Skip to main content
NCBI home page
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2018 Apr 26;62(5):e02642-17. doi: 10.1128/AAC.02642-17

Heavy Metal Resistance Genes Are Associated with blaNDM-1- and blaCTX-M-15-Carrying Enterobacteriaceae

Qiu E Yang a,✉, Siham Rajab Agouri a, Jonathan Mark Tyrrell a, Timothy Rutland Walsh a,✉
PMCID: PMC5923091  PMID: 29507071

ABSTRACT

The occurrence of heavy metal resistance genes in multiresistant Enterobacteriaceae possessing blaNDM-1 or blaCTX-M-15 genes was examined by PCR and pulsed-field gel electrophoresis with S1 nuclease. Compared with clinical susceptible isolates (10.0% to 30.0%), the pcoA, merA, silC, and arsA genes occurred with higher frequencies in blaNDM-1-positive (48.8% to 71.8%) and blaCTX-M-15-positive (19.4% to 52.8%) isolates, and they were mostly located on plasmids. Given the high association of metal resistance genes with multidrug-resistant Enterobacteriaceae, increased vigilance needs to be taken with the use of heavy metals in hospitals and the environment.

KEYWORDS: heavy metal resistance, blaNDM-1, blaCTX-M-15, plasmids, coresistance

TEXT

The increasing spread of multidrug-resistant superbugs in clinical environments has prompted worldwide concern, because antibiotic resistance genes, such as blaNDM-1 and blaCTX-M-15, limit treatment options to combat bacterial infections (1–4). Note that in addition to emerging antibiotic resistance, heavy metals represent another major source of environmental contamination that may select for antibiotic resistance (5). Heavy metal compounds for growth promotion and therapeutic treatment, like zinc and copper, have been used in pig and poultry production; and unlike antibiotic food additives, metals can accumulate in soil, water, aquacultural and marine antifouling treatments, and industrial effluent (6). It has been proposed that antibiotic-resistant bacteria are enriched at locations contaminated with metals, and genes conferring coselection to heavy metals and antibiotics are often found together in many clinical isolates (7–11). Furthermore, genes conferring heavy metal tolerance may coexist on the same genetic element (e.g., plasmid), which may further promote codissemination and resistance (10, 12). Here, we characterize the phenotype and genotype of heavy metal resistance in a collection of clinical Gram-negative isolates, including Klebsiella pneumoniae, Escherichia coli, Enterobacter cloacae, Klebsiella oxytoca, and Providencia stuanti, isolated from the United Kingdom and India.

A total of 95 nonduplicate isolates were tested in this study (Table 1): 39 blaNDM-1-positive isolates originated from human lower respiratory and urinary tract samples from the United Kingdom and Chennai and Haryana, India, as previously described (13); 36 blaCTX-M-15-carrying isolates originated from patients with burns, bacteremia, and urinary tract infections (UTIs) from various Indian hospitals (Haryana, Mumbai, Kolkata, Kerala, Delhi, and Vellore); and 20 control E. coli and K. pneumoniae isolates susceptible to all known antibiotic classes as control samples were provided by Specialist Antimicrobial Chemotherapy Unit (SACU), Public Health Wales. MICs of four heavy metal ions, i.e., CuSO4.5H2O for copper (Cu2+), HgCl2 for mercury (Hg2+), AgNO3 for silver (Ag+), and AsNaO2 for arsenic (As3+), were measured by agar dilution using Mueller-Hinton agar (Becton Dickinson, USA). E. coli (ATCC 25922) was used as a negative control. MIC levels of ≥10 mM for Cu2+, ≥2 mM for As3+, ≥32 μM for Hg2+, and ≥ for 128 μM Ag+ were regarded as resistance (8, 14, 15). High MIC values for Cu2+ (10 mM), As3+ (20 mM), and Hg2+ (128 μM) were obtained in most of the blaNDM-1-positive isolates, with high resistance rates of 79.5% (31/39), 76.9% (30/39), and 64.1% (25/39), respectively. Similarly, with blaCTX-M-15-positive strains, 91.7% (33/36), 63.9% (23/36), and 52.8% (19/36) of isolates were resistant to Cu2+, As3+, and Hg2+, respectively. High MIC values (128 to 256 μM) for Ag+ were observed for all isolates. Antibiotic-susceptible control strains also gave high rates of resistance to Cu2+ (90% [18/20]) but remained sensitive to Hg2+ (15.0% [3/20]) and As3+ (25.0% [5/20]).

TABLE 1.

Phenotypic and genotypic resistances to heavy metals in 95 clinical strains in this study

Strain and identification no. Bacterial organism Phenotype (MIC)
 Genotype
Ag (μM) Hg (μM) Cu (mM) As (mM)
blaNDM-1 (n = 39)
    N1 K. pneumoniae 128 128 10 0.625 merA, silC
    N2 K. pneumoniae 128 128 10 2.5 arsA, merA
    N3 C. freundii 128 128 10 2.5 arsA, merA
    N4 E. cloacae 128 16 10 20 pcoA, silC
    N5 Enterobacter spp. 128 16 5 1.25 Negative
    N6 E. coli 128 128 10 20 arsA, merA, pcoA, silC
    N7 K. pneumoniae 128 128 10 10 arsA, merA, pcoA, silC
    N8 K. pneumoniae 128 128 10 20 arsA, merA, pcoA, silC
    N9 K. pneumoniae 128 16 10 0.625 pcoA, silC
    N10 K. pneumoniae 128 16 10 0.625 silC
    N11 K. pneumoniae 128 16 10 0.625 silC
    N12 K. pneumoniae 256 128 10 10 arsA, merA, pcoA, silC
    N13 C. freundii 256 128 10 10 arsA, merA, pcoA, silC
    N14 E. coli 128 128 10 10 arsA, merA, pcoA, silC
    N15 E. coli 128 16 5 1.25 pcoA, silC
    N16 K. pneumoniae 128 128 10 1.25 arsA, merA, pcoA,silC
    N17 K. pneumoniae 128 128 10 20 arsA, merA, pcoA, silC
    N18 K. pneumoniae 128 64 10 10 arsA, merA, pcoA, silC
    N19 K. pneumoniae 128 128 10 20 arsA, merA, pcoA, silC
    N20 E. coli 128 16 5 2.5 Negative
    N21 K. pneumoniae 128 128 10 2.5 merA, pcoA, silC
    N22 K. pneumoniae 128 128 10 2.5 merA, pcoA, silC
    N23 E. coli 128 128 5 0.625 Negative
    N26 Enterobacter spp. 128 128 10 10 arsA, merA, pcoA
    N27 K. pneumoniae 128 128 5 10 arsA, merA, pcoA, silC
    N28 K. oxytoca 128 16 10 5 arsA, merA, pcoA, silC
    N29 E. coli 128 16 10 10 arsA, silC
    N31 E. cloacae 128 16 10 20 pcoA, arsA, silC
    N32 E. cloacae 128 16 10 0.625 pcoA, silC, merA, arsA
    K15 K. pneumoniae 128 16 10 5 merA, pcoA, silC
    K7 K. pneumoniae 128 128 10 2.5 merA, pcoA, silC
    IR25 K. pneumoniae 128 128 10 5 merA
    IR18k K. pneumoniae 128 128 10 20 merA
    IR28k K. pneumoniae 128 128 10 20 merA, pcoA, silC
    IR29 E. coli 128 128 5 5 merA, pcoA, silC
    IR26 E. coli 128 128 5 5 Negative
    IR22 E. coli 128 16 5 5 Negative
    IR61 K. oxytoca 128 16 10 20 Negative
    IR5 E. coli 128 128 10 20 arsA, merA, pcoA, silC
blaCTX-M-15 (n = 36)
    A5/3 K. pneumoniae 128 16 10 5 arsA, pcoA, silC
    A5/7 K. pneumoniae 128 128 10 20 arsA, merA, pcoA, silC
    A5/4 K. pneumoniae 128 128 5 5 pcoA, silC
    C5/8 K. pneumoniae 128 64 10 0.625 arsA, merA
    C5/7 K. pneumoniae 128 128 10 10 arsA, merA, pcoA, silC
    C5/5 K. pneumoniae 128 16 10 5 Negative
    D5/12 K. pneumoniae 128 128 10 0.15 merA
    D5/4 K. pneumoniae 128 16 10 0.625 pcoA, arsA
    E5/14 K. pneumoniae 128 16 10 5 merA, pcoA, silC
    E5/17 K. pneumoniae 128 128 10 2.5 arsA, merA, pcoA, silC
    G5/2 K. pneumoniae 128 16 10 5 arsA, pcoA, silC
    G5/6 K. pneumoniae 128 128 10 0.3 merA
    G5/11 K. pneumoniae 128 128 10 0.3 merA, pcoA, silC
    I5/5 K. pneumoniae 128 128 10 20 merA, pcoA, silC
    F5/6 K. pneumoniae 128 16 10 0.3 Negative
    E5/19 K. pneumoniae 128 128 10 5 merA, pcoA, silC
    A4/8 E. coli 128 16 10 0.3 Negative
    F4/3 E. coli 128 16 10 5 Negative
    B4/6 E. coli 128 16 10 2.5 Negative
    A4/11 E. coli 128 16 10 5 Negative
    C4/3 E. coli 128 128 10 2.5 merA
    E4/4 E. coli 128 128 10 2.5 Negative
    D4/12 E. coli 128 16 10 2.5 merA
    C4/12 E. coli 128 64 10 2.5 merA
    G4/12 E. coli 128 16 10 2.5 Negative
    I4/9 E. coli 128 128 10 2.5 merA
    I4/3 E. coli 128 16 10 0.3 Negative
    I4/13 E. coli 128 16 5 2.5 merA, pcoA, silC
    H4/5 E. coli 128 16 10 0.3 Negative
    H6/20 Salmonella spp. 128 128 10 0.15 Negative
    G6/9 Salmonella spp. 128 16 10 0.625 merA, pcoA, silC
    G6/13 Salmonella spp. 128 64 10 0.15 merA, silC
    I2/5 Enterobacter spp. 128 128 10 20 pcoA, silC
    I2/2 Enterobacter spp. 128 128 10 20 pcoA, silC
    F2/6 Enterobacter spp. 128 128 0.625 0.15 merA
    B1/10 P. stuanti 128 128 10 20 merA
Susceptible (n = 20)
    Kpff160 K. pneumoniae 128 128 10 10 arsA, merA, pcoA, silC
    Kpff217 K. pneumoniae 128 16 10 0.3 pcoA, silC
    KpFF11 K. pneumoniae 128 128 10 5 arsA, merA, pcoA, silC
    KpFF197 K. pneumoniae 128 16 10 0.625 silC
    KpFF177 K. pneumoniae 128 16 10 0.3 pcoA
    KpFF296 K. pneumoniae 128 16 10 10 arsA, pcoA, silC
    KpFF101 K. pneumoniae 256 16 10 10 Negative
    KpFF264 K. pneumoniae 128 16 10 0.15 Negative
    KpFF267 K. pneumoniae 128 16 10 0.15 Negative
    KpFF153 K. pneumoniae 128 16 10 0.3 pcoA
    Ec66 E. coli 128 8 10 0.15 Negative
    Ec9 E. coli 128 16 10 0.15 Negative
    Ec63 E. coli 128 8 10 0.15 Negative
    Ec59 E. coli 128 8 5 0.15 Negative
    Ec60 E. coli 128 16 5 0.15 Negative
    Ec166 E. coli 128 8 10 0.15 Negative
    Ec284 E. coli 128 8 10 0.625 Negative
    Ec61 E. coli 128 128 10 5 Negative
    Ec141 E. coli 128 16 10 0.15 Negative
    Ec98 E. coli 128 16 10 0.15 Negative
Transconjugants and controls
    25922 E. coli 64 16 5 0.15 Negative
    GFP E. coli 64 16 5 1.25 Negative
    TCE5/19 E. coli 64 16 5 2.5 pcoA
    TCN12 E. coli 128 64 5 10 arsA, pcoA, merA
    TCN22 E. coli 128 8 5 2.5 pcoA
Open in a new tab

The presence of four heavy metal resistance genes was confirmed by PCR: merA for Hg2+, arsA for As3+, pcoA for Cu2+, and silC for Ag+. Primers were designed by primer 3 (Geneious Pro 5.5.6) and the NCBI primer designing tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) (Table 2). PCRs were performed under the following conditions: initial denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 45 s, annealing at 58°C to 60°C for 45 s and extension at 72°C for 45 s, and final extension at 72°C for 5 min. The purified PCR products were randomly selected for following sequencing analyses (Eurofins Genomics, Germany). The silC, merA, pcoA, and arsA genes were dispersed throughout our blaNDM-1-positive isolates, with 28/39 (71.8%), 26/39 (66.7%), 25/39 (64.1%), and 19/39 (48.7%), respectively (Fig. 1). Similarly, in blaCTX-M-15-producing isolates, the most prevalent heavy metal resistance gene was merA (19/36 [52.8%]). The genes arsA, pcoA, and silC were only detected in 7 (19.4%), 15 (41.7%), and 15 (41.7%) isolates, respectively. In contrast, the relatively low prevalences of pcoA, silC, arsA, and merA genes were identified in susceptible isolates, with detection rates of 30.0% (6/20), 25.0% (5/20), 20% (4/20), and 10% (2/20), respectively (Fig. 1). In addition, statistical comparisons with these metal resistance genes in three groups of isolates were conducted using chi-square and Fisher's exact tests, where a P value of ≤0.05 was considered significant. The prevalences of silC (71.8% versus 25.0%; P = 0.0009), merA (66.7% versus 10.0%; P < 0.0001), pcoA (64.1% versus 30.0%; P = 0.0158), and arsA (48.7% versus 20.0%; P = 0.0482) genes detected in blaNDM-1-positive isolates were all markedly higher than those in susceptible isolates. Furthermore, the detection rates of silC (71.8% versus 41.7%; P = 0.0108) and arsA (48.7% versus 19.4%; P = 0.0144) in blaNDM-1-positive isolates were significantly higher than those in blaCTX-M-15- producing isolates (Fig. 1).

TABLE 2.

Details of primers used for heavy metal resistance gene detection in this study

Metal ion Primer Sequence (5′→3′) Temperature (°C) Size (bp) GenBank accession no. or GeneID
Hg2+ merA_F1 CTGCGCCGGGAAAGTCCGTT 58 1,035 DQ126685
merA_R1 GCCGATGAGCCGTCCGCTAC
merA_F2 GAGCTTCAACCCTTCGACCA 60 849 575669924
merA_R2 AGCGAGACGATTCCTAAGCG
As3+ arsA_F1 CAGTACCGACCCGGCCTCCA 58 861 CP000648
arsA_R1 AGGCCGTGTTCACTGCGAGC
arsA_F2 GGCTGGAAAAACAGCGTGAG 58 1,002 387605479
arsA_R2 CCTGCAAATTAGCCGCTTCC
Cu2+ pcoA_F CGGCCAGGTTCACGTCCGTC 58 1,371 NC_009649
pcoA_R TGCCAGTTGCCGCATCCCTG
Ag+ silC_F1 CGTAGCGCAAGCGTGTCGGA 58 1,090 NC_009649
silC_R1 ATATCAGCGGCCCGCAGCAC
silC_F2 TTCAACGTCACGGATGCAGA 60 872 157412014
silC_R2 AGCGTGTCGGAAACATCCTT
Open in a new tab

FIG 1.

FIG 1

Open in a new tab

Occurrence of heavy metal resistance genes in 95 clinical isolates. P values were calculated using chi-square and Fisher's exact tests. *, 0.01 < P ≤ 0.05; **, 0.001 < P ≤ 0.01; ***, P ≤ 0.001. ns, not significant.

Previous studies have proposed the role of plasmids in conferring resistance to both antibiotics and heavy metals (7, 16, 17). In this study, the locations of the pcoA, merA, silC, and arsA genes were analyzed by pulsed-field gel electrophoresis with S1 nuclease (S1-PFGE) (Invitrogen Abingdon, UK). In brief, isolates carrying heavy metal resistance genes were randomly selected, and genomic DNA in agarose blocks was digested with S1 nuclease and probed. In-gel hybridization was performed with pcoA, merA, silC, and arsA gene probes labeled with 32P with a random primer method (Stratagene, Amsterdam, Netherlands). The results showed that pcoA, merA, silC, and arsA genes are located on a diverse range of plasmid backbones, differing from 50 to 500 kb in size (Fig. 2; see also Fig. S1 in the supplemental material). Heavy metal resistance genes were carried on more than one plasmid in many strains, and chromosomally located genes were identified (Fig. 2 and Fig. S1), suggesting significant plasticity.

FIG 2.

FIG 2

Open in a new tab

PFGE analysis of blaNDM-1-positive strains digested with S1 nuclease and hybridization with the pcoA gene probe (a) and silC gene probe (b). (a) Isolate order of lanes 1 to 14: N1, N2, N3, N4, N5, N6, N7, N8, N9, N10, N11, N12, N13, and N14. (b) Isolate order of lanes 1 to 14: N16, N17, N18, N19, N20, N21, N22, N23, 3, 26, N27, N28, N29, N31.

Conjugation experiments were performed, as described previously (13), to investigate cotransfer of heavy metal and antibiotic resistance genes. Conjugations were performed with blaNDM-1- and blaCTX-M-15-positive donors with the rifampin-resistant recipient E. coli UAB190. Selection of blaCTX-M-15-positive transconjugants was performed on Brilliance UTI clarity agar (Oxoid, Ltd., Basingstoke, UK) supplemented with rifampin 100 mg/liter (Sigma-Aldrich, St. Louis, MO, USA) and cefotaxime 2 mg/liter. blaNDM-1-positive transconjugants were selected using rifampin with meropenem 0.5 mg/liter (AstraZeneca, London, UK). PCR for blaNDM-1 and blaCTX-M-15 genes was used for further confirmation of gene transfer (13, 18). Plasmid incompatibility groups were characterized by PCR-based replicon typing as previously described (19). A total of 18 and 14 transconjugants were obtained in E. coli UAB190 from 39 blaNDM-1 and 36 blaCTX-M-15 isolates, respectively. In 11 of 18 transconjugants, blaNDM-1 was located on IncA/C-type plasmids; 78.6% (11/14) of plasmids carrying blaCTX-M-15 belonged to IncFII, reflective of global molecular epidemiology (2, 20). Plasmids carrying blaNDM-1 from 6 transconjugants could not be typed. The heavy metal resistance genes arsA, merA, and pcoA were found on 2 blaNDM-1- and 1 blaCTX-M-15-positive plasmids, respectively (Table 1).

Our data indicate the abundance and mobility of heavy metal resistance genes (pcoA, merA, silC, and arsA) that can contribute to antibiotic-resistant gene dissemination and maintenance. Furthermore, many of these genes are found on transmissible plasmids. Therefore, our findings suggest that the coselection of heavy metal resistance genes in blaNDM-1- and blaCTX-M-15-positive isolates has significant implications for hospital and environmental (industrial waste) contamination with heavy metals.

Supplementary Material

Supplemental material
supp_62_5_e02642-17__index.html (814B, html)

ACKNOWLEDGMENTS

Q.E.Y. was funded by a CSC scholarship, and T.R.W. was funded by HEFC. T.R.W. and Q.E.Y. were also supported by MRC grant DETER-XDR-China (MR/P007295/1).

We have no conflicts of interest to declare.

Footnotes

Supplemental material for this article may be found at https://doi.org/10.1128/AAC.02642-17.

REFERENCES

  • 1.Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K, Walsh TR. 2009. Characterization of a new metallo-beta-lactamase gene, bla(NDM-1), and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother 53:5046–5054. doi: 10.1128/AAC.00774-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Canton R, Coque TM. 2006. The CTX-M beta-lactamase pandemic. Curr Opin Microbiol 9:466–475. doi: 10.1016/j.mib.2006.08.011. [DOI] [PubMed] [Google Scholar]
  • 3.Moellering RC., Jr 2010. NDM-1–a cause for worldwide concern. N Engl J Med 363:2377–2379. doi: 10.1056/NEJMp1011715. [DOI] [PubMed] [Google Scholar]
  • 4.Walsh TR, Weeks J, Livermore DM, Toleman MA. 2011. Dissemination of NDM-1 positive bacteria in the New Delhi environment and its implications for human health: an environmental point prevalence study. Lancet Infect Dis 11:355–362. doi: 10.1016/S1473-3099(11)70059-7. [DOI] [PubMed] [Google Scholar]
  • 5.Silver S, Phung LT. 1996. Bacterial heavy metal resistance: new surprises. Annu Rev Microbiol 50:753–789. doi: 10.1146/annurev.micro.50.1.753. [DOI] [PubMed] [Google Scholar]
  • 6.Wales AD, Davies RH. 2015. Co-selection of resistance to antibiotics, biocides and heavy metals, and its relevance to foodborne pathogens. Antibiotics (Basel) 4:567–604. doi: 10.3390/antibiotics4040567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Baker-Austin C, Wright MS, Stepanauskas R, McArthur JV. 2006. Co-selection of antibiotic and metal resistance. Trends Microbiol 14:176–182. doi: 10.1016/j.tim.2006.02.006. [DOI] [PubMed] [Google Scholar]
  • 8.Fard RM, Heuzenroeder MW, Barton MD. 2011. Antimicrobial and heavy metal resistance in commensal enterococci isolated from pigs. Vet Microbiol 148:276–282. doi: 10.1016/j.vetmic.2010.09.002. [DOI] [PubMed] [Google Scholar]
  • 9.Ji X, Shen Q, Liu F, Ma J, Xu G, Wang Y, Wu M. 2012. Antibiotic resistance gene abundances associated with antibiotics and heavy metals in animal manures and agricultural soils adjacent to feedlots in Shanghai; China. J Hazard Mater 235–236:178–185. [DOI] [PubMed] [Google Scholar]
  • 10.Seiler C, Berendonk TU. 2012. Heavy metal driven co-selection of antibiotic resistance in soil and water bodies impacted by agriculture and aquaculture. Front Microbiol 3:399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Dhakephalkar PK, Chopade BA. 1994. High levels of multiple metal resistance and its correlation to antibiotic resistance in environmental isolates of Acinetobacter. Biometals 7:67–74. [DOI] [PubMed] [Google Scholar]
  • 12.Akinbowale OL, Peng H, Grant P, Barton MD. 2007. Antibiotic and heavy metal resistance in motile aeromonads and pseudomonads from rainbow trout (Oncorhynchus mykiss) farms in Australia. Int J Antimicrob Agents 30:177–182. doi: 10.1016/j.ijantimicag.2007.03.012. [DOI] [PubMed] [Google Scholar]
  • 13.Kumarasamy KK, Toleman MA, Walsh TR, Bagaria J, Butt F, Balakrishnan R, Chaudhary U, Doumith M, Giske CG, Irfan S, Krishnan P, Kumar AV, Maharjan S, Mushtaq S, Noorie T, Paterson DL, Pearson A, Perry C, Pike R, Rao B, Ray U, Sarma JB, Sharma M, Sheridan E, Thirunarayan MA, Turton J, Upadhyay S, Warner M, Welfare W, Livermore DM, Woodford N. 2010. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study. Lancet Infect Dis 10:597–602. doi: 10.1016/S1473-3099(10)70143-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Randall CP, Gupta A, Jackson N, Busse D, O'Neill AJ. 2015. Silver resistance in Gram-negative bacteria: a dissection of endogenous and exogenous mechanisms. J Antimicrob Chemother 70:1037–1046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Skurnik D, Ruimy R, Ready D, Ruppe E, Bernede-Bauduin C, Djossou F, Guillemot D, Pier GB, Andremont A. 2010. Is exposure to mercury a driving force for the carriage of antibiotic resistance genes? J Med Microbiol 59:804–807. doi: 10.1099/jmm.0.017665-0. [DOI] [PubMed] [Google Scholar]
  • 16.Mergeay M, Nies D, Schlegel H, Gerits J, Charles P, Van Gijsegem F. 1985. Alcaligenes eutrophus CH34 is a facultative chemolithotroph with plasmid-bound resistance to heavy metals. J Bacteriol 162:328–334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Szczepanowski R, Braun S, Riedel V, Schneiker S, Krahn I, Pühler A, Schlüter A. 2005. The 120 592 bp IncF plasmid pRSB107 isolated from a sewage-treatment plant encodes nine different antibiotic-resistance determinants, two iron-acquisition systems and other putative virulence-associated functions. Microbiology 151:1095–1111. doi: 10.1099/mic.0.27773-0. [DOI] [PubMed] [Google Scholar]
  • 18.Nicolas-Chanoine MH, Blanco J, Leflon-Guibout V, Demarty R, Alonso MP, Canica MM, Park YJ, Lavigne JP, Pitout J, Johnson JR. 2008. Intercontinental emergence of Escherichia coli clone O25: H4-ST131 producing CTX-M-15. J Antimicrob Chemother 61:273–281. [DOI] [PubMed] [Google Scholar]
  • 19.Carattoli A, Miriagou V, Bertini A, Loli A, Colinon C, Villa L, Whichard JM, Rossolini GM. 2006. Replicon typing of plasmids encoding resistance to newer β-lactams. Emerg Infect Dis 12:1145. doi: 10.3201/eid1207.051555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Coque TM, Novais A, Carattoli A, Poirel L, Pitout J, Peixe L, Baquero F, Canton R, Nordmann P. 2008. Dissemination of clonally related Escherichia coli strains expressing extended-spectrum beta-lactamase CTX-M-15. Emerg Infect Dis 14:195–200. doi: 10.3201/eid1402.070350. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material
supp_62_5_e02642-17__index.html (814B, html)
AAC.02642-17_zac005187139s1.pdf (135.7KB, pdf)

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES