Skip to main content
NCBI home page
Japanese Journal of Cancer Research : Gann logoLink to Japanese Journal of Cancer Research : Gann
. 1996 Jul;87(7):735–742. doi: 10.1111/j.1349-7006.1996.tb00286.x

p53 Antisense Oligonucleotide Inhibits Growth of Human Colon Tumor and Normal Cell Lines

Yasuhide Hirota 1,✉, Tadashi Horiuchi 2, Kouichi Akahane 1
PMCID: PMC5921161  PMID: 8698624

Abstract

We examined the relationship between the expression of mutant p53 proteins and tumor cell growth using a p53 antisense oligonucleotide (5′‐CCCTGCTCCCCCCTGGCTCC‐3′). The oligonucleotide inhibited the growth of three human colon tumor cell lines (DLD‐1, SW620 and WiDr), which produce only mutant p53 proteins with different mutation sites. Treatment of DLD‐1 cells with the p53 antisense oligonucleotide caused a decrease in the level of p53 mutant protein. Synthesis of DNA in DLD‐1 and SW620 cells was inhibited more potently than that of RNA or protein after antisense treatment. Furthermore, these cells were accumulated in the S phase when DNA synthesis was inhibited. Meanwhile, the antisense oligonucleotide also inhibited the growth of three human normal cell lines (WI‐38, TIG‐1 and Intestine 407). While treatment of WI‐38 and TIG‐1 cells with the antisense oligonucleotide inhibited synthesis of DNA more potently than that of RNA or protein, these normal cells were accumulated in the G0/G1 phase. These results suggest that p53 proteins, either with or without mutation, play a pivotal role in the growth of tumor and normal cells, but that mutant and wild‐type p53 proteins may function differently in cell growth.

Keywords: p53 Antisense, Oligonucleotide, Cell cycle, Cell growth

Full Text

The Full Text of this article is available as a PDF (527.3 KB).

REFERENCE

  • 1.Hollstein , M. , Sidransky , D. , Vogelstein , B. and Harris , C. C.p53 Mutations in human cancers . Science , 253 , 49 – 53 ( 1991. ). [DOI] [PubMed] [Google Scholar]
  • 2.Levine , A. J. , Momand , J. and Finlay , C. A.The p53 tumour suppressor gene . Nature , 351 , 453 – 456 ( 1991. ). [DOI] [PubMed] [Google Scholar]
  • 3.Kastan , M. B. , Zhan , Q. , El‐Deiry , W. S. , Carrier , F. , Jacks , T. , Walsh , W. V. , Plunkett , B. S. , Vogelstein , B. and Fornace , A. J. J.A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia‐telangiectasia . Cell , 71 , 587 – 593 ( 1992. ). [DOI] [PubMed] [Google Scholar]
  • 4.Lane , D. P.p53, guardian of the genome . Nature , 358 , 15 – 16 ( 1992. ). [DOI] [PubMed] [Google Scholar]
  • 5.El‐Deiry , W. S. , Tokino , T. , Velculescu , V. E. , Levy , D. B. , Parsons , R. , Trent , J. M. , Lin , D. , Mercer , W. E. , Kinzler , K. W. and Vogelstein , B.WAF1, a potential mediator of p53 tumor suppression . Cell , 75 , 817 – 825 ( 1993. ). [DOI] [PubMed] [Google Scholar]
  • 6.Harper , J. W. , Adami , G. R. , Wei , N. , Keyomarsi , K. and Elledge , S. J.The p21 cdk‐interacting protein Cip1 is a potent inhibitor of G1 cyclin‐dependent kinases . Cell , 75 , 805 – 816 ( 1993. ). [DOI] [PubMed] [Google Scholar]
  • 7.Xlong , Y. , Hannon , G. J. , Zhang , H. , Casso , D. , Kobayashi , R. and Beach , D.p21 is a universal inhibitor of cyclin kinases . Nature , 366 , 701 – 704 ( 1993. ). [DOI] [PubMed] [Google Scholar]
  • 8.Bargonetti , J. , Freidman , P. N. , Kern , S. E. , Vogelstein , B. and Prives , C.Wild‐type but not mutant p53 immunopurified proteins bind to sequences adjacent to the SV40 origin of replication . Cell , 65 , 1083 – 1091 ( 1991. ). [DOI] [PubMed] [Google Scholar]
  • 9.Bargonetti , J. , Manfredi , J. , Chen , X. , Marshak , D. and Prives , C.A proteolytic fragment from the central region of p53 has marked sequence‐specific DNA‐binding activity when generated from wild‐type but not from oncogenic mutant p53 protein . Genes Dev ., 7 , 2565 – 2574 ( 1993. ). [DOI] [PubMed] [Google Scholar]
  • 10.Zambetti , G. P. , Bargonetti , J. , Walker , K. , Prives , C. and Levine , A. J.Wild‐type p53 mediates positive regulation of gene expression through a specific DNA sequence element . Genes Dev ., 6 , 1143 – 1152 ( 1992. ). [DOI] [PubMed] [Google Scholar]
  • 11.Finlay , C. A. , Hinds , P. W. and Levine , A. J.The p53 proto‐oncogene can act as a suppressor of transformation . Cell , 57 , 1083 – 1093 ( 1989. ). [DOI] [PubMed] [Google Scholar]
  • 12.Dittmer , D. , Pati , S. , Zambetti , G. , Chu , S. , Teresky , A. K. , Moore , M. , Finlay , C. and Levine , A. J.Gain of function mutations in p53 . Nat. Genet ., 4 , 42 – 46 ( 1993. ). [DOI] [PubMed] [Google Scholar]
  • 13.Shaulsky , G. , Goldfinger , N. and Rotter , V.Alterations in tumour development in vivo mediated by expression of wild‐type or mutant p53 proteins . Cancer Res ., 51 , 5232 – 5237 ( 1991. ). [PubMed] [Google Scholar]
  • 14.Wolf , D. , Admon , S. , Oren , M. and Rotter , V.Abelson murine leukemia virus‐transformed cells that lack p53 protein synthesis expression aberrant p53 mRNA species . Mol. Cell. Biol ., 4 , 552 – 558 ( 1984. ). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Chen , P.‐L. , Chen , Y. , Bookstein , R. and Lee , W.‐H.Genetic mechanisms of tumor suppression by the human p53 gene . Science , 250 , 1576 – 1580 ( 1990. ). [DOI] [PubMed] [Google Scholar]
  • 16.Peacock , J. W. and Benchimol , S.Mutation of the endogenous p53 gene in cells transformed by HPV‐16 E7 and EJ c‐ras confers a growth advantage involving an autocrine mechanism . EMBO J ., 13 , 1084 – 1092 ( 1994. ). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Bayever , E. , Iversen , P. , Smith , L. , Spinolo , J. and Zon , G.Guest editorial: systemic human antisense therapy begins . Antisense Res. Dev ., 2 , 109 – 110 ( 1992. ). [DOI] [PubMed] [Google Scholar]
  • 18.Bayever , E. , Haines , K. , Iversen , P. L. , Ruddon , R. W. , Pirruccello , S. J. , Mountjoy , C. P. , Arneson , M. A. and Smith , L. J.Selective cytotoxicity to human leukemic myeloblasts produced by oligonucleotide phosphothioates complementary to p53 nucleotide sequences . Leuk. Lymphoma , 12 , 223 – 231 ( 1994. ). [DOI] [PubMed] [Google Scholar]
  • 19.Shaulian , E. , Zauberman , A. , Ginsberg , D. and Oren , M.Identification of a minimal transforming domain of p53: negative dominance through abrogation of sequence‐specific DNA binding . Mol. Cell. Biol ., 12 , 5581 – 5592 ( 1992. ). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Rodrigues , N. R. , Rowan , A. , Smith , M. E. F. , Kerr , I. B. , Bodmer , W. F. , Gannon , J. V. and Lane , D. Pp53 Mutations in colorectal cancer . Proc. Natl. Acad. Sci. USA , 87 , 7555 – 7559 ( 1990. ). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Crooke , R. M.In vitro toxicology and pharmacokinetics of antisense oligonucleotides . Anti-cancer Drug Design , 6 , 609 – 646 ( 1991. ). [PubMed] [Google Scholar]
  • 22.Barker , S. J. , Markowitz , S. , Fearon , E. R. , Willson , J. K. V. and Vogelstein , B.Suppression of human colorectal carcinoma cell growth by wild‐type p53 . Science , 249 , 912 – 915 ( 1990. ). [DOI] [PubMed] [Google Scholar]
  • 23.Hara , E. , Tsurui , H. , Shinozaki , A. , Nakada , S. and Oda , K.Cooperative effect of antisense‐Rb and antisense‐p53 oligomers on the extension of life span in human diploid fibroblasts, TIG‐1 . Biochem. Biophys. Res. Commun ., 179 , 528 – 534 ( 1991. ). [DOI] [PubMed] [Google Scholar]
  • 24.Deppert , W. , Buschhausen‐Danker , G. , Patschinsky , T. and Steinmeyer , K.Cell cycle control of p53 in normal (3T3) and chemically transformed (Meth A) mouse cells. II. Requirement for cell cycle progression . Oncogene , 5 , 1701 – 1706 ( 1990. ). [PubMed] [Google Scholar]
  • 25.Mercer , W. E. , Nelson , D. , Deleo , A. B. , Old , L. J. and Baserga , R.Microinjection of monoclonal antibody to protein p53 inhibits serum‐induced DNA synthesis in 3T3 cells . Proc. Natl. Acad. Sci. USA , 79 , 6309 – 6312 ( 1982. ). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Mercer , W. E. , Avignolo , C. and Baserga , R.Role of the p53 protein in cell proliferation as studied by microinjection of monoclonal antibodies . Mol. Cell. Biol ., 4 , 276 – 281 ( 1984. ). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Shohat , O. , Greenberg , M. , Reisman , D. , Oren , M. and Rotter , V.Inhibition of cell growth mediated by plasmids encoding p53 anti‐sense . Oncogene , 1 , 277 – 283 ( 1987. ). [PubMed] [Google Scholar]
  • 28.Donehower , L. A. , Harvey , M. , Slagle , B. , McArthur , M. , Montgomery , C. A. J. , Butel , J. S. and Brafley , A.Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours . Nature , 356 , 215 – 221 ( 1992. ). [DOI] [PubMed] [Google Scholar]
  • 29.Dutta , A. , Ruppert , J. M. , Aster , J. C. and Winchester , E.Inhibition of DNA replication factor RPA by p53 . Nature , 365 , 79 – 82 ( 1993. ). [DOI] [PubMed] [Google Scholar]
  • 30.Kanda , T. , Segawa , K. , Ohuchi , N. , Mori , S. and Ito , Y.Stimulation of polyomavirus DNA replication by wild‐type p53 through the DNA‐binding site . Mol. Cell. Biol ., 14 , 2651 – 2663 ( 1994. ). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Li , R. and Botchan , M. R.The acidic transcriptional activation domains of VP16 and p53 bind the cellular replication protein A and stimulate in vitro BPV‐1 DNA replication . Cell , 73 , 1207 – 1221 ( 1993. ). [DOI] [PubMed] [Google Scholar]
  • 32.Lin , D. , Shields , M. T. , Ullrich , S. J. , Appella , E. and Mercer , W. E.Growth arrest induced by wild‐type p53 protein blocks cells prior to or near the restriction point in late G1 phase . Proc. Natl. Acad. Sci. USA , 89 , 9210 – 9214 ( 1992. ). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Mercer , W. E. , Shields , M. T. , Amin , M. , Sauve , G. J. , Appela , E. and Ullrich , S. J.Negative growth regulation in a glioblastoma tumor cell line that conditionally expresses human wild‐type p53 . Proc. Natl. Acad. Sci. USA , 87 , 6166 – 6170 ( 1990. ). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Mercer , W. E. , Shields , M. T. , Lin , D. , Appella , E. and Ullrich , S. J.Growth suppression induced by wild‐type p53 protein is accompanied by selective down‐regulation of proliferating‐cell nuclear antigen expression . Proc. Natl. Acad. Sci. USA , 88 , 1958 – 1962 ( 1991. ). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Donehower , L. A. and Bradley , A.The tumor suppressor p53 . Biochem. Biophys. Acta , 1155 , 181 – 205 ( 1993. ). [DOI] [PubMed] [Google Scholar]
  • 36.Hupp , T. R. , Meek , D. W. , Midgley , C. A. and Lane , D. P.Regulation of the specific DNA binding function of p53 . Cell , 71 , 875 – 886 ( 1992. ). [DOI] [PubMed] [Google Scholar]
  • 37.Milner , J. A.conformational hypothesis for the suppressor and promoter functions of p53 in cell growth and in cancer . Proc. R. Soc. Lond. B , 245 , 139 – 145 ( 1991. ). [DOI] [PubMed] [Google Scholar]
  • 38.Ullrich , S. J. , Anderson , C. W. , Mercer , W. E. and Appella , E.The p53 tumor suppressor protein, a modulator of cell proliferation . J. Biol. Chem ., 267 , 15259 – 15262 ( 1992. ). [PubMed] [Google Scholar]

Articles from Japanese Journal of Cancer Research : Gann are provided here courtesy of Wiley

RESOURCES