Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2018 Apr 25;56(5):e01686-17. doi: 10.1128/JCM.01686-17

Comprehensive Molecular Approach for Characterization of Hepatitis E Virus Genotype 3 Variants

Bo Wang a, Dominik Harms a, C Patrick Papp a, Sandra Niendorf a, Sonja Jacobsen a, Marc Lütgehetmann b, Sven Pischke c,d, Heiner Wedermeyer d,e, Jörg Hofmann f,g, C-Thomas Bock a,h,✉
Editor: Yi-Wei Tangi
PMCID: PMC5925713  PMID: 29514938

ABSTRACT

Autochthonous hepatitis E virus genotype 3 (HEV-3) infections in industrialized countries are more frequent than previously assumed. HEV-3 is zoonotic and the causal pathogen of chronic hepatitis E. According to the latest classification of the family Hepeviridae, 10 designated HEV-3 subtypes (HEV-3a to HEV-3j) and 7 unassigned HEV-3 subtypes are proposed. In order to identify and characterize the HEV-3 variants in circulation, we developed a molecular approach combining a sensitive HEV-specific real-time reverse transcription-PCR (RT-PCR) targeting the overlapping region of HEV ORF2 and ORF3 (the ORF2/3 region) and two newly designed consensus nested RT-PCRs targeting the HEV ORF1 and ORF2 genes, respectively. Since complete genome sequences are required for new HEV-3 subtype assignment, we implemented a straightforward approach for full-length HEV-3 genome amplification. Twenty-nine human serum samples and six human feces samples from chronic hepatitis E patients were selected for evaluation of the system. Viral loads ranged from 1 × 104 to 1.9 × 1010 copies/ml of serum and from 1.8 × 104 to 1 × 1012 copies/g of feces. Sequence and phylogenetic analyses of partial ORF1 and ORF2 sequences showed that HEV strains had considerable genetic diversity and clustered into the HEV-3c (29/35), HEV-3e (2/35), HEV-3f (2/35), and unassigned HEV-3 (2/35) subtypes. Moreover, from these strains, three full-length HEV-3 genome sequences were generated and characterized. DE/15-0030 represents a typical HEV-3c strain (95.7% nucleotide identity to wbGER27), while DE/15-0031 and SW/16-0282 have <89.2% homology to known HEV-3 strains and are phylogenetically divergent, indicating novel HEV-3 subtypes. In summary, our approach will significantly facilitate the detection, quantification, and determination of HEV-3 strains and will thus help to improve molecular diagnostics and our knowledge of HEV diversity and evolution.

KEYWORDS: hepatitis E virus, chronic hepatitis E, HEV-3 subtypes, HEV-3 variants, PCR, quantification, detection, complete genome amplification

INTRODUCTION

Hepatitis E virus (HEV) is the major cause of acute hepatitis globally and is associated with large outbreaks in regions of endemicity (1). However, HEV has gained considerably more attention since it became clear that autochthonous infections with HEV genotype 3 (HEV-3) in industrialized countries are increasingly reported (2–4). Zoonotic transmission of HEV genotype 3 (and 4) from animal reservoirs to humans has been reported frequently (4–8). Although the majority of HEV infections are asymptomatic, the clinical course includes acute and chronic hepatitis E, which can lead to severe liver diseases, including fulminant liver failure and extrahepatic symptoms (4, 9–11). Furthermore, it is well established that prolonged HEV viremia and chronic hepatitis E with HEV-3 can occur in organ transplant recipients (12–15).

HEV is a nonenveloped virus with an approximately 7.2-kb positive-sense, single-stranded RNA genome that consists of three open reading frames (ORF1, ORF2, and ORF3), 5′ and 3′ untranslated regions (UTRs), and a poly(A) tract at the 3′ end. ORF1 encodes the nonstructural proteins; ORF2 expresses the capsid protein; and ORF3 partially overlaps ORF2 and encodes a multifunctional phosphoprotein (16, 17). The latest consensus proposals for HEV classification by the International Committee on Taxonomy of Viruses (ICTV) have divided the family Hepeviridae into two genera, Orthohepevirus and Piscihepevirus. Species within the former genus are designated Orthohepevirus A to Orthohepevirus D (18). Within Orthohepevirus A, there are eight major genotypes, namely, HEV-1 to HEV-8. These genotypes have been subsequently classified into different subtypes based on the distribution of nucleotide pairwise distances (p-distances) and phylogenetic analyses of full-length genome sequences (19, 20).

HEV-3 was first described in human cases in the United States and was later identified almost worldwide. In Europe, it represents the most frequently detected genotype. The distribution of its 10 assigned subtypes (HEV-3a to HEV-3j) differs greatly. HEV-3a and HEV-3j strains circulate in North America and Australia; HEV-3b, HEV-3d, and HEV-3g strains in Asia; and HEV-3c, -3e, -3f, -3h, and -3i in Europe (21–23). Additionally, there are several unassigned subtypes, whose HEV-3 subtype designations remain to be identified and await the availability of further complete genome sequences (19).

Previous studies have reported that the low sensitivity of the serological test may contribute to an underestimation of HEV seroprevalence. Thus, the most reliable tests for the diagnosis of HEV infections are nucleic acid amplification techniques (NATs) (24, 25). Molecular assays with optimal performance are quantitative real-time reverse transcription-PCRs (RT-PCRs) targeting the overlapping region of ORF2 and ORF3 (ORF2/3) (26–28). However, generic HEV-specific nested RT-PCRs followed by sequencing can identify the HEV genotype and subtype, thus helping to define the origin of infection, trace the source of contamination, and interpret the epidemiology and evolution of HEV. The latter will give new insights into the poorly described role of HEV subtypes in pathogenicity and the chronicity of infection (1). In this regard, we have developed a comprehensive molecular approach that combines an HEV-specific real-time RT-PCR targeting the overlapping HEV ORF2/3 region and two newly designed consensus nested RT-PCRs targeting the HEV ORF1 and ORF2 genes, respectively. Since complete genome sequences are required for new HEV-3 subtype assignment, we employed a rapid and straightforward approach for full-length HEV-3 genome amplification and characterization.

MATERIALS AND METHODS

HEV samples and control samples.

Twenty-nine serum samples and six fecal samples from chronic hepatitis E patients were selected for evaluation of the HEV genotyping system (Table 1). Thirty-four samples were obtained from three German medical centers (Charité Universitätsmedizin Berlin, University Medical Center Hamburg-Eppendorf, and Hannover Medical School) and one from Spital Lachen, Lachen, Switzerland. HEV-negative serum samples served as negative controls. Samples were stored at −80°C until use. Additionally, we analyzed 24 serum and 10 feces samples from HEV-negative patients from a “healthy” German cohort to validate our test system.

TABLE 1.

Sample characteristics

Patient codea Sampling siteb (yr) Virus concnc (sample type) Genotype and subtype
SW/16-0282 Lachen, Switzerland (2016) 1.55 × 1010 (serum) HEV-3 (no subtype classified)
DE/16-0004 Charité, Germany (2014) 1.06 × 104 (serum) HEV-3c
DE/16-0005 Charité, Germany (2013) 5.08 × 105 (serum) HEV-3c
DE/16-0007 Charité, Germany (2015) 5.17 × 107 (serum) HEV-3c
DE/16-0008 Charité, Germany (2015) 2.40 × 106 (serum) HEV-3c
DE/16-0009 Charité, Germany (2015) 8.77 × 104 (serum) HEV-3c
DE/16-0010 Charité, Germany (2014) 1.12 × 106 (serum) HEV-3c
DE/16-0012 Charité, Germany (2016) 1.02 × 107 (serum) HEV-3c
DE/16-0013 Charité, Germany (2013) 3.83 × 106 (serum) HEV-3f
DE/16-0014 Charité, Germany (2013) 7.10 × 105 (serum) HEV-3e
DE/16-0015 Charité, Germany (2014) 3.46 × 106 (serum) HEV-3c
DE/16-0017 Charité, Germany (2013) 7.89 × 105 (serum) HEV-3c
DE/16-0018 Charité, Germany (2013) 2.13 × 106 (serum) HEV-3c
DE/16-0019 Charité, Germany (2014) 2.57 × 106 (serum) HEV-3c
DE/16-0020 Charité, Germany (2013) 5.00 × 106 (serum) HEV-3c
DE/16-0021 Charité, Germany (2009) 4.55 × 105 (serum) HEV-3c
DE/16-0024 Charité, Germany (2014) 1.54 × 104 (serum) HEV-3c
DE/16-0026 Charité, Germany (2016) 2.67 × 106 (serum) HEV-3c
DE/16-0132 MHH, Germany (2014) 7.55 × 105 (serum) HEV-3f
DE/16-0133 MHH, Germany (2016) 2.38 × 106 (serum) HEV-3c
DE/16-0134 MHH, Germany (2016) 1.66 × 107 (serum) HEV-3e
DE/16-0137 MHH, Germany (2015) 9.76 × 104 (serum) HEV-3c
DE/16-0140 MHH, Germany (2014) 1.91 × 1010 (serum) HEV-3c
DE/16-0143 MHH, Germany (2013) 7.91 × 105 (serum) HEV-3c
DE/16-0145 MHH, Germany (2013) 1.11 × 1010 (serum) HEV-3c
DE/16-0146 MHH, Germany (2010) 9.07 × 104 (serum) HEV-3c
DE/16-0149 MHH, Germany (2016) 7.28 × 106 (serum) HEV-3c
DE/16-0150 MHH, Germany (2016) 8.12 × 105 (serum) HEV-3c
DE/16-0154 MHH, Germany (2016) 2.31 × 106 (serum) HEV-3c
DE/15-0030 UKE, Germany (2015) 1.03 × 1012 (feces) HEV-3c
DE/15-0031 UKE, Germany (2015) 9.60 × 109 (feces) HEV-3 (no subtype classified)
DE/15-0032 UKE, Germany (2014) 6.13 × 108 (feces) HEV-3c
DE/15-0034 UKE, Germany (2014) 2.95 × 109 (feces) HEV-3c
DE/15-0037 UKE, Germany (2014) 1.37 × 106 (feces) HEV-3c
DE/15-0038 UKE, Germany (2013) 1.82 × 104 (feces) HEV-3c
a

Codes of patients for whom full-length genome analysis was performed are shown in boldface.

b

Lachen, Spital Lachen, Lachen, Switzerland; Charité, Charité University Medicine, Berlin, Germany; MHH, Hannover Medical School, Hannover, Germany; UKE, University Medical Center Hamburg-Eppendorf, Hamburg, Germany.

c

Expressed as copies per gram of feces or copies per milliliter of serum.

All HEV-positive samples were retrospectively and anonymously tested for the HEV genotype. Ethics committee approval is not formally required for a study with remaining and anonymized samples in Germany. However, the ethics commission of the Charité Universitätsmedizin Berlin has approved the use of anonymized patient samples for such a study (approval number EA1/249/16).

RNA extraction and cDNA synthesis.

Blood/serum samples were collected and left undisturbed at room temperature for 15 min; the clot was then removed by centrifugation at 2,000 × g for 10 min at 4°C. Fecal samples were homogenized and suspended at a concentration of 10% (wt/vol) in phosphate-buffered saline (pH 7.4), followed by a 20-min centrifugation at 12,000 × g and 4°C. Viral RNA was extracted from serum and fecal samples using the High Pure Viral nucleic acid kit (Roche Diagnostics, Mannheim, Germany) according to the manufacturer's instructions. In addition, 2 × 107 PFU bacteriophage MS2 was added as an internal control prior to the lysis step of viral RNA extraction (29). Aliquots of extracted RNA were frozen at −80°C until use. cDNA was synthesized using a Transcriptor first-strand cDNA synthesis kit (Roche Diagnostics, Mannheim, Germany). One microgram of the total RNA extract was added to 20 μl (final amount) of the cDNA mixture with 50 ng random hexamers or 50 μM oligo(dT)20 primers, following the manufacturer's recommendations. Aliquots of synthesized cDNA were frozen at −20°C until use.

Quantitative HEV-specific real-time RT-PCR.

Viral RNA was quantified using HEV-specific real-time reverse transcription (RT)-PCR (HEV quantitative PCR [qPCR]) targeting a conserved 70-nucleotide (nt) region within the ORF2/ORF3 genes as described previously (nt 5261 to 5330, numbered according to the HEV prototype strain from Burma [GenBank accession no. M73218]) (Fig. 1A) with modifications for detecting HEV genotypes 1 through 4 (30). HEV genome detection was identical for serum- and feces-derived RNA. In brief, PCR was performed with LightCycler FastStart DNA Master Plus kits (Roche Diagnostics GmbH, Mannheim, Germany) in a 20-μl reaction volume comprising 10 μl isolated RNA, 300 nM each forward and reverse primer (HEV-07 and HEV-08), and 150 nM probe (HEV-TM3) (Table 2). Cycling and quantification were performed on a Roche LightCycler 480 II instrument (Roche Diagnostics GmbH, Mannheim, Germany) under the following conditions: 5 min at 55°C for reverse transcription and 5 min at 95°C for initial denaturation, followed by 45 cycles of 95°C for 10 s, 55°C for 15 s, and 72°C for 15 s. Multiplex quantification of bacteriophage MS2 RNA served as an internal extraction control (29). HEV-negative serum samples were used as negative controls. Nuclease-free distilled H2O was used as a nontreated control.

FIG 1.

FIG 1

(A) Schematic representation of the HEV genome and localization of the HEV ORF1 and ORF2 nested PCRs (shaded bars) and HEV qPCR (filled bar). (B) Representative agarose gel electrophoresis of HEV ORF1 and ORF2 nested RT-PCR products from serum and feces samples of patients chronically infected with HEV. The PCR product lengths are 307 bp for the second PCR of ORF1 (left) and 401 bp for the second PCR of ORF2 (right). HEV-positive serum samples are identified in lanes 1 to 4, and HEV-positive fecal samples are identified in lanes 5 to 8. PK, positive control; NK, negative control; NTC, nontemplate control. M, 100-bp DNA ladder. Selected marker fragment lengths are given on the left.

TABLE 2.

Primer sets used for virus quantification, RT-PCR detection, and complete-genome sequencing

Primera Sequence (5′–3′)b Locationc Use
HEV-07_f GGTGGTTTCTGGGGTGAC 5261–5278 Real-time RT-PCR assays for HEV-1 to HEV-4
HEV-TM3_f FAM-TGATTCTCAGCCCTTCGC-MGB 5284–5301
HEV-08_r AGGGGTTGGTTGGATGAA 5330–5313
HEV-38_f GARGCYATGGTBGAGAARG 4084–4102 Nested RT-PCR for HEV-1 to HEV-4 of ORF1 region
HEV-39_r GCCATRTTCCARACRGTRTTCC 4622–4601
HEV-37_f GGTTYCGYGCYATTGARAARG 4277–4297
HEV-27_r TCRCCRGARTGYTTCTTCC 4583–4565
HEV-30_f CCGACAGAATTRATTTCGTCGG 6296–6317 Heminested RT-PCR for HEV-1 to HEV-4 in ORF2
HEV-32_f GTCTCRGCCAATGGCGAGCCRRC 6350–6372
HEV-31_r GTYTTRGARTACTGCTGR 6750–6733
HEV-15_f TGTGGTCGAYGCCATGGAG 15–33 HEV-3 full-length genome fragment 1
HEV-23_r CRTCCTCAGAGGCRTTCC 1129–1112
HEV-24_f GCTGYTCACGGCTWATGAC 1034–1052 HEV-3 full-length genome fragment 2
HEV-16_r AAKGGATTGGCMGACTCCC 2108–2090
HEV-137_f TCTAATGGCCTGGACTGTACTG 1894–1915 HEV-3 full-length genome fragment 3
HEV-124_r TGGACCGAYGAGGCYCGCTGCAT 3176–3154
HEV-123_f AGGGTTGAGCAGAACCCYAAGAGGC 2602–2626 HEV-3 full-length genome fragment 4
HEV-18_r CTGYTCAAGCTCTGGGCARG 3831–3812
HEV-157_f TACCACCAGCTKGCTGAGGAG 3751–3771 HEV-3 full-length genome fragment 5
HEV-41_r GCCATGTTCCAGACDGTRTTCCA 4622–4600
HEV-28_f ATGGAGGAGTGTGGBATGC 4465–4483 HEV-3 full-length genome fragment 6
HEV-20_r GAAGGGGTTGGTTGGATG 5332–5315
HEV-126_f TGCCTATGCTGCCCGCGCCACC 5187–5208 HEV-3 full-length genome fragment 7
HEV-129_r ACCYCCRGCCGACGAAATCAATTCTG 6325–6300
HEV-05_f CCGACAGAATTGATTTCGTCGG 6297–6318 HEV-3 full-length genome fragment 8
HEV-22_r CTCCCGRGTTTTACCYACCT 7123–7104
HEV-154_f CAAARGYACARCGRGARAATCCATC 493–469 HEV-3 5′ RACE
HEV-155_r CGGCCGRACCACCACAGCATTCGC 135–112
HEV-133_f GCCTTGGTGCTGGTCCTGTATC 6906–6927 HEV-3 3′ RACE
HEV-134_r ACTATCCCGCTCGTGCTCATAC 6990–7011
a

Forward primer designations end with _f; reverse primer designations end with _r.

b

Primers and probes are adapted from the work of Jothikumar et al. (30). I, inosine; FAM, 6-carboxyfluorescein; MGB, minor groove binder. R stands for G or A; Y stands for C or T; S stands for G or C; W stands for A or T; M stands for A or C; K stands for G or T; H stands for A, C, or T; and N stands for A, T, C, or G.

c

Numbered according to the HEV prototype strain from Burma (GenBank accession no. M73218).

An HEV plasmid was constructed by cloning the HEV ORF3 gene (HEV_RKI [GenBank accession no. FJ956757]) into the Topo TA cloning vector (Thermo Fisher Scientific, Waltham, MA, USA). Tenfold serial dilutions of the plasmid ranging from 1 × 107 copies/μl to 1 × 102 copies/μl were used in each PCR run. The first WHO international standard for HEV RNA (code 6329/10) was used to standardize the system. A standard curve was generated from the copy number and corresponding cycle threshold (CT) value. The viral titer was calculated as copies per gram of feces or copies per milliliter of serum.

Qualitative nested HEV RT-PCR.

HEV-RNA from serum and feces was detected by nested RT-PCRs (ORF1 PCR and ORF2 PCR) using generic primers targeting conserved regions within ORF1 (HEV-38 and HEV-39 for the first round; HEV-37 and HEV-27 for the second round) and ORF2 (HEV-30 and HEV-31 for the first round; HEV-32 and HEV-21 for the second round) of HEV genotypes 1 to 4, respectively (Fig. 1A; Table 2). The ORF1 and ORF2 RT-PCRs were performed under the same conditions using a touchdown PCR protocol with reverse transcription at 50°C for 30 min and subsequent PCR at 94°C for 5 min; 10 cycles with 94°C for 30 s, a 1°C touchdown decrease of the annealing temperature from 60°C to 50°C, and extension at 72°C for 45 s; and 35 cycles at an annealing temperature of 52°C. Nested PCRs were performed at 94°C for 10 min, followed by 40 cycles at 94°C for 30 s, 52°C for 30 s, and 72°C for 45 s. Fragments were analyzed by 1.5% agarose gel electrophoresis using BioDocAnalyze software (Biometra GmbH, Göttingen, Germany). First-round RT-PCRs were performed using the SuperScript III one-step RT-PCR kit (Invitrogen, Carlsbad, CA, USA) with 5 μl of RNA, 400 nM (each) first-round primers, 1 μg bovine serum albumin, 0.2 mM each deoxynucleoside triphosphate (dNTP), and 2.4 mM MgSO4. Nested PCRs were carried out with HotStarTaq master mix (Qiagen, Hilden, Germany) using 1 μl of the RT-PCR product, 2.5 mM MgCl2, and 400 nM (each) second-round primers. Standard precautions were taken to avoid contamination during the PCR procedure, and no false-positive results were observed in the negative controls. Sensitivity tests for ORF1 and ORF2 nested RT-PCRs were performed with 10-fold serial dilutions of the serum specimen from a previously described HEV-3 blood donor (HEV_RKI [GenBank accession no. FJ956757]) (31) ranging from 1 × 107 copies/ml to 1 × 102 copies/ml (31). All PCR runs (qualitative and quantitative) were performed under certified quality management conditions, while each step of the PCR workflow was carried out in separate laboratory rooms. The amplicons were purified with the High Pure PCR product purification kit (Roche Diagnostics, Mannheim, Germany) and were sequenced in both directions with the BigDye Terminator (version 3.1) cycle sequencing kit (Applied Biosystems, Waltham, MA, USA).

Full-length HEV-3 genome amplification.

In order to identify conserved regions in the HEV-3 genome for PCR primer design, 72 complete HEV-3 genome sequences were obtained from the NCBI GenBank database. Eight overlapping fragments ranging from approximately 800 to 1,300 nt of the HEV genome, representing HEV ORFs 1 to 3, were chosen for full-length genome amplification (Fig. 2A; Table 2). Consensus primers were designed for the amplification of 5′ and 3′ ends. Oligonucleotides were examined for the absence of possible hairpins, secondary structure, and melting temperature with Geneious, version 10.0.5 (Biomatters Limited, Auckland, New Zealand).

FIG 2.

FIG 2

(A) Schematic description of the HEV genome and 10 overlapping segments covering the full-length HEV-3 genome (with 2 segments indicating 5′ and 3′ RACE). Primer designations are shown below the lines (with details given in Table 2). (B) Representative agarose gel electrophoresis of full-length HEV-3 genome amplicons from serum sample DE/15-0030. Lanes 1 to 8 correspond to the eight numbered segments shown in panel A. M, 100-bp DNA ladder. Selected marker fragment lengths are given on the left.

Full-length HEV-3 genome sequences were obtained by amplification using Kapa HiFi HotStart ReadyMix (Kapa Biosystems, Boston, MA, USA) involving the following steps: 94°C for 3 min; then 35 cycles of 98°C for 30 s, 60°C for 15 s, and 72°C for 90 s; and a final extension at 72°C for 5 min. The 5′ and 3′ sequences were obtained using rapid amplification of 5′ and 3′ cDNA ends (5′ and 3′ RACE; Roche Diagnostics, Mannheim, Germany). The amplicons were purified and sequenced in both directions as described above.

Phylogenetic and sequence analyses.

Phylogenetic analyses of the partial ORF1 gene (307 nt) and partial ORF2 gene (401 nt) of HEV from ORF1 and ORF2 PCR runs and of complete genome sequences were conducted with MEGA7 software (32). Sequences were aligned using the MAFFT algorithm (33). Neighbor-joining trees on the maximum composite likelihood model were constructed with 1,000 bootstrap reiterations. Values below 70% are hidden in Fig. 4 and 5 for clarity of presentation. Reference sequences for HEV subtypes were adapted according to the latest proposal of the ICTV for Hepeviridae (19).

FIG 4.

FIG 4

Phylogenetic relationships of HEV strains based on ORF1 (A) and ORF2 (B) sequences. In the main tree at the left of each panel, the HEV-3a, -3b, -3c, -3e, and -3f branches are collapsed and are indicated on the right to allow better legibility. The HEV-3c, HEV-3e, and HEV-3f branches containing sequences from this study are expanded on the right. The HEV strains of this study are shown in boldface. Other strains are designated with the genotype/subtype and accession number. Bootstrap values (>70%) are indicated at specific nodes. Bars indicate the number of nucleotide substitutions per site. (A) Phylogenetic relationships of HEV strains based on 307 nt of ORF1 corresponding to nucleotide positions 4277 to 4583 (numbered according to the HEV prototype strain from Burma [GenBank accession no. M73218]). (B) Phylogenetic relationships of HEV strains based on 401 nt of HEV ORF2 corresponding to nucleotide positions 6350 to 6750 (numbered according to the HEV prototype strain from Burma).

FIG 5.

FIG 5

Phylogenetic relationships of HEV strains based on full-length HEV genome sequences. Bootstrap values (>70%) are indicated at specific nodes. Bars indicate the number of nucleotide substitutions per site. To allow better legibility, the HEV-3a, HEV-3b, HEV-3e, and HEV-3f branches are collapsed. The strain designations are indicated with genotype/subtype and accession number at each branch. HEV strains of this study are shown in boldface.

Sequence analysis and genome assembly were carried out with Geneious, version 10.0.5 (Biomatters Limited, Auckland, New Zealand) as described previously (34). The distribution of nucleotide pairwise distances was analyzed using SSE (35). Sequence similarity comparisons were implemented using the BLASTn search engine (https://blast.ncbi.nlm.nih.gov).

Accession number(s).

All HEV sequences generated in this study have been deposited in NCBI GenBank under accession numbers MG020026 to MG020057 (ORF1), MG020058 to MG020089 (ORF2), and, for the full-length HEV genome, KX172133 (DE/15-0030), KU980235 (DE/15-0031), and KY780957 (SW/16-0282).

RESULTS

Real-time RT-PCR quantification and consensus nested RT-PCR detection of HEV RNA.

For rapid and sensitive detection of HEV genomes in serum and feces samples, a modified in-house quantitative real-time HEV PCR assay (HEV qPCR) targeting the overlapping HEV ORF2/3 region was implemented (Fig. 1A) (30). In order to evaluate the HEV qPCR, 29 serum and 6 feces samples from chronic hepatitis E patients, as well as an engineered HEV plasmid (genotype 3) and negative controls, were included. Standard curves were generated using 102 to 107 copies of a HEV plasmid DNA per reaction. The viral loads of HEV were determined on the basis of the standard curve and were extrapolated with reference to the standard curves. All 35 samples were correctly identified as positive for HEV RNA. Viral loads ranged from 1 × 104 to 1.9 × 1010 copies/ml serum and from 1.8 × 104 to 1 × 1012 copies/g feces (Table 1). No amplification result was observed for the negative control or the nontreated control. The internal extraction control using bacteriophage MS2 RNA demonstrated the quality of RNA extraction.

In preparation for HEV genotyping, the 29 human serum and 6 human feces samples were analyzed with newly developed consensus nested RT-PCRs targeting the ORF1 and ORF2 genes of HEV genotypes 1 to 4 (Fig. 1A). All 35 samples tested positive for RNAs of both the HEV ORF1 and ORF2 genes. No amplification results were observed for the negative control or the nontreated control. Representative agarose gel electrophoresis of HEV ORF1 and ORF2 nested RT-PCR products are shown in Fig. 1B. Partial ORF1 and ORF2 gene sequences amplified by PCR from serum and feces samples in this study were used for sequence and phylogenetic analyses.

Analytical sensitivity and specificity of HEV qPCR and nested PCRs.

Real-time RT-PCR sensitivity tests performed with a previously described HEV-3 serum specimen from a blood donor (HEV_RKI [GenBank accession no. FJ956757]) (31) and dilutions thereof (with concentrations ranging from 106 to 101 copies/ml) indicated that the in-house HEV qPCR had a sensitivity of 33 copies/reaction with a cycle threshold (CT) value of 38.26. Sensitivity tests for the ORF1 and ORF2 nested RT-PCRs demonstrated detection limits of 1 × 103 copies/ml for HEV ORF2 and 1 × 104 copies/ml for HEV ORF1.

The analytical specificities of the qPCR and nested PCR assays were evaluated by testing 22 non-HEV specimens, including RNA from norovirus strains, sapovirus strains, rotavirus strains, enterovirus isolates, and hepatitis C virus strains, and DNA from hepatitis B virus and hepatitis D virus strains (see Table S1 in the supplemental material). The validation was further confirmed by 24 human serum and 10 human feces specimens from healthy German cohorts. No false-positive amplification results were observed, giving evidence for 100% specificity of the test system.

Full-length HEV-3 genome amplification.

In order to subtype HEV genomes in more detail, a new method for PCR of the full-length HEV genome was designed. A schematic description of the HEV genome and the eight overlapping segments covering the full-length HEV-3 genome is shown in Fig. 2A. The overlapping fragments, ranging from approximately 800 to 1,300 nt, were amplified to generate full-length genome sequences of the HEV ORFs (Fig. 2B). Genome ends were amplified by 5′ and 3′ RACE (rapid amplification of 5′ and 3′ cDNA ends) PCR with HEV-3 consensus primers. To evaluate this approach, two full-length HEV-3 genome sequences of unassigned subtypes and, as a control, one full-length genome sequence of HEV genotype 3c were generated and were designated DE/15-0030, SW/16-0282, and DE15/0031, respectively.

DE/15-0030 consisted of 7,222 nt, excluding the poly(A) tail at the 3′ end, and contained the three expected HEV ORFs with 1,704 (ORF1), 661 (ORF2), and 123 (ORF3) amino acids (aa). DE/15-0031 consisted of 7,227 nt, excluding the poly(A) tail at the 3′ terminus, and contained the three HEV ORFs with 1,705 (ORF1), 661 (ORF2), and 123 (ORF3) aa. The genomic features of the HEV variant SW/16-0282 have been described recently (36). The genomic regions of identified HEV-3 strains are described in Table 3.

TABLE 3.

Genomic regions of identified HEV-3 strains

Genomic region Start site–end site (nt)a
DE/15-0030 DE/15-0031 SW/16-0282
5′ UTR 1–25 1–25 1–25
ORF1 26–5137 26–5140 26–5137
ORF2 5172–7154 5175–7157 5172–7154
ORF3 5134–5502 5137–5507 5134–5502
3′ UTR 7155–7222 7158–7227 7155–7222
a

Numbered according to the HEV prototype strain from Burma (GenBank accession no. M73218).

HEV-3 sequence analyses.

The nucleotide sequences of the partial ORF1 genes, the ORF2 genes, and the full-length genomes of the HEV strains analyzed were compared to reference and prototype sequences of known HEV-3 subtypes (19). Sequence analyses of the HEV ORF1 and ORF2 regions revealed patient-specific HEV strains showing sequences with minor variations (Fig. 3A and B). Twenty-nine of the 35 HEV strains analyzed showed HEV-3c subtypes with a 92.5%-to-95.8% nucleotide similarity to the HEV-3c reference strain wbGER27 (GenBank accession no. FJ705359). Two HEV strains showed HEV-3e subtypes with an 89.2%-to-92.5% nucleotide similarity to the HEV-3e reference strain swJ8-5 (accession no. AB248521), and two HEV samples showed HEV-3f subtypes with a 90.2%-to-90.5% nucleotide similarity to the HEV-3f reference strain E116-YKH98C (accession no. AB369687). The HEV ORF2 regions of 29/35 HEV strains clustered with HEV-3c subtypes, with 95.7%-to-98.0% nucleotide similarity to the wbGER27 strain, in accordance with the ORF1 analyses. Similarly, two HEV strains revealed HEV-3e subtypes with an 89.9%-to-91.4% nucleotide similarity to the swJ8-5 strain, and two HEV strains showed HEV-3f subtypes with a 91.2%-to-92.2% nucleotide similarity to the E116-YKH98C strain, in accordance with the respective ORF1 analyses. Specifically, the partial ORF1 and ORF2 genes of DE/15-0030 had 98.1% and 97.7% similarity to wbGER27; thus, DE/15-0030 might be identified as a typical HEV-3c strain. In contrast, two unidentified HEV-3 subtype strains (DE/15-0031 and SW/16-0282) possessed remarkable genetic diversity within both the ORF1 (71.5% to 89.2%) and ORF2 (78.5.4% to 90.0%) regions relative to known HEV-3 strains (Fig. 3C).

FIG 3.

FIG 3

(A) Representative partial ORF1 sequences (110 nt) of the HEV strains aligned with the HEV-3c (GenBank accession no. FJ705359), HEV-3e (accession no. AB248521), and HEV-3f (accession no. AB369687) reference sequences. (B) Representative partial ORF2 sequences (110 nt) of the HEV strains aligned with the HEV-3c, HEV-3e, and HEV-3f reference sequences. (C) Representative partial ORF1 sequences (110 nt) of DE/15-0031 and SW/16-0282 aligned with the HEV-3c, HEV-3e, and HEV-3f reference sequences and unclassified HEV-3 strains swX07-E1 (accession no. EU360977) and TR19 (accession no. JQ013794). Numbering above the alignments is according to the HEV-3c reference strain (accession no. FJ705359).

Comparative analyses of the full-length genome sequences indicated that DE/15-0030 shared the highest nucleotide sequence similarity, of 95.7%, with the HEV-3c reference wbGER27 strain, which was first described in German wild boar. In contrast, DE/15-0031 and SW/16-0282 showed noticeable differences with known HEV-3 strains. DE/15-0031 shared the highest nucleotide sequence similarity, of 89.2%, with an unassigned HEV-3 strain, swX07-E1 (GenBank accession no. EU360977), which was found in a Swedish domestic pig. SW/16-0282 shared the highest nucleotide sequence similarity, of 87.8%, with HEV-3 h reference strain TR19 (accession no. JQ013794), which was isolated from a human stool sample in France. According to the distribution analyses of nucleotide p-distances between DE/15-0031, SW/16-0282, and known HEV-3 strains using SSE, which was recommended by the ICTV Hepeviridae group, nucleotide p-distances between DE/15-0031 and other HEV-3 strains range from 0.108 to 0.191 (18, 19). Notably, DE/15-0031 is equally related to unassigned HEV-3 strains swX07-E1 and FR_R (accession no. KJ873911) from German human plasma with a nucleotide p-distance of 0.108. The nucleotide p-distances between SW/16-0282 and various HEV-3 strains range from 0.121 to 0.195. In addition, single ORF1 and ORF2 comparative analyses confirmed that there was no recombination of DE/15-0031 or SW/16-0282 strains with other HEV-3 strains.

Phylogenetic analyses of HEV-3 strains.

Preliminary phylogenetic analyses based on the partial ORF1 and ORF2 genes demonstrated that all the HEV strains analyzed in this study belonged to HEV-3. To analyze selected HEV strains in depth, full-length genome analyses were performed. HEV reference/prototype strains described by the ICTV under Hepeviridae for HEV classification and various full-length HEV-3 sequences were chosen for phylogenetic reconstructions (18, 19). The phylogenetic tree obtained for the partial ORF1 region (307 nt) showed that all 35 HEV strains of this study segregated to the HEV-3 clade with different subclades. A total of 29 HEV strains classified as HEV-3c, 2 classified as HEV-3e, and 2 classified as HEV-3f clustered into the same clade, respectively, as the HEV-3 reference/prototype strains with the same subtype. However, 2 strains (DE/15-0031 and SW/16-0282) were divergent from known HEV-3 reference strains; thus, the subtype could not be identified (Fig. 4A). The topology of the phylogenetic tree obtained for the partial ORF2 region (401 nt) was highly similar to that of the ORF1 region. Among 35 HEV strains, 29 were classified as HEV-3c, 2 as HEV-3e, and 2 as HEV-3f, yet DE/15-0031 and SW/16-0282 were still divergent from known HEV-3 strains; hence, the subtype could not be identified (Fig. 4B).

Since complete genome sequences are required for new HEV-3 subtype assignment according to the criteria for the family Hepeviridae, we amplified the full-length genomes of the typical HEV-3c strain DE/15-0030 and the two HEV strains of unknown, unclassified subtypes, DE/15-0031 and SW/16-0282. Phylogenetic analysis of the full-length genome sequences confirmed the classification of DE/15-0030 in the HEV-3c clade; DE/15-0030 also clustered in the same clade as three full-length HEV-3c strains (GenBank accession no. KJ701409, FJ705359, and KC618402). Due to the high diversity of strains DE/15-0031 and SW/16-0282 relative to various HEV-3 reference strains, DE/15-0031 and SW/16-0282 might be classified as unassigned HEV-3 subtypes awaiting the availability of further complete genome sequences (Fig. 5).

DISCUSSION

The detection and discrimination of the HEV genotype and subtype, including virus variants, is very helpful in determining the transmission route and chain of infection, e.g., from an HEV outbreak. Furthermore, it is necessary to identify the HEV subtype in order to determine the dissemination of HEV variants within Europe, while the prevalence and changes in prevalence of HEV subtypes have not been recorded to date. In this regard, it has been repeatedly reported recently that prolonged HEV viremia and chronic hepatitis E with HEV-3 can occur in immunocompromised patients, such as organ transplant recipients (12–15, 37, 49). However, it is not known yet whether a specific HEV-3 subtype is preferentially associated with chronic infection and other pathogenic mechanisms.

Previous studies reported that quantitative HEV-specific real-time RT-PCR of a conserved region (ORF2/ORF3) in the HEV genome is the most sensitive method for HEV RNA detection (25). On the other hand, consensus nested RT-PCRs for the amplification of longer fragments (>300 nt) located in different HEV genome regions (ORF1 and ORF2) are useful for molecular characterization and genotyping/subtyping of HEV variants (38). However, full-length genome sequencing is definitely mandatory for proposing new HEV variants (genotype and subtype). In this study, sensitive HEV-specific quantitative real-time RT-PCR (qPCR) and consensus nested RT-PCRs were combined in order to analyze HEV strains in detail. An in-house real-time RT-PCR that was adapted and optimized from a previously published qPCR assay targeting a conserved overlapping HEV ORF2/3 region (30) was used to detect, quantify, and molecularly characterize HEV genomes from 29 human serum and 6 human feces samples derived from chronic hepatitis E patients. Viral loads ranged from 1 × 104 to 1.9 × 1010 copies/ml serum and from 1.8 × 104 to 1 × 1012 copies/g feces by qPCR (Table 1 and Fig. 1).

It has been reported that phylogenetic analyses within the HEV ORF1 gene correlated well with the results from the phylogenetic analysis of the complete HEV genome (39). In another study, the HEV ORF2 gene was found to be more suitable for determining the HEV genotype and subtype (21). In order to avoid discrepancies and guarantee congruencies, in this study we utilized both ORF1 and ORF2 gene amplification and sequencing for phylogenetic analyses and classification (Fig. 4). We could show that the topology of phylogenetic trees obtained from ORF1 and ORF2 sequences revealed high sequence identities with 29 HEV strains assigned to the HEV-3c clade, 2 assigned to the HEV-3f clade, and 2 assigned to the HEV-3e clade. However, the HEV strains analyzed also showed remarkable genetic diversity within their specific subtypes (Fig. 3). In addition, according to our phylogenetic analyses, two HEV-3 strains (DE/15-0031 and SW/16-0282) were divergent from known and designated HEV subtypes, and therefore, the respective subtypes could not be identified by partial ORF1 and ORF2 sequences (Fig. 4).

Recent studies have reported that HEV-3 is the main genotype circulating in Europe, while the majority of HEV RNA-positive samples in France and the Netherlands had the HEV-3c and HEV-3f subtypes, respectively (23, 40, 41); however, our knowledge concerning autochthonous HEV infection in Germany is still limited. Preliminary investigations showed close relationships between human and wild boar and pig HEV strains, while a high HEV prevalence was discovered in wild boars from different regions in Germany (42–45). HEV strains obtained from porcine liver tissue showed high sequence homology to human HEV strains in Germany and were indicative of zoonotic transmission of HEV in this country (46). In this study, we analyzed 34 human serum and feces samples from chronic hepatitis E patients provided by three university hospitals in Germany (Charité, MHH, UKE) and 1 sample from a kidney transplant recipient in Switzerland. The sequence and phylogenetic analyses of the ORF1 and ORF2 genes of these HEV strains showed a prevalence of the HEV-3c, HEV-3e, and HEV-3f subtypes, while HEV-3c is the predominant subtype. The HEV-3c strains of our study revealed high sequence identities (ORF1, 92.5% to 95.8%; ORF2, 95.7% to 98.0%) with the HEV wbGER27 strain, recovered from a wild boar in Germany (Fig. 3). Therefore, occupational exposure and/or consumption of undercooked (pork) meat could be responsible for zoonotic HEV transmission.

According to the standardization of HEV subtyping recommended by the ICTV for the Hepeviridae family, the combination of nucleotide p-distances and phylogenetic analyses of complete genome sequences would be the most appropriate and accurate method for HEV classification (18, 19). Moreover, complete HEV genome sequences are increasingly important for analyses of recombination and mutations within the HEV genome, for the development of novel treatment options and vaccines, for resistance analyses, and for better understanding of the molecular epidemiology and evolutionary genomics of HEV infection (47). Since Sanger sequencing is limited to a maximum of approximately 1,000 nt reads, we developed a novel approach for full-length HEV-3 genome sequencing achieved by assembly of eight overlapping fragments using consensus HEV-3 primer sets (48). Additionally, generic primer pairs were designed for HEV-3 5′- and 3′-end amplification (Fig. 2). After the establishment of this efficient HEV full-length amplification and sequencing method, we analyzed three selected full-length HEV genome sequences (DE/15-0030, DE/15-0031, and SW/16-0282). According to the complete genome phylogenetic analyses (Fig. 5), DE/15-0030 showed high similarity with the HEV-3c reference strain wbGER27 (95.7% nucleotide homology), segregating into the clade of HEV-3c strains, and could be recognized as a typical HEV-3c strain. However, DE/15-0031 and SW/16-0282 were divergent from known HEV-3 strains published in GenBank. According to the proposed criteria of the ICTV for Hepeviridae, sequences that were phylogenetically distinct from previously assigned sequences were assigned a new subtype only if at least three complete ORF1 and ORF2 sequences were available and were epidemiologically unrelated (19). From the nucleotide p-distance analyses of full-length HEV genome sequences, the DE/15-0031 strain of this study is equally related to the unassigned HEV-3 strains swX07-E1 (from a Swedish domestic pig) and FR_R (from German human plasma) (nucleotide p-distance, 0.108). The nucleotide p-distance between swX07-E1 and FR_R is 0.116, smaller than the nucleotide p-distance within subtypes (0.120). DE/15-0031, swX07-E1, and FR_R were also epidemiologically unrelated and therefore meet the criteria of a new HEV subtype assignment (proposed as HEV subtype 3k). The nucleotide p-distance between SW/16-0282 and known HEV-3 strains is higher than 0.121 and therefore does not contribute to a new HEV subtype. Whether DE/15-0031 and SW/16-0282 represent new HEV-3 subtypes requires further verification by more-comprehensive genetic analyses of HEV strains from human and animal reservoirs and awaits the availability of further complete-genome sequences.

In summary, we have here developed a molecular approach which combined a sensitive HEV-specific real-time RT-PCR and two newly designed consensuses nested RT-PCRs and have evaluated the subtyping assay using human serum and feces samples from chronic hepatitis E patients. According to the sequence and phylogenetic analyses, it could be shown that the HEV strains belong predominantly to HEV-3c, HEV-3e, HEV-3f, and unidentified HEV-3 subtypes. Since complete genome sequences are required for new HEV-3 subtype assignment, we established an efficient method for full-length HEV-3 genome amplification. The feasibility of the HEV full-length sequencing verified this molecular test assay. Therefore, our method will significantly facilitate the quantification, detection, and determination of HEV-3 subtypes, giving new insights into HEV molecular epidemiology and pathogenicity.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

We declare that we have no competing interests.

We are grateful for the excellent technical assistance of Marcel Schulze (RKI). We are also deeply grateful to Mira Choi and Peter Nickel (Department of Nephrology and Intensive Care, Charité University Medicine, Berlin, Germany) for providing us with clinical samples from chronic hepatitis E patients and to Agnes Kneubühl (Clinics for Internal Medicine/Nephrology, Spital Lachen, Lachen, Switzerland) for providing the SW/16-0282 HEV isolate. We are grateful to Sindy Böttcher for providing us with enterovirus isolates.

B.W. is supported by the China Scholarship Council (CSC), Beijing, China. D.H. is supported by a scholarship from the Claussen-Simon-Stiftung (Claussen-Simon Foundation) “Dissertation Plus” program, Germany. The content is the responsibility only of the authors and does not represent the views of the CSC or the Claussen-Simon-Stiftung.

Footnotes

Supplemental material for this article may be found at https://doi.org/10.1128/JCM.01686-17.

REFERENCES

  • 1.Wedemeyer H, Pischke S, Manns MP. 2012. Pathogenesis and treatment of hepatitis E virus infection. Gastroenterology 142:1388–1397. doi: 10.1053/j.gastro.2012.02.014. [DOI] [PubMed] [Google Scholar]
  • 2.Wichmann O, Schimanski S, Koch J, Kohler M, Rothe C, Plentz A, Jilg W, Stark K. 2008. Phylogenetic and case-control study on hepatitis E virus infection in Germany. J Infect Dis 198:1732–1741. doi: 10.1086/593211. [DOI] [PubMed] [Google Scholar]
  • 3.Mansuy JM, Peron JM, Abravanel F, Poirson H, Dubois M, Miedouge M, Vischi F, Alric L, Vinel JP, Izopet J. 2004. Hepatitis E in the south west of France in individuals who have never visited an endemic area. J Med Virol 74:419–424. doi: 10.1002/jmv.20206. [DOI] [PubMed] [Google Scholar]
  • 4.Dalton HR, Stableforth W, Thurairajah P, Hazeldine S, Remnarace R, Usama W, Farrington L, Hamad N, Sieberhagen C, Ellis V, Mitchell J, Hussaini SH, Banks M, Ijaz S, Bendall RP. 2008. Autochthonous hepatitis E in southwest England: natural history, complications and seasonal variation, and hepatitis E virus IgG seroprevalence in blood donors, the elderly and patients with chronic liver disease. Eur J Gastroenterol Hepatol 20:784–790. doi: 10.1097/MEG.0b013e3282f5195a. [DOI] [PubMed] [Google Scholar]
  • 5.Meng XJ. 2010. Hepatitis E virus: animal reservoirs and zoonotic risk. Vet Microbiol 140:256–265. doi: 10.1016/j.vetmic.2009.03.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Spahr C, Knauf-Witzens T, Vahlenkamp T, Ulrich RG, Johne R. 2018. Hepatitis E virus and related viruses in wild, domestic and zoo animals: a review. Zoonoses Public Health 65:11–29. doi: 10.1111/zph.12405. [DOI] [PubMed] [Google Scholar]
  • 7.Said B, Usdin M, Warburton F, Ijaz S, Tedder RS, Morgan D. 2017. Pork products associated with human infection caused by an emerging phylotype of hepatitis E virus in England and Wales. Epidemiol Infect 145:2417–2423. doi: 10.1017/S0950268817001388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Banks M, Bendall R, Grierson S, Heath G, Mitchell J, Dalton H. 2004. Human and porcine hepatitis E virus strains, United Kingdom. Emerg Infect Dis 10:953–955. doi: 10.3201/eid1005.030908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kamar N, Garrouste C, Haagsma EB, Garrigue V, Pischke S, Chauvet C, Dumortier J, Cannesson A, Cassuto-Viguier E, Thervet E, Conti F, Lebray P, Dalton HR, Santella R, Kanaan N, Essig M, Mousson C, Radenne S, Roque-Afonso AM, Izopet J, Rostaing L. 2011. Factors associated with chronic hepatitis in patients with hepatitis E virus infection who have received solid organ transplants. Gastroenterology 140:1481–1489. doi: 10.1053/j.gastro.2011.02.050. [DOI] [PubMed] [Google Scholar]
  • 10.Kamar N, Bendall RP, Peron JM, Cintas P, Prudhomme L, Mansuy JM, Rostaing L, Keane F, Ijaz S, Izopet J, Dalton HR. 2011. Hepatitis E virus and neurologic disorders. Emerg Infect Dis 17:173–179. doi: 10.3201/eid1702.100856. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Kamar N, Bendall R, Legrand-Abravanel F, Xia N-S, Ijaz S, Izopet J, Dalton HR. 2012. Hepatitis E. Lancet 379:2477–2488. doi: 10.1016/S0140-6736(11)61849-7. [DOI] [PubMed] [Google Scholar]
  • 12.Behrendt P, Steinmann E, Manns MP, Wedemeyer H. 2014. The impact of hepatitis E in the liver transplant setting. J Hepatol 61:1418–1429. doi: 10.1016/j.jhep.2014.08.047. [DOI] [PubMed] [Google Scholar]
  • 13.Schlosser B, Stein A, Neuhaus R, Pahl S, Ramez B, Kruger DH, Berg T, Hofmann J. 2012. Liver transplant from a donor with occult HEV infection induced chronic hepatitis and cirrhosis in the recipient. J Hepatol 56:500–502. doi: 10.1016/j.jhep.2011.06.021. [DOI] [PubMed] [Google Scholar]
  • 14.Pischke S, Stiefel P, Franz B, Bremer B, Suneetha PV, Heim A, Ganzenmueller T, Schlue J, Horn-Wichmann R, Raupach R, Darnedde M, Scheibner Y, Taubert R, Haverich A, Manns MP, Wedemeyer H, Bara CL. 2012. Chronic hepatitis E in heart transplant recipients. Am J Transplant 12:3128–3133. doi: 10.1111/j.1600-6143.2012.04200.x. [DOI] [PubMed] [Google Scholar]
  • 15.Kamar N, Selves J, Mansuy JM, Ouezzani L, Peron JM, Guitard J, Cointault O, Esposito L, Abravanel F, Danjoux M, Durand D, Vinel JP, Izopet J, Rostaing L. 2008. Hepatitis E virus and chronic hepatitis in organ-transplant recipients. N Engl J Med 358:811–817. doi: 10.1056/NEJMoa0706992. [DOI] [PubMed] [Google Scholar]
  • 16.Tam AW, Smith MM, Guerra ME, Huang CC, Bradley DW, Fry KE, Reyes GR. 1991. Hepatitis E virus (HEV): molecular cloning and sequencing of the full-length viral genome. Virology 185:120–131. doi: 10.1016/0042-6822(91)90760-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.van Tong H, Hoan NX, Wang B, Wedemeyer H, Bock CT, Velavan TP. 2016. Hepatitis E virus mutations: functional and clinical relevance. EBioMedicine 11:31–42. doi: 10.1016/j.ebiom.2016.07.039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Smith DB, Simmonds P, members of the International Committee on the Taxonomy of Viruses Hepeviridae Study Group, Jameel S, Emerson SU, Harrison TJ, Meng XJ, Okamoto H, Van der Poel WH, Purdy MA. 2015. Consensus proposals for classification of the family Hepeviridae. J Gen Virol 96:1191–1192. doi: 10.1099/vir.0.000115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Smith DB, Simmonds P, Izopet J, Oliveira-Filho EF, Ulrich RG, Johne R, Koenig M, Jameel S, Harrison TJ, Meng XJ, Okamoto H, Van der Poel WH, Purdy MA. 2016. Proposed reference sequences for hepatitis E virus subtypes. J Gen Virol 97:537–542. doi: 10.1099/jgv.0.000393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Sridhar S, Teng JLL, Chiu TH, Lau SKP, Woo PCY. 2017. Hepatitis E virus genotypes and evolution: emergence of camel hepatitis E variants. Int J Mol Sci 18:E869. doi: 10.3390/ijms18040869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Lu L, Li C, Hagedorn CH. 2006. Phylogenetic analysis of global hepatitis E virus sequences: genetic diversity, subtypes and zoonosis. Rev Med Virol 16:5–36. doi: 10.1002/rmv.482. [DOI] [PubMed] [Google Scholar]
  • 22.Kwo PY, Schlauder GG, Carpenter HA, Murphy PJ, Rosenblatt JE, Dawson GJ, Mast EE, Krawczynski K, Balan V. 1997. Acute hepatitis E by a new isolate acquired in the United States. Mayo Clin Proc 72:1133–1136. doi: 10.4065/72.12.1133. [DOI] [PubMed] [Google Scholar]
  • 23.Lapa D, Capobianchi MR, Garbuglia AR. 2015. Epidemiology of hepatitis E virus in European countries. Int J Mol Sci 16:25711–25743. doi: 10.3390/ijms161025711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Bendall R, Ellis V, Ijaz S, Ali R, Dalton H. 2010. A comparison of two commercially available anti-HEV IgG kits and a re-evaluation of anti-HEV IgG seroprevalence data in developed countries. J Med Virol 82:799–805. doi: 10.1002/jmv.21656. [DOI] [PubMed] [Google Scholar]
  • 25.Baylis SA, Hanschmann KM, Blumel J, Nubling CM, HEV Collaborative Study Group. 2011. Standardization of hepatitis E virus (HEV) nucleic acid amplification technique-based assays: an initial study to evaluate a panel of HEV strains and investigate laboratory performance. J Clin Microbiol 49:1234–1239. doi: 10.1128/JCM.02578-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Abravanel F, Sandres-Saune K, Lhomme S, Dubois M, Mansuy JM, Izopet J. 2012. Genotype 3 diversity and quantification of hepatitis E virus RNA. J Clin Microbiol 50:897–902. doi: 10.1128/JCM.05942-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Abravanel F, Chapuy-Regaud S, Lhomme S, Dubois M, Peron JM, Alric L, Rostaing L, Kamar N, Izopet J. 2013. Performance of two commercial assays for detecting hepatitis E virus RNA in acute or chronic infections. J Clin Microbiol 51:1913–1916. doi: 10.1128/JCM.00661-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Germer JJ, Ankoudinova I, Belousov YS, Mahoney W, Dong C, Meng J, Mandrekar JN, Yao JD. 2017. Hepatitis E virus (HEV) detection and quantification by a real-time reverse transcription-PCR assay calibrated to the World Health Organization standard for HEV RNA. J Clin Microbiol 55:1478–1487. doi: 10.1128/JCM.02334-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Dreier J, Stormer M, Kleesiek K. 2005. Use of bacteriophage MS2 as an internal control in viral reverse transcription-PCR assays. J Clin Microbiol 43:4551–4557. doi: 10.1128/JCM.43.9.4551-4557.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Jothikumar N, Cromeans TL, Robertson BH, Meng XJ, Hill VR. 2006. A broadly reactive one-step real-time RT-PCR assay for rapid and sensitive detection of hepatitis E virus. J Virol Methods 131:65–71. doi: 10.1016/j.jviromet.2005.07.004. [DOI] [PubMed] [Google Scholar]
  • 31.Adlhoch C, Kaiser M, Pauli G, Koch J, Meisel H. 2009. Indigenous hepatitis E virus infection of a plasma donor in Germany. Vox Sang 97:303–308. doi: 10.1111/j.1423-0410.2009.01211.x. [DOI] [PubMed] [Google Scholar]
  • 32.Kumar S, Stecher G, Tamura K. 2016. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol 33:1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Katoh K, Misawa K, Kuma K, Miyata T. 2002. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res 30:3059–3066. doi: 10.1093/nar/gkf436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Wang B, Yang XL, Li W, Zhu Y, Ge XY, Zhang LB, Zhang YZ, Bock CT, Shi ZL. 2017. Detection and genome characterization of four novel bat hepadnaviruses and a hepevirus in China. Virol J 14:40. doi: 10.1186/s12985-017-0706-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Simmonds P. 2012. SSE: a nucleotide and amino acid sequence analysis platform. BMC Res Notes 5:50. doi: 10.1186/1756-0500-5-50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Wang B, Harms D, Hofmann J, Ciardo D, Kneubuhl A, Bock CT. 2017. Identification of a novel hepatitis E virus genotype 3 strain isolated from a chronic hepatitis E virus infection in a kidney transplant recipient in Switzerland. Genome Announc 5(20):e00345-17. doi: 10.1128/genomeA.00345-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Pischke S, Wedemeyer H. 2015. Hepatitis E in transplant recipients: why is this not a problem in Japan? EBioMedicine 2:1564–1565. doi: 10.1016/j.ebiom.2015.11.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.La Rosa G, Fratini M, Muscillo M, Iaconelli M, Taffon S, Equestre M, Chionne P, Madonna E, Pisani G, Bruni R, Ciccaglione AR. 2014. Molecular characterisation of human hepatitis E virus from Italy: comparative analysis of five reverse transcription-PCR assays. Virol J 11:72. doi: 10.1186/1743-422X-11-72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Zhai L, Dai X, Meng J. 2006. Hepatitis E virus genotyping based on full-length genome and partial genomic regions. Virus Res 120:57–69. doi: 10.1016/j.virusres.2006.01.013. [DOI] [PubMed] [Google Scholar]
  • 40.Doting MHE, Weel J, Niesters HGM, Riezebos-Brilman A, Brandenburg A. 2017. The added value of hepatitis E diagnostics in determining causes of hepatitis in routine diagnostic settings in the Netherlands. Clin Microbiol Infect 23:667–671. doi: 10.1016/j.cmi.2017.02.026. [DOI] [PubMed] [Google Scholar]
  • 41.Lhomme S, Abravanel F, Dubois M, Chapuy-Regaud S, Sandres-Saune K, Mansuy JM, Rostaing L, Kamar N, Izopet J. 2015. Temporal evolution of the distribution of hepatitis E virus genotypes in southwestern France. Infect Genet Evol 35:50–55. doi: 10.1016/j.meegid.2015.07.028. [DOI] [PubMed] [Google Scholar]
  • 42.Kaci S, Nockler K, Johne R. 2008. Detection of hepatitis E virus in archived German wild boar serum samples. Vet Microbiol 128:380–385. doi: 10.1016/j.vetmic.2007.10.030. [DOI] [PubMed] [Google Scholar]
  • 43.Schielke A, Sachs K, Lierz M, Appel B, Jansen A, Johne R. 2009. Detection of hepatitis E virus in wild boars of rural and urban regions in Germany and whole genome characterization of an endemic strain. Virol J 6:58. doi: 10.1186/1743-422X-6-58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Adlhoch C, Wolf A, Meisel H, Kaiser M, Ellerbrok H, Pauli G. 2009. High HEV presence in four different wild boar populations in East and West Germany. Vet Microbiol 139:270–278. doi: 10.1016/j.vetmic.2009.06.032. [DOI] [PubMed] [Google Scholar]
  • 45.Oliveira-Filho EF, Bank-Wolf BR, Thiel HJ, Konig M. 2014. Phylogenetic analysis of hepatitis E virus in domestic swine and wild boar in Germany. Vet Microbiol 174:233–238. doi: 10.1016/j.vetmic.2014.09.011. [DOI] [PubMed] [Google Scholar]
  • 46.Wenzel JJ, Preiss J, Schemmerer M, Huber B, Plentz A, Jilg W. 2011. Detection of hepatitis E virus (HEV) from porcine livers in southeastern Germany and high sequence homology to human HEV isolates. J Clin Virol 52:50–54. doi: 10.1016/j.jcv.2011.06.006. [DOI] [PubMed] [Google Scholar]
  • 47.Houldcroft CJ, Beale MA, Breuer J. 2017. Clinical and biological insights from viral genome sequencing. Nat Rev Microbiol 15:183–192. doi: 10.1038/nrmicro.2016.182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Kumar A, Murthy S, Kapoor A. 2017. Evolution of selective-sequencing approaches for virus discovery and virome analysis. Virus Res 239:172–179. doi: 10.1016/j.virusres.2017.06.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Choi M, Hofmann J, Köhler A, Wang B, Bock C-T, Schott E, Reinke P, Nickel P. 2018. Prevalence and clinical correlates of chronic hepatitis E infection in German renal transplant recipients with elevated liver enzymes. Transplant Direct 4:e341. doi: 10.1097/TXD.0000000000000758. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES