify when this will happen (see Notes 4.1.4 and 5).
- Incubate at 98°C for 3 minutes.
- Incubate at 98°C for 5 seconds.
- Incubate at 72°C for 20 seconds.
- Cycle through steps b and c approximately 15-25 times (see Note 4.1.4 regarding number of cycles).
- Recommended: validate PCR reaction by running 2 μl out on a 2% agarose borax gel.
- Dissolve 2 g agarose in 100 ml borax solution by boiling for 30 seconds.
- Cast the hot solution and let sit until gelled.
- A satisfying result will feature a single band, which will be more likely to happen if the PCR reaction does not saturate.
3.1.2. Oligopaints: PCR cleanup (50 μl reaction)
In a 1.5 ml tube, add 350 μL Zymo DNA binding buffer to ∼50 μL of PCR product.
Transfer to a Zymo DCC-5 column and spin at >10,000 g for 30 seconds.
Add 200 μl DNA Wash Buffer to column and spin at >10,000 g for 30 seconds.
Repeat the wash step.
Discard flow-through by aspirating the collection tube dry.
Spin at >10,000 g for 1 minute to remove residual buffer.
Transfer column to clean 1.5 ml tube.
Incubate at room temperature for 1 minute.
Elute DNA in 11 μl ddH2O.
3.1.3. Oligopaints: T7 reaction (30 μl reaction)
- Prepare on ice in RNase-free environment:
- 10 μl PCR product.
- 10 μl NTP buffer mix (from HiScribe kit).
- 2 μl T7 Pol Mix (from HiScribe kit).
- 1 μl RNase inhibitor.
- 7 μl ddH2O.
Incubate at 37°C for 4-16 hrs (see Note 4.1.6).
3.1.4. Oligopaints: RT reaction (70 μl reaction) (see Note 4.1.7)
- Prepare on ice in RNase-free environment:
- 7 μl dNTP (10 mM each).
- 14 μl Maxima H Minus RT buffer.
- 10 μl 100 μM unlabeled or labeled primer (see Note 4.1.8).
- 5 μl or less Maxima H Minus RT enzyme.
- 4 μl RNase inhibitor.
- 30 μl RNA from T7 reaction.
Incubate at 50°C for 1-2 hours (no pre-denaturing step required).
- Digest remaining RNA:
- Mix 1:1 0.5 M EDTA and 1 M NaOH.
- Add 50 μl of the NaOH-EDTA solution.
- Heat at 95°C for 10 minutes.
- Recommended: Test reaction product by running 2 ul out on a 15% urea TBE gel. Use urea-loading buffer.
- Run gel in 60°C water bath for ∼40 minutes to ensure probe is denatured. This allows for clear separation between the RT primer and the desired ssDNA probe.
- 80% or more incorporation of the RT primer would be a satisfying outcome.
3.1.5. Oligopaints: Probe cleanup
Add 240 μl Oligo binding buffer and mix. (The volume of Oligo binding buffer added should 2× the volume of the sample after step 3.1.4.3 2 × 120 μl = 240 μl).
Split volume evenly into two 1.5 ml tubes (180 μl per tube). To each tube add 480 μl of 100% ethanol and mix. (The total volume of ethanol added should be 8× the volume of the sample after step 3.1.4.3; 8 × 120 μl = 960 μl = 2 × 480 μl).
Transfer the solution of one tube to a Zymo DCC-25 column and spin at ≥10,000 g for 30 seconds. (Note, the maximum capacity of the column is 750 μl.) Dispose the flow-through, add contents of the second tube to the column, and spin again at ≥10,000g for 30 seconds (see Note 4.1.9).
Add 750 μl DNA Wash Buffer.
Spin at >10,000 g for 30 seconds and discard flow-through.
Spin at ≥10,000g for 30 seconds to remove excess buffer.
Transfer column to a clean 1.5 ml tube.
Elute in 30 μl ddH2O.
Measure final probe concentration.
3.2 Methods for preparing samples for OligoSTORM
All steps are carried at room temperature, unless indicated otherwise. Conduct all RNaseA work such that RNase A does not contaminate work areas and equipment.
3.2.1. OligoSTORM: Sample fixation
Prepare a sample of tissue culture cells adhered at desired confluency to a coverslip.
Gently rinse cells with 1× PBS by briefly immersing coverslip in a small petri dish containing the buffer and then placing into a fresh, dry petri dish.
Immediately add enough freshly prepared fixation solution to cover the cells and let stand for 10 minutes (see Notes 4.2.1 and 8).
Remove fixation solution and rinse the sample once or twice with 1× PBS (see Note 4.2.1).
3.2.2. OligoSTORM: Sample permeabilization (see Note 4.2.9)
Incubate fixed cells for 10 minutes in permeabilization solution.
Incubate for 2 minutes in 1× PBS.
Incubate for 5 minutes in 0.1 M HCl.
Wash 3× for 1 minute in PBS.
For DNA FISH only: incubate 1 hour at 37°C in RNaseA solution.
Wash 3× for 1 minute in 2× SSC.
Incubate for 35 minutes in 2× SSC + 50% vol/vol formamide and 0.1% Tween-20 (see Note 4.2.1).
Use sample directly in step 3.2.3. or store at 4°C. Coverslips may be stored at 4°C for several days.)
3.2.3. OligoSTORM: Sample denaturation and hybridization (assuming one sample)
- Prepare hybridization mix on ice (see Note 4.2.1):
- ∼100 pmol of Oligopaint oligos (see Note 4.2.3).
- 1 μl of 100 μM Reporter-labeled secondary oligo.
- Enough hybridization buffer to achieve a final volume of ∼20-70μl (see Notes 4.2.3 and 10).
Add ∼20-70 μl hybridization mix to a clean glass slide. It is important that enough solution is added such that, after the following step (3.2.3.3), all cells are exposed to the solution; too little solution results in air bubbles, where cells will not be exposed to hybridization mix.
Gently tap coverslip of cells dry on a Kimwipe. Invert coverslip carrying the cells onto the solution on the glass slide.
Seal edges of coverslip with rubber cement and allow the rubber cement to dry for 5 minutes (see Note 4.2.11).
Denature the slides at 78°C for 3 minutes (see Notes 4.2.5 and 12).
Hybridize overnight (see Note 4.2.13) at the hybridization temperature appropriate for the Oligopaint probe(s) being used (see Notes 4.2.6 and 14). If an air incubator is being used, place the sample in a humidified chamber (see Note 4.2.7).
3.2.4. OligoSTORM: Post-hybridization washes
Pre-warm 2× SSCT solution to 60°C.
Remove the coverslip and wash 2× for 10 minutes each in 2× SSCT at 60°C.
Incubate in 2× SSCT for 10 minutes.
Wash in 2× SSC.
Optional: Store in 2× SSC at 4°C for up to 2 weeks.
3.2.5 OligoSTORM: Mounting sample (see Notes 4.2.15 and 16)
- Make chambered slide:
- Adhere two strips of double stick tape along both long edges of a standard slide.
- Gently tap off excess fluid from coverslip and mount it on the doublestick tape (cells facing the slide).
Add STORM imaging buffer to side of coverslip and allow channel to fill by capillary action (see Note 4.2.17).
Seal coverslip to slide with nail polish.
3.3. Methods for preparing samples for OligoDNA-PAINT
Carry out all procedures at room temperature unless indicated otherwise. Conduct all RNaseA work such that RNase A does not contaminate work areas and equipment. If using a coverglass chamber slide, ∼75% maximum well volume can be used for all steps unless otherwise indicated; if using a coverslip, incubations and washes can be performed in a mini-staining jar or in a well of a 6-well tissue culture plate using a volume sufficient to fully immerse the coverslip unless otherwise indicated.
3.3.1. OligoDNA-PAINT: Sample fixation
Prepare a sample of tissue culture cells adhered at desired confluency to a coverglass chamber slide or a coverslip (see Notes 4.3.1 and 2).
Add enough 1× PBS to cover the cells and let stand for 1 minute.
Aspirate the 1× PBS and then add enough freshly prepared fixation solution to cover the cells and let stand for 10 minutes (see Notes 4.3.3 and 10).
Remove the fixation solution and rinse the sample with once or twice with 1× PBS (see Note 4.3.3).
3.3.2. OligoDNA-PAINT: Sample permeabilization (see Note 4.3.11)
Add freshly prepared permeabilization solution and incubate for 10 minutes.
Remove the Triton solution and incubate the sample with PBT for 2 minutes.
Remove the PBT and incubate the sample in 0.1 N HCl for 5 minutes.
Remove the HCl and rinse the sample twice with 2× SSCT.
Add freshly prepared 2× SSCT + 50% (vol/vol) formamide solution and incubate for 2 minutes (see Note 4.3.3).
Remove the solution from step 3.3.2.5, then add pre-warmed 2× SSCT + 50% (vol/vol) formamide and incubate at 60°C for 20 minutes (see Notes 4.3.3 and 12).
3.3.3. OligoDNA-PAINT: Sample denaturation and hybridization
- During 3.3.2.6, prepare a 100 μl hybridization mix (assuming one sample; if using a coverslip in place of a coverglass chamber slide, the reaction can be scaled down four-fold to a final volume of 25 μl.
- 50 μl deionized formamide (see Note 4.3.3).
- 25 μl 4× hybridization buffer.
- 4 μl 10 μg/μl RNase A.
- Enough Oligopaint oligos to reach a concentration of ∼1.6μM (see Note 4.3.5) ddH2O needed to raise the total volume to 100 μl.
When 3.3.2.6 is complete, remove the 2× SSCT + 50% (vol/vol) formamide solution and add the hybridization mix (see Note 4.3.3). If using a coverslip in place of a coverglass chamber slide, pipet the hybridization mix directly onto the coverslip, place a glass microscope slide on top of the coverslip, carefully invert the slide, and seal the coverslip to the slide with rubber cement.
Denature the sample at 78°C for 3 minutes (see Notes 4.3.6 and 13).
Hybridize overnight (see Note 4.3.14) at the hybridization temperature appropriate for the Oligopaint probe(s) being used (see Notes 4.3.7 and 15). If an air incubator is being used, place the sample in a humidified chamber (see Note 4.3.8).
3.3.4. OligoDNA-PAINT: Post-hybridization washes and preparation for imaging
Pre-warm 2× SSCT solution to 60°C.
Remove coverslip and then remove the hybridization mix (see Note 4.3.16).
Add pre-warmed 2× SSCT, incubate at 60°C for 5 minutes, and then remove 2× SSCT.
Repeat step 3.3.4.3 three additional times (for a total of four 5 minute washes).
Add 2× SSCT, incubate for 2 minutes at room temperature, and then remove 2× SSCT.
Repeat step 3.3.4.5 one additional time.
Add DAPI solution and incubate for 5 minutes.
Remove the DAPI solution and incubate the sample in DNA-PAINT Buffer C for 2 minutes.
Remove the DNA-PAINT Buffer C and add Au particle solution (see Note 4.3.17).
Spin the sample at 500 RCF in a swinging bucket centrifuge for 3 minutes (see Note 4.3.18).
Remove the Au particle solution and incubate the sample in DNA-PAINT Buffer C for 2 minutes.
Remove the DNA-PAINT Buffer C and add DNA-PAINT Buffer C containing DNA-PAINT imager strand. Optionally, the solution can include an oxygen-scavenging system (see Notes 4.3.9 and 19).
Place the sample on a microscope stage for imaging or store at 4°C for up to 2 weeks. Coverslips will need to be mounted onto a glass microscope slide prior to imaging (see Note 4.3.20). Take care to avoid adding anti-fade mounting media at this stage (see Note 4.3.21).
4. Notes
4.1. Notes for synthesizing Oligopaint probes
This step also serves as an early check on the quality of the Oligopaint library.
We recommend designing oligos with the minimum length that can satisfy the labeling requirements. This may improve the overall success of probe generation, including the step of amplification.
Oligo libraries vary in concentration of full product, which is not perfectly correlated with the reported concentration. However, these minor variations in concentration, which are due to library-synthesis and uncertainties in dilution, are generally not critical at this step.
For best results, users may wish to optimize the PCR conditions (e.g., template and primer concentrations), including determining at which rounds of amplification the exponential and saturation phases begin. In our experience, halting the reaction after 15-25 rounds has generally given satisfactory results.
You can increase the quantity of your stock of the Oligopaints library via PCR amplification of your raw library (e.g., the initial library received from a commercial source), using as few cycles as necessary (with ≤25 cycles as a guideline).
The T7 reaction saturates after approximately 4-6 hours. The RNA product remains stable for 16 hours. Thus, the suggested 4-16 hour reaction time allows for convenient time management of the protocol.
We did not include an RNA purification step between steps 3.1.3 and 3.1.4 as we have not found such a step to improve the outcome of reverse transcription. However, if RNA degradation is observed, we recommend purifying the RNA followed by polyacrylamide gel electrophoresis. Otherwise, users may wish to proceed immediately to the RT reaction after the in vitro transcription step has been completed, as RNA is more prone than ssDNA to degradation.
Use unlabeled primer when generating Oligopaint oligos for use in OligoDNA-PAINT (Fig. 1G) and labeled primer when generating Oligopaint oligos that carry a 5′ fluorophore, such as would be case for the dual-fluorophore variation of OligoSTORM (Fig. 1F). Fluorophores that we have found to be compatible with the RT step include AlexaFluor 405, AlexaFluor 488, AlexaFluor 647, Cy3, and Cy5.
For large scale probe cleanup, use the Zymo DCC-100 columns (1-10 nmol of primer). Scale up washes as directed by the manufacturer and elute probe in 100 μl of ddH2O. Concentrate sample using a SpeedVac concentrator or vacuum lyophilizer or by ethanol precipitation.
4.2. Notes for preparing samples for OligoSTORM
Paraformaldehyde and formamide are toxic and should be disposed of using appropriate hazardous waste streams.
Dextran sulfate can be difficult to get into solution, and thus users may wish to prepare the hybridization buffer with commercially available aqueous solutions of 50% dextran sulfate. (See Note 4.3.4 for another approach, which we have found useful when the desired final concentration of dextran sulfate is relatively high.)
The concentration of Oligopaint probe in the hybridization mix may need to be adjusted in order to optimize the ratio of signal to noise (SNR). Thus, while we have achieved good SNR using ∼100 pmol of probe per sample per ∼100 kb of genomic target (=5 μM Oligopaint oligos when dissolved in 20 μl hybridization mix), users may wish to adjust probe concentrations, keeping in mind that higher concentrations for any particular oligo species (targeting a single 30-42 base genomic target) may increase target occupancy, but overall higher concentration of all oligos, together, could increase background. (See Note 4.3.5 for our experience with respect to OligoDNA-PAINT.)
With regard to choice of reporter and activator fluorophores, we recommend Alexa647 as the reporter and Alexa405 as the activator for single color experiments and, for multicolor imaging, we recommend Alexa647 and Alexa750 as reporters and Alexa405 as the activator for both.
The heat source for denaturation can simply be an anodized aluminum heat block placed in a benchtop heating unit or immersed in a water bath. For more precise control, a flat-block thermocycler can be used.
A flat-block thermocycler can be used for the hybridization step and is the instrument of choice, as its heated lid prevents the evaporation of the hybridization mix.
A humidified chamber can help reduce sample drying. A simple humidified chamber can be prepared by placing 3-5 damp lab tissues in the bottom of a 10 cm diameter tissue culture dish. The coverglass chamber slide or microscope slide can get wet, provided the sample side does not come into contact with the lab tissues.
While the protocol includes a standard fixation time, users may wish to empirically determine optimal fixation times.
We recommend being gentle with the washes, as cells tend to lose adherence to the coverslip under flow even when the coverslips have been pre-treated with poly-D-lysine. Note that some cells adhere well on their own and, in such cases, it is not necessary to pretreat the coverslips.
The final volume will depend on the size of the coverslip. It is important that enough solution is added such that, after step 3.2.3.3, all cells are exposed to the solution; too little solution results in air bubbles, where cells will not be exposed to hybridization mix.
Sealing the edges of the coverslip with rubber cement is not an essential step and can be skipped, if desired.
While users may consider varying the temperature of denaturation, care should be taken to avoid temperatures that might excessively perturb chromatin structure.
Although not carefully documented, there is a general sense that long hybridization times, even up to 24 or 48 hours, may be beneficial when targeting large (on the order of Mbs) single copy regions.
The optimal hybridization temperature will vary from probe to probe and typically will range from 42°C for shorter probes (e.g., with ≤32 bases of genomic homology) to 52°C (e.g., with ≥40 bases of genomic homology).
Particularly when imaging large genomic targets, we recommend adding fiducial beads (e.g., 200 nm 540/560 FluorSpheres, ThermoFisher) to the samples prior to adding STORM imaging buffer in order to correct for stage drift during image acquisition. This can be achieved by rinsing the coverslip with a 2×SSC solution containing 100 nm beads labeled with a fluorophore that is spectrally distinct from the reporter.
For brighter and thus more accurate localization, we recommend adding 3 μl of 2M cyclooctatetraene in DMSO to the STORM imaging buffer [25] prior to adding the buffer to the sample. Note, this buffer ages very quickly.
Use the buffer that is appropriate for your fluorophore. For example, when using fluorophores that require thiol for switching, use an oxygen-scavenging buffer with a thiol [21].
4.3. Notes for preparing samples for OligoDNA-PAINT
With respect to sample preparation, we recommend using 8-well coverglass chambers, such as Lab-Tek II Chambered Coverglass (ThermoFisher) or iBiDi μ-slide (iBiDi), as these permit easy fluid exchange. Alternatively, a #1.5 coverslip (17 mm optimal thickness) can be used – in this case, a fine-tipped diamond scribe can be used for marking which side of the coverslip contains cells and the identity of the sample. In either case, the critical issue is simply that the FISH must be performed on a glass support that is very thin (17 mm optimal thickness). For those using coverslips, note that some microscope objectives include correction collars to account for different thicknesses of the glass support, in which case experienced users can opt to use a different thickness. Cells should not be placed on the surface of a slide and then mounted with a coverslip, as this configuration will place the cells too far from the microscope objective to observe single-molecule fluorescence events.
Tissue cultures of adherent cell lines can be distributed into 8-well coverglass chamber slides and further cultured. Alternatively, ∼100-200 μl of a 1 × 105 cells/ml suspension of cells can be deposited into the well of a coverglass chamber slide or onto the surface of a coverslip, after which cells should be allowed to adhere for 1-3 hours as described [5, 7, 8]. For loosely adherent and suspension cell lines, pre-treatment of the glass surface with poly-D-lysine [5, 7] may improve cell adherence.
Paraformaldehyde and formamide are toxic and should be disposed of using appropriate hazardous waste streams.
Dextran sulfate adds a considerable amount of powder volume upon solvation, so care needs to be taken when preparing this solution. First, add the appropriate volume of 20× SSC stock to reach a final dilution of 8× SSC (e.g. 8 ml of 20× SSC for 20 ml total volume of 4× hybridization buffer). Next, add ∼70% of the ddH2O that would be needed (e.g. 8.5 ml for 20 ml total volume). Then, add the dextran sulfate powder to this solution and mix overnight by inversion on a rotary shaker (e.g. 8 g dextran sulfate powder for 20 ml total volume). Once the dextran powder is fully dissolved, add the appropriate amount of Tween-20 to reach 0.8% (vol/vol) in the total volume (e.g. 160 μl for 20 ml) and enough ddH2O until the final volume (e.g. 20 ml) of hybridization buffer is reached. Mix again overnight by inversion on a rotary shaker.
The optimal hybridization mix will likely vary, as the optimal probe concentration may vary from probe to probe and target to target. If 1.6 μM does not lead to optimal results, concentrations as high as 32 μM can be tried. For example, dense samples and tissues often need ∼10× more probe than typical tissue culture samples. (See Note 4.2.3 for our experience with respect to OligoSTORM.)
The heat source for denaturation can simply be an anodized aluminum heat block placed in a benchtop heating unit or immersed in a water bath. For more precise control, a flat-block thermocycler can be used.
A flat-block thermocycler can be used for the hybridization step and is the instrument of choice, as its heated lid prevents the evaporation of the hybridization mix. If using an air incubator, larger hybridization volumes may be required to offset the evaporation that occurs during extended high-temperature incubation when using coverglass chamber slides. A 50% increase in hybridization volume is generally sufficient in our hands.
A humidified chamber can help reduce sample drying. A simple humidified chamber can be prepared by placing 3-5 damp lab tissues in the bottom of a 10 cm diameter tissue culture dish. The coverglass chamber slide or microscope slide can get wet, provided the sample side does not come into contact with the lab tissues.
Imager strands, added in DNA-PAINT Buffer C, are typically 9-10 base ssDNA oligos containing a 3′ Cy3B or ATTO655 fluorophore and are used at concentrations ranging from 0.1 to 10 nM. A detailed discussion of imager strands is provided elsewhere [12-14].
While the protocol includes a standard fixation time, users may wish to empirically determine optimal fixation times.
We recommend being gentle with the washes, as cells tend to lose adherence to the coverslip under flow even when the coverslips have been pre-treated with poly-D-lysine.
If using a coverslip in combination with a glass staining jar, place the staining jar containing 2× SSCT + 50% (vol/vol) formamide in the water bath at room temperature and allow the jar and water bath to heat up together. Likewise, after the step is complete, allow the jar and water bath to cool down together. Glass staining jars typically are not made of borosilicate glass and thus are heat labile and sometimes break upon large shifts in temperature.
While users may consider varying the temperature of denaturation, care should be taken to avoid temperatures that might excessively perturb chromatin structure.
Although not carefully documented, there is a general sense that long hybridization times, even up to 24 or 48 hours, may be beneficial when targeting large (on the order of Mbs) single copy regions.
The optimal hybridization temperature will vary from probe to probe and typically will range from 42°C for shorter probes (e.g., with ≤32 bases of genomic homology) to 52°C (e.g., with ≥40 bases of genomic homology).
If using coverglass chamber slides, adding ∼100-200 μl (space-allowing) of pre-warmed 2× SSCT makes it easier to remove the viscous hybridization mix.
The inclusion of fiducial markers, such as Au nanoparticles, enables the user to correct for drift during image acquisition.
Coverglass chamber slides can be taped to bucket attachments for multi-well plates. Coverslips can be placed in the well of a 6-well tissue culture plate and spun in the same bucket attachment.
An oxygen-scavenging system such as glucose oxidase/catalase or protocatechuic acid/protocatechuate-3,4-dioxygenase [26] may increase imaging performance.
A mounting chamber can be prepared by placing two strips of double-sided tape roughly 75% of the width of the coverslip apart on a microscope slide, such that the coverslip can sit between them while still leaving the majority of the surface untouched by the tape (cells should face downwards towards the microscope slide). Buffer can be pipetted into this channel, which can eventually be sealed on the open edges (i.e. the ones not contacting the tape) with nail polish or epoxy.
Note that OligoDNA-PAINT is typically performed in aqueous buffers such as 1× PBS, and that binding of the imager strand to the docking site may be impeded in the high viscosity anti-fade mounting media commonly added to diffraction-limited FISH samples being imaged with diffraction-limited light microscopy. Note, also, that some microscope auto-focus systems (e.g. those found on the Nikon N-STORM) are incompatible with anti-fade mounting media due to its high refractive index.
Acknowledgments
The authors would like to thank members of the Wu, Zhuang, and Yin laboratories for extensive conversations and experience. This work was supported by grants from the NIH to the laboratories of C-t W (GM085169, DP1GM106412, RM1HG008525), XZ (R01GM105637), and PY (1R01EB018659, 1-U01-MH106011), XZ is a Howard Hughes Medical Institute investigator. In addition, BJB and ANB were supported by Damon Runyon Postdoctoral Fellowships.
References
- 1.Huang B, Babcock H, Zhuang X. Breaking the diffraction barrier: Super-resolution imaging of cells. Cell. 2010;143:1047–1058. doi: 10.1016/j.cell.2010.12.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Sengupta P, Van Engelenburg S, Lippincott-Schwartz J. Visualizing cell structure and function with point-localization superresolution imaging. Dev Cell. 2012;23:1092–1102. doi: 10.1016/j.devcel.2012.09.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Thompson MA, Lew MD, Moerner WE. Extending microscopic resolution with single-molecule imaging and active control. Ann Rev Biophysics. 2012;41:321–342. doi: 10.1146/annurev-biophys-050511-102250. [DOI] [PubMed] [Google Scholar]
- 4.Godin AG, Lounis B, Cognet L. Super-resolution microscopy approaches for live cell imaging. Biophys J. 2014;107:1777–1784. doi: 10.1016/j.bpj.2014.08.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Beliveau BJ, Boettiger AN, Avendaño MS, Jungmann R, McCole RB, Joyce EF, Kim-Kiselak C, Bantignies F, Fonseka CY, Erceg J, Hannan MA, Hoang HG, Colognori D, Lee JT, Shih WM, Yin P, Zhuang X, Wu CT. Single-molecule super-resolution imaging of chromosomes and in situ haplotype visualization using Oligopaint FISH probes. Nat Commun. 2015;6:7147. doi: 10.1038/ncomms8147. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Boettiger AN, Bintu B, Moffitt JR, Wang S, Beliveau BJ, Fudenberg G, Imakaev M, Mirny LA, Wu Ct, Zhuang X. Super-resolution imaging reveals distinct chromatin folding for different epigenetic states. Nature. 2016;529:418–422. doi: 10.1038/nature16496. 2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Beliveau BJ, Joyce EF, Apostolopoulos N, Yilmaz F, Fonseka CY, McCole RB, Chang Y, Li JB, Senaratne TN, Williams BR, Rouillard JM, Wu CT. Versatile design and synthesis platform for visualizing genomes with Oligopaint FISH probes. Proc Natl Sci U S A. 2012;109:21301–21306. doi: 10.1073/pnas.1213818110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Beliveau BJ, Apostolopoulos NA, Wu CT. Visualizing genomes with Oligopaint FISH probes. Curr Protoc Mol Biol. 2014;105 doi: 10.1002/0471142727.mb1423s105. Unit 14.23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Rust M, Bates M, Zhuang X. Sub-diffraction-limit imaging by stochastic optical reconstruction microscopy (STORM) Nat Methods. 2006;3:793–6. doi: 10.1038/nmeth929. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Huang B, Wang W, Bates M, Zhuang X. Three-dimensional super-resolution imaging by stochastic optical reconstruction microscopy. Science. 2008;319:810–813. doi: 10.1126/science.1153529. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Bates M, Huang B, Dempsey G, Zhuang X. Multicolor super-resolution imaging with photo-switchable fluorescent probes. Science. 2007;317:1749–1753. doi: 10.1126/science.1146598. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Sharanov A, Hochstrasser RM. Wide-field subdiffraction imaging by accumulated binding of diffusing probes. Proc Natl Acad Sci U S A. 2006;103:18911–18916. doi: 10.1073/pnas.0609643104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Jungmann R, Steinhauer C, Scheible M, Kuzyk A, Tinnefeld P, Simmel FC. Single-molecule kinetics and super-resolution microscopy by fluorescence imaging of transient binding on DNA origami. Nano Lett. 2010;10:4756–4761. doi: 10.1021/nl103427w. [DOI] [PubMed] [Google Scholar]
- 14.Jungmann R, Avendaño MS, Woehrstein JB, Dai M, Shih WM, Yin P. Multiplexed 3D cellular super-resolution imaging with DNA-PAINT and Exchange-PAINT. Nat Methods. 2014;11:313–318. doi: 10.1038/nmeth.2835. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Bates M, Jones SA, Zhuang X. Stochastic Optical Reconstruction Microscopy (STORM) - A Method for Superresolution Fluorescence Imaging. In: Yuste R, editor. Imaging: A Laboratory Manual. Cold Spring Harbor Laboratory Press; 2010. [DOI] [PubMed] [Google Scholar]
- 16.Dai M, Jungmann R, Yin P. Optical imaging of individual biomolecules in densely packed clusters. Nat Nanotechnol. 2016;11:798–807. doi: 10.1038/nnano.2016.95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Jungmann R, Avendaño MS, Dai M, Woehrstein JB, Agasti SS, Feiger Z, Rodal A, Yin P. 2016 Quantitative super-resolution imaging with qPAINT. Nat Methods. 2016;13:439–42. doi: 10.1038/nmeth.3804. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Chen KH, Boettiger AN, Moffitt JR, Wang S, Zhuang X. Spatially resolved, highly multiplexed RNA profiling in single cells. Science. 2015;348:aaa6090. doi: 10.1126/science.aaa6090. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Wang S, Su JH, Beliveau BJ, Bintu B, Moffitt JR, Wu CT, Zhuang X. Spatial organization of chromatin domains and compartments in single chromosomes. Science. 2016;353:598–602. doi: 10.1126/science.aaf8084. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Bates M, Blosser TR, Zhuang X. Short-range spectroscopic ruler based on a single-molecule optical switch. Phys Rev Lett. 2005;94:108101. doi: 10.1103/PhysRevLett.94.108101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Dempsey GT, Vaughan JC, Chen KH, Bates M, Zhuang X. Evaluation of fluorophores for optimal performance in localization-based super-resolution imaging. Nat Methods. 2011;8:1027–1036. doi: 10.1038/nmeth.1768. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Murgha Y, Beliveau Bm Semrau K, Schwartz D, Wu CT, Gulari E, Rouillard JM. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries. Biotechniques. 2015;58:301–7. doi: 10.2144/000114298. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Moffit JR, Zhuang X. RNA imaging with multiplexed error-robust fluorescence in situ hybridization. Methods Enzymology. 2016;572:1–49. doi: 10.1016/bs.mie.2016.03.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Schmidt TL, Beliveau BJ, Uca YO, Theilmann M, Da Cruz F, Wu CT, Shih WM. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries. Nat Commun. 2015;6:8634. doi: 10.1038/ncomms9634. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Olivier N, Keller D, Gönczy P, Manley S. Resolution Doubling in 3D-STORM Imaging through Improved Buffers. PLoS One. 2013;8:e69004. doi: 10.1371/journal.pone.0069004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Aitken EC, Marshall RA, Puglisi JD. An Oxygen Scavenging System for Improvement of Dye Stability in Single-Molecule Fluorescence Experiments. Biophys J. 2008;94:826–183. doi: 10.1529/biophysj.107.117689. [DOI] [PMC free article] [PubMed] [Google Scholar]
