Skip to main content
Plant Physiology logoLink to Plant Physiology
. 1999 May;120(1):65–72. doi: 10.1104/pp.120.1.65

The AG Dinucleotide Terminating Introns Is Important but Not Always Required for Pre-mRNA Splicing in the Maize Endosperm1

Shailesh Lal 1,2, Jae-Hyuk Choi 1,2, L Curtis Hannah 1,*
PMCID: PMC59270  PMID: 10318684

Abstract

Previous RNA analysis of lesions within the 15 intron-containing Sh2 (shrunken2) gene of maize (Zea mays) revealed that the majority of these mutants affect RNA splicing. Here we decipher further two of these mutants, sh2-i (shrunken2 intermediate phenotype) and sh2-7460. Each harbors a G-to-A transition in the terminal nucleotide of an intron, hence destroying the invariant AG found at the terminus of virtually all nuclear introns. Consequences of the mutations, however, differ dramatically. In sh2-i the mutant site is recognized as an authentic splice site in approximately 10% of the primary transcripts processed in the maize endosperm. The other transcripts exhibited exon skipping and lacked exon 3. A G-to-A transition in the terminus of an intron was also found in the mutant sh2-7460, in this case intron 12. The lesion activates a cryptic acceptor site downstream 22 bp within exon 13. In addition, approximately 50% of sh2-7460 transcripts contain intron 2 and 3 sequences.


Although introns in nuclear genes are ubiquitous in nature, the signals required to define precisely and to recognize exon-intron borders are not fully understood. Studies from all eukaryotes suggest that splicing is essentially a two-step cleavage-ligation reaction. The first step involves the cleavage at the 5′-splice site that leads to the formation of an intron lariat with the adenosine residue of the branch point sequence located upstream of the 3′-splice site. This step is followed by the ligation of the exon and by the release of the intron lariat (Moore and Sharp, 1993; Brown, 1996; Simpson and Filipowicz, 1996). This complex set of events is carried out by pre-mRNA association with a conglomeration of small nRNAs and nuclear proteins that forms a dynamic, large ribonucleosome protein complex termed a spliceosome (for review, see Moore et al., 1993; Sharp, 1994). This fundamental process, common to all eukaryotic gene expression, can have a diverse impact on the regulation of gene expression. For example, imprecise or inaccurate pre-mRNA splicing often imparts a mutant phenotype (for review, see Weil and Wessler, 1991), whereas alternative splicing is sometimes important in the regulation of gene expression (Gorlach et al., 1995; Golovkin and Reddy, 1996; Nishihama et al., 1997). Certain introns dramatically enhance gene expression in transient and stably transformed callus tissue (Callis et al., 1987; Vasil et al., 1989; Clancy et al., 1994). Finally, intron splicing is required for some plant viruses to be pathogenic (Kiss-Laszlo et al., 1992).

Unlike yeast and vertebrates, the lack of a plant in vitro system capable of efficiently splicing introns has hindered our understanding of the mechanism of splicing in plants. Despite the universal nature of the splicing pathway, primary transcripts of animal origin are not efficiently or accurately spliced in plant cells. Conversely, the majority of plant pre-mRNAs are not faithfully spliced in animal cells (Barta et al., 1986; van Santen and Spritz, 1987; Wiebauer et al., 1988; Pautot et al., 1989; Waigmann and Barta, 1992). This species barrier between the heterologous splicing of pre-mRNA is also observed between monocots and dicots. Some monocot introns are not spliced in dicots (Keith and Chua, 1986; Goodall and Filipowicz, 1991). In contrast, introns of dicot origin are efficiently spliced in monocots, suggesting that monocot-splicing machinery is more flexible or complex. There are also fundamental structural/sequence differences that differentiate plant introns from those of vertebrate and yeast introns (Goodall and Filipowicz, 1991; for review, see Simpson and Filipowicz, 1996). Vertebrate introns possess a polypyrimidine track that is not found in plant introns (Simpson et al., 1996).

Branch points have recently been mapped in plants, the consensus of which is similar to that of the vertebrates (Liu and Filipowicz, 1996; Simpson et al., 1996; for review, see Brown, 1998). A feature distinguishing plant introns from those of other organisms is their AU richness. This has been indicated to be essential for intron processing and for definition of the intron/exon junction (Goodall and Filipowicz, 1989; Lou et al., 1993; McCullough et al., 1993; Carle-Urioste et al., 1994; Luehrsen and Walbot, 1994; Gniadkowski et al., 1996). It is interesting that the requirements of the AU-rich region are more stringent in dicots than in monocots (Goodall and Filipowicz, 1991), and some monocot introns are GC rich.

Here we describe two mutants of the sh2 (shrunken2) gene of maize (Zea mays) that affect RNA splicing. Sh2 encodes the large subunit of a heterotetrameric enzyme, AGP, a key regulatory enzyme in the starch biosynthetic pathway. Null sh2 mutants cause the dramatic reduction of the starch content in maize kernels that leads to a collapsed, brittle, or shrunken phenotype (Tsai and Nelson, 1966). Previous analysis of the various sh2 mutants revealed that each of these mutants produced multiple transcripts or transcripts of a non-wild-type size. Because Sh2 contains 15 introns, northern analyses suggest that the primary lesion of many mutants occurs at RNA processing (Giroux and Hannah, 1994). To characterize further the molecular events underlying the mutational lesion of two of these mutants, sh2-i (shrunken2 intermediate phenotype) and sh2-7460, mutant transcripts and genomic DNA were isolated, cloned, sequenced, and expressed in Escherichia coli and in maize tissue culture cells.

To our knowledge, the results of these studies reveal a number of features of pre-RNA processing not yet reported in plants. Namely, we show that, although the AG dinucleotide terminating a nuclear intron is important for splicing, it is not always essential. We note exon skipping, a phenomenon commonly found in vertebrates. We also report a case of improper splicing of two adjacent introns. These latter two phenomena are hallmarks of the exon definition of pre-RNA splicing.

MATERIALS AND METHODS

Plant Materials

The maize (Zea mays) mutants sh2-i and sh2-7460 were kindly provided by Dr. M.G. Nueffer and Dr. Oliver Nelson and have been described elsewhere (Hannah et al., 1980; Giroux and Hannah, 1994). The wild-type Sh2 allele used here was isolated from McClintock's a1-m3 stock (Giroux et al., 1996). Plants were maintained and grown in the greenhouse or in the field at the University of Florida, Gainesville.

RNA and Genomic DNA Isolation

Total RNA from the 20- to 22-d postpollination kernels and leaf genomic DNA were isolated as described previously (McCarty, 1986; Giroux et al., 1994). RNA from suspension cells was extracted using TRIZOL reagent (Life Technologies) according to the protocol of the manufacturer. Northern analysis was performed as described by Maniatis et al. (1993). Band intensities were measured by a digital imaging system (model IS-1000, Alpha Innotech Corp., San Leandro, CA).

PCR Amplification and Cloning

RT-PCR was used to synthesize the full-length cDNA clones of the sh2-i and sh2-7460 alleles by using a reverse transcriptase kit (Superscript, Life Technologies). First-strand cDNA synthesis was primed with oligo(dT) primer from developing maize endosperm total RNA, and full-length clones were isolated by use of the primers SH2FO.1 (5′-CAAGATCACGTCGACAGGCAAGTG-3′) and SH2.3 (5′-GGTTTGCTGCAGC TTCTAGGGC-3′). These are complementary to the 5′- and 3′-nontranslated regions of Sh2 cDNA, respectively. Underlined sequences contain modified bases to incorporate restriction sites for SalI and PstI. The restriction sites were used to subsequently clone the amplified fragment into the corresponding restriction site of vector pBluescript KS+.

To amplify cDNA-spanning exons 1 to 4 from sh2-i, primers SH2F0.1 and SH2R0.1 (5′-GCCTGTAACATCCTCCTGCAGGT-3′) were used. The resulting products were separated on a 1% agarose gel and alkaline transferred onto a membrane (Hybond H+, Amersham), according to the protocol provided by the manufacturer. This blot was first probed with an exon 3-specific probe, according to the procedure described by Church and Gilbert (1984). The exon 3-specific probe was generated by PCR amplification of Sh2 cDNA using primers SH2LHS1 (5′-CATTCTCAAACACAGTCGACTAG-3′) and SH2LHSR (5′-AGCAGGCGCAGCTCTAG-3′). The blot was then washed twice with 2× SSPE/0.1%SDS and 0.2× SSPE/0.1%SDS at 65°C for 20 min and then subjected to overnight exposure to x-ray film to monitor the efficacy of probe removal. It was then probed with full-length Sh2 cDNA. Resulting autoradiograms were quantified by a phosphor imager (Molecular Dynamics, Sunnyvale, CA) or with a digital imaging system (model IS-1000).

Genomic sequences from exons 1 to 4 were amplified using primers SH2FO.1 and SH2RO.1 (5′-GCCTGTAACATCCTCCTGCAGGT-3′) using leaf DNA as the template. Similarly, exons 7 to 14 of mutant sh2-7460 were amplified using primers, SHLH872 (5′-ACATGTCGACGATGCTGCTG CTATC-3′) and SHLH871R (5′-GAGTTCACCTGCAGA GCTGAC-3′). Resulting fragments were cloned into pBluescript KS+ or pUC19. DNA sequencing was done at the University of Florida DNA Sequencing Core Laboratory (Gainesville), using the ABI Prism Dye Terminator sequencing protocol (Applied Biosystems). DNA sequences derived from the mutants were compared with the Sh2 sequence (Shaw and Hannah, 1992) using DNA analysis software (Lasergene, DNASTAR, Madison, WI).

Bacterial Expression of AGP

The Escherichia coli expression (Iglesias et al., 1993) was used to monitor sh2-i and sh2-7460 transcripts for functional AGP activity. The full-length Sh2 transcript from wild type, the smaller transcript of mutant sh2-i, and the wild-type-size transcript of sh2-7460 were RT-PCR amplified using primers LH377 (5′-GGGGCCATGGCCCAG TTTGCACTTGCATTGGACGACA CG-3′) and LH396 (5′- CCCCGAGCTCACTATATGACAGACCCATCGTTGATGG) as described earlier and cloned into the NcoI and SstI restriction sites of bacterial expression vector pMSH (Iglesias et al., 1993). Resulting clones are termed pSHW, pMSHi, and pMSH7460, respectively. The low abundance of the larger sh2-i transcript and its close proximity after electrophoresis to the more abundant, smaller transcript made it difficult to effectively resolve the DNA bands. Hence, the region from exon 1 to exon 7 of sh2-i transcripts was amplified using primers LH377 and SH796R (5′-CTCTCATCAACA GGAGCA C-3′). This allowed for a definitive resolution of fragments of approximately 600 and 700 bp on the 1% agarose gel. The larger fragment of approximately 700 bp of mutant sh2-i was eluted from the gel, digested with NcoI and XhoI, and cloned into the corresponding site of pMSHi replacing the corresponding sequence in the smaller transcript, giving rise to pMSHWi. Constructs were separately transformed into an E. coli strain AC70R-504, which lacks endogenous AGP activity but harbors the Bt2 gene on the compatible vector described by Giroux et al. (1996). Transformed cells were grown for 16 h on Luria-Bertani-medium plates containing 1% Glc and then iodine stained to monitor AGP activity as described earlier (Iglesias et al., 1993; Greene et al., 1996).

Particle Bombardment and Expression Vectors

Maize cell line PC5, established from the mesocotyl tissue of germinating seed (Chourey and Zurawski, 1981), was cultured in a liquid Murashige and Skoog medium supplemented with 2 mg/L 2,4-D. Cells were grown in the dark at 27°C on a shaker at 150 rpm and were routinely subcultured at 7-d intervals. After 3 d of subculture, approximately 2 mL of cells was transferred onto a filter disc (Whatman) for particle bombardment. The disc was placed on a Petri plate containing Murashige and Skoog-agarose medium and used immediately as a target for the particle bombardment. Preparation of the DNA/gold mixture and the parameters for bombardment were previously described (Taylor and Vasil, 1991). The Biolistic Particle Delivery System (model PDS-1000/HE, Bio-Rad) was used for bombardment. Cells were harvested 22 h postbombardment, frozen in liquid N2, and stored at −70°C for further analysis.

Exons 2 to 4 were isolated from 1 μg of leaf genomic DNA from the wild type and sh2-i by 30 cycles of PCR amplification using primers SH2F0.1 and SH2R0.1. Resulting 1.6-kb fragments were blunt ended with Pfu polymerase (New England Biolabs) and ligated into the solitary EcoRV site present in the luciferase-coding region of the plant expression vector pAHC18, kindly provided by Dr. Peter Quail (Christensen and Quail, 1996). Resulting constructs were expressed in maize suspension cells as described earlier. Total RNA extracted from the cells was treated with amplification grade DNase I (BRL) and subjected to RT-PCR using primers LucLo.Pr2 (5′-CCCGGTTTTAATGAATACGT-3′) and LucUp.Pr2 (5′-CCGTGCTCCAAAACAACAA-3′), which flanked the insertion. The resulting PCR fragments were blotted and probed with the luciferase-coding region of pAHC18 as described earlier. The fragments were eluted from the gel and directly sequenced.

RESULTS

Origin of AGP Activity in the Mutant sh2-i

The mutant sh2-i, which was generously supplied by Dr. M.G. Neuffer (University of Missouri, Columbia), was generated by ethyl methanesulfonate mutagenesis and conditions an intermediate or leaky phenotype in comparison to virtually all other sh2 mutant alleles. Giroux and Hannah (1994) showed that this mutant produced a major transcript and protein smaller than those found in the wild type. To determine whether the detected diminutive SH2 protein conditioned AGP activity in sh2-i, the small transcript of sh2-i was cloned. Sequencing revealed that this transcript lacked exon 3. Exon 3 is a multiple of 3 (123 bp) in length; therefore, deletion of this exon maintains translational continuity. Conservation of the reading frame combined with the fact that initiation of translation begins in exon 2 (Shaw and Hannah, 1992) caused us to consider the possibility that this mutant SH2 protein conditioned the partial AGP activity of sh2-i.

Accordingly, this transcript was cloned and coexpressed with the wild-type Bt2 (Brittle2) gene in an E. coli mutant lacking the endogenous bacterial AGP, glg-C gene (Igleasias et al., 1993). Expression of wild-type Sh2 and Bt2 genes (Fig. 1) complemented the E. coli mutant giving rise to glycogen, which can be visualized easily by exposure to iodine vapors. In contrast, expression of the abbreviated sh2-i transcript (Fig. 1, pMSH-i/pMBT-W) did not complement the glg-C mutant. Because mutants with less than 3% wild-type activity give rise to some staining (S. Lal, J.-H. Choi, and L.C. Hannah, unpublished data), we have concluded that this sh2-i transcript probably does not underlie the leaky kernel phenotype. Furthermore, the lack of enzymatic activity encoded by the small transcript has been predicted from the recent findings that the completely conserved, exon 3-encoded motif PAV is critical for enzymatic activity in potato (Greene et al., 1996) and in E. coli (Meyer et al., 1993). We have concluded from these experiments that the truncated sh2-i transcript does not encode the AGP activity encountered in this mutant and that an additional source of AGP must condition the leaky phenotype of this mutant.

Figure 1.

Figure 1

Expression of maize endosperm AGP in E. coli. The full-length wild-type transcript Sh2, the wild-type-size transcript of mutants sh2-i (sh2-iw) and sh2-7460, and the smaller transcript of sh2-i were expressed with Bt2 in an E. coli strain deficient in the endogenous AGP gene. Complementation of the glg-C E. coli mutant resulting in glycogen synthesis was visualized by iodine staining.

Therefore, we analyzed whether the sh2-i primary transcript undergoes multiple splicing events possibly giving rise to other less-abundant, mature transcripts containing exon 3. RT-PCR analysis was performed on oligo(dT)-primed first-strand cDNA from wild-type and sh2-i developing endosperm poly(A+) RNA using primers flanking exons 1 to 4. A less-abundant, wild-type-size PCR product from sh2-i (Fig. 2A, left, lane 2) was observed. This fragment hybridized to a full-length Sh2 cDNA probe (Fig. 2A, center, lane 2) and to a probe specific to exon 3 (Fig. 2A, right, lane 2) As judged by digital imaging, this fragment makes up approximately 10% of the total Sh2 transcript. Furthermore, quantitative analysis of RNA blots probed with exon 3 suggests that this transcript makes up 5% to 10% of the total transcript.

Figure 2.

Figure 2

RT-PCR analysis of mutant sh2-i and sh2-7460 transcripts. A, Total endosperm RNA from the wild type and that from the mutants sh2-i and sh2-7460 were subjected to RT-PCR using primers spanning exons 1 to 4 of the Sh2 transcript. The left panel depicts the resultant RT-PCR products resolved on a 1% agarose gel and stained with ethidium bromide. Lanes 1, 2, and 3 represent the RT-PCR product derived from Sh2 and the mutants sh2-i and sh2-7460, respectively. The center and right panels are DNA blots of the agarose gel probed with radiolabeled full-length Sh2 cDNA and Sh2 exon 3-specific probes, respectively. B, Schematic structure of the RT-PCR products derived from the mutants sh2-i and sh2-7460 and the wild-type Sh2 transcripts, as shown in A. Transcript sources are labeled at the left side of the panel; the numbers on the right give the size and the relative proportion (in percentages) of each transcript in the mutant endosperm. Arrows represent primers used for PCR amplification. Exons are represented by boxes, and the intronic sequences that remained in the mutant sh2-7460 transcript are marked by a thick line. Asterisks indicate that these transcripts contain a 22-bp deletion of a downstream exon 13 sequence.

Full-length clones making up the larger transcript of sh2-i were isolated by PCR, sequenced, and expressed in E. coli. Sequencing showed that this transcript contains a completely wild-type exon 3 that perfectly abuts exons 2 and 4 (Fig. 2B). Expression of this transcript leads to a functional AGP (Fig. 1, top right). We have concluded that the low levels of AGP activity found in sh2-i arise from this less-abundant transcript.

Because two transcripts arise from one mutant gene, the sh2-i pre-RNA must undergo multiple splicing events. Primers spanning exons 1 to 4 were used to isolate sh2-i genomic DNA. Sequencing revealed that sh2-i harbors a G-to-A transition at the terminus of intron 2 (Fig. 3). Hence, loss of a wild-type splice site at the terminus of intron 2 leads to the skipping of exon 3 in approximately 90% of the processed transcripts. In these cases, splicing occurs between the donor site of intron 2 and the acceptor site of intron 3. In approximately 10% of the transcripts, however, the intron 2 acceptor site functions in splicing, although it lacks the invariant AG terminus.

Figure 3.

Figure 3

Schematic representation of the genomic sequence bearing the splice-site alterations of mutants sh2-i (exons 2–4) and sh2-7460 (exon 11–13 [A]) and (exon 2–4 [B]). The point mutations that altered the 3′-splice site AG to AA of intron 2 in mutant sh2-i and intron 12 of mutant sh2-7460 are boxed. Arrows joined by lines mark the donor and acceptor sites used during RNA splicing to generate the mutant transcripts.

Whereas the mutated 3′-splice site of intron 2 functions as an acceptor site in the maize endosperm, this variant splice site lacks function when this portion of Sh2 is expressed in cultured maize cells. Exons 2 to 4 of the wild type and sh2-i were cloned into the lone EcoRV site within the luciferase-coding region of the plant expression vector AHC18 (Christensen and Quail, 1996). These recombinant constructs and AHC18 were separately introduced into the maize suspension cell line PC5 via particle bombardment. Total RNA extracted from these cells was analyzed by RT-PCR using primers flanking the adjacent luciferase-coding region of AHC18. Resulting DNA was electrophoresed, blotted, and probed with the luciferase-coding region (Fig. 4). A single fragment of 981 bp was amplified from cells expressing the wild-type Sh2 gene. Sequencing revealed that this fragment lacked introns 2 and 3, which was expected if Sh2 pre-RNA splice signals are recognized in the cultured cells as they are in the maize endosperm. In contrast, the sh2-i-containing construct produced a single, highly abundant transcript of 858 bp. From sequencing, this transcript lacked exon 3. Therefore, whereas the AA terminus of intron 2 is recognized in the maize endosperm, we find no evidence that this can also function in this genic context in maize tissue culture cells.

Figure 4.

Figure 4

Expression of Sh2 transcripts in maize suspension cells. A, Southern blot of RT-PCR products amplified using primers specific to the luciferase-coding region. These products were detected with the luciferase-coding region after expression of exons 2 to 4 from Sh2 and the mutant sh2-i cloned into the luciferase-coding region of the expression vector AHC18 and were transiently expressed in maize suspension cells using particle bombardment. B, Top, Represents the genomic construct cloned into the luciferase (lux)-coding region of the vector AHC18. Sh2 exons are marked by blank boxes, whereas introns are depicted by a line. The hatched boxes represent the flanking luciferase-coding sequences. Arrows represent the primers used in the RT-PCR reaction. The construct source is labeled at the top of each panel. Structures of the various constructs were determined by cloning and sequencing.

The Mutant sh2-7460 also Contains a G-to-A Mutation at an Intron Acceptor Site

Giroux and Hannah (1994) showed that the mutation sh2-7460 produces two transcripts, pointing to an alteration in RNA splicing. RT-PCR was used to isolate full-length clones from the two transcripts. Sequencing of these transcripts identified three alterations in RNA splicing. Both transcripts lacked the first 22 bp of exon 13. In addition, the larger transcript contained 15 bp of the distal portion of intron 2 and all of intron 3 (Fig. 2A, lanes 3), which lead to a shift in the reading frame and a proximal chain-termination codon. From sequencing, we concluded that a premature chain-termination mutation was created in exon 13 of the wild-type-size transcript and, as expected, that this transcript does not condition AGP activity (Fig. 1, lower left).

To precisely define the mutation underlying the complex splicing pattern exhibited by sh2-7460, genomic DNA corresponding to the altered spliced sites was amplified and cloned. A G-to-A transition at the terminus of intron 12 was detected, which provided a ready explanation for the loss of function of the intron 12 acceptor site. Here an AG in the AU-rich proximal region of exon 13 was activated and used as an acceptor site. Unlike the situation with sh2-i, we found no evidence for splicing of the mutant A-terminating intron.

DISCUSSION

Wild-Type Transcripts Arise from Splicing of an AA-Terminating Intron Giving Rise to the Leaky or Non-Null Phenotype of the Maize Mutant sh2-i

Here we elucidated the mechanism underlying the residual activity in the mutant sh2-i. The phenotype of mutant sh2-i is quite leaky, and Giroux and Hannah (1994) speculated that a predominant but truncated protein observed in this mutant might have partial enzymatic activity giving rise to the leaky phenotype. Here we cloned the cognate transcript and showed that the truncated protein is nonfunctional in an E. coli expression system. In an attempt to elucidate the cause of the residual activity, we found that, although this mutant has suffered a G-to-A transition in the terminus of intron 2, the mutant splice site can still be recognized and properly spliced, albeit in only approximately 10% of the primary transcripts. The low level of this wild-type transcript causes the leaky phenotype of sh2-i. Giroux et al. (1994) noted that AGP activity, the product of the Sh2 locus, from sh2-i is approximately 20% of the wild type, a value comparable with that found for the wild-type transcript from this mutant.

The presence of the wild-type Sh2 transcript in the mutant sh2-i indicates that at low, physiologically significant levels, the 3′-splice site of intron 2 is used although it lacks the virtually invariant AG-terminating dinucleotide. To our knowledge, this is the first report of a conventional nuclear intron now terminating in AA being spliced in a plant system. This splicing does not reflect a unique feature of Sh2 RNA splicing, because an identical change in a latter intron in the sh2-7460 mutation abolishes splicing at that position. Hence, this splicing is context dependent. Context dependency or tissue dependency is also evident, because we cannot detect intron 2 splicing of sh2-i when exons 2 to 4 of this mutant are expressed in a maize tissue culture system.

This observation is intriguing because the terminal AG of nuclear introns is considered invariant in many diverse species, including plants. This dinucleotide is likely associated with the binding of U5 small nuclear ribonucleoprotein particles, one of the major subunits of spliceosomes, and represents an essential step in RNA processing (Brown, 1996). Furthermore, the terminal G is important for the second step of splicing in yeast (Parker and Siliciano, 1993). Mutations altering the terminal AG abolish splicing and sometimes activate nearby, downstream cryptic acceptor sites (Kiss-Laszlo et al., 1992; Lou et al., 1993; Parker and Siliciano, 1993; Carle-Urioste et al., 1994; Simpson and Filipowicz, 1996; Simpson et al., 1996). Several cases of a G-to-A transition at the 3′-splice site have been reported in Arabidopsis floral homeotic genes ag-1, ag-4, and ap1-1 (Yanofsky et al., 1990; Mandel et al., 1992; Sieburth et al., 1995); the spy-2 gene associated with GA signal transduction (Jacobsen et al., 1996); the tt4(2YY6) gene encoding chalcone synthase (Burbulis et al., 1996); the stm-3 homeotic gene essential for meristem formation during embryogenesis (Long et al., 1996); and the cop1-1 essential regulatory gene for the photomorphogenic development of the plant (McNellis et al., 1994). These mutations completely abolish the recognition of the acceptor site and result in inclusion of the intron in the processed transcript (McNellis et al., 1994), in exon skipping (Sieburth et al., 1995; Jacobsen et al., 1996), or in activation of a cryptic acceptor splice site in the adjacent exon (Sieberth et al., 1995; Burbulis et al., 1996).

Alterations in splicing caused by the intron terminal G-to-A transition have been extensively documented in vertebrates (Krawczak et al., 1992). These alterations are the basis for Citrullinemia (Dunn et al., 1989), Tay Sachs disease (Arpaia et al., 1988), and Fabry disease (Okumiya et al., 1995).

Whereas sh2-i splicing is the first report, to our knowledge, of this type of splicing in a plant system, the use of the dinucleotide AA in the acceptor site has been noted in other systems. Two cases were reported in Caenorhabditis elegans (Aroian et al., 1993) and one was reported in swine (Brown et al., 1994). The 3′-splice-site mutation AG to AA functions at 2% of the wild-type frequency in yeast (Parker and Siliciano, 1993). Recently, McCullough et al. (1996) expressed a β-conglicinin intron construct in tobacco nuclei and noted the use of a 3′ AA splice site. However, this splicing event also involved use of the nonconical 5′-splice site, AU.

The G-to-A Transitions of the Terminal Nucleotides of Introns 2 and 12 Have Drastically Different Effects on Pre-mRNA Splicing

Mutant sh2-7460 contains an AG-to-AA alteration of the 3′ terminus of intron 12. Therefore, this lesion is identical to that of sh2-i, except that it resides in a different intron. In contrast to sh2-i, this mutant site is not functional. Rather, a cryptic 3′-splice site 22 bp downstream within exon 13 is used as an acceptor. This divergence in consequence on splicing must reflect a difference in sequence, context, or position within the gene. These types of mutations in which the splicing apparatus uses a site found in an exon as an acceptor site have been amply documented in plant literature. We note that the 22 bp of exon 13 now included in the intron of sh2-7460 are 73% AU rich. Contrast between GC and AT richness has been indicated in splice-site selection (Goodall and Filipowicz, 1989; Lou et al., 1993; McCullough et al., 1993; Simpson and Brown, 1993; Luehrsen and Walbot, 1994) that may aid in the selection of the cryptic splice site.

Mutant sh2-7460 Depicts a Complex Pattern of Pre-mRNA Splicing

The larger transcript of sh2-7460 exhibits abnormalities in the splicing of exons 2, 3, and 13. The former change involves enclosure of the entire 282-bp intron 3 and 15 bp of the distal portion of intron 2. Hence, the authentic 3′- splice site of intron 2 is skipped in approximately 50% of the mature transcripts. Coupled with this, the splicing of intron 3 does not occur.

Plant genes are rich in introns and their accurate recognition and removal from the primary transcript is a complex process that may involve sequences distant from the splice site, as might be the case here. Mutations acting from a distance to affect splicing have been found in mammalian systems and in Arabidopsis (McNellis et al., 1994). An insertion in intron 11 of the maize mutant sh2-7527 results in the inclusion of intron 9 in approximately 40% of the processed transcripts. This mutant is identical in sequence to wild-type Sh2 from exons 6 to 11 (S. Lal and L.C. Hannah, unpublished data; Giroux and Hannah, 1994). There may be a global, three-dimensional nature of splicing, in which the splicing of various introns in context to a particular gene is interrelated. Whether the downstream mutation in intron 12 in sh2-7460 affects the splicing of upstream exons is being investigated.

These Mutations Provide Evidence for Both the Intron Definition and the Exon Definition of Pre-RNA Splicing

Two theories account for the initial recognition of introns. In exon definition of splicing, recognition of splice sites on each end of a single exon occurs initially and is coordinated (Berget, 1995). Mutations that alter recognition at one end of the exon also alter recognition at the other end of the same exon. In other words, alteration in binding at the 5′-donor site also alters use of the upstream 3′- acceptor site abutting the same exon. Recently, the evidence for exon definition in plants was reported (Yi and Jack, 1998). In contrast, in the intron definition of splicing, the initial recognition is in the intron, probably at the branch point for lariat formation. This is followed by scanning in the 3′ direction for detection of the first AG dinucleotide. This AG then defines the acceptor site (for summary, see Luehrsen and Walbot [1994]).

The exon definition of splicing is attractive in animal systems where introns can be quite large compared with the adjoining exons. This model circumvents the need to scan the very large animal introns for splice sites. This model predicts that mutations abolishing splicing at one terminus of an exon also block splicing at the other terminus of the same exon. The exon consequently is not recognized and is removed during splicing, a phenomenon termed exon skipping. In support of this model, 51% of more than 100 splice mutations in humans exhibited exon skipping (Berget, 1995). Although plant exon sequences influence pre-mRNA splicing (Carle-Urioste et al., 1994, 1997), little evidence favors the exon definition of splicing in plants (for review, see Simpson and Filipowicz, 1996).

The vast majority of the evidence from splice-site mutants in plants favors the intron definition of splicing. In this regard, the splicing pattern of exon 13 in sh2-7460 is easily explained by the intron definition of splicing. The use of the first AG nucleotide downstream of the mutated site in sh2-7460 is consistent with the scanning model, beginning in the intron and proceeding 3′ until the first AG is encountered.

In contrast, the alteration found in sh2-i favors the exon definition of splicing. Exon skipping, the hallmark of the exon definition of splicing, occurs in 90% of the sh2-i endosperm-splicing events and all of those produced in maize tissue culture cells. Blockage of splicing at the 3′ end of intron 2 apparently blocks splicing at the 5′ end of intron 3 and results in total exclusion of exon 3 from the processed transcript. Furthermore, the aberrations in the splicing of the two adjacent introns (introns 2 and 3) in sh2-7460 endosperms are in accord with the exon definition of splicing.

In summary, splicing of introns 2 and 3 of Sh2 transcripts seemingly follows the exon definition of splicing, whereas splicing of intron 12 of the same transcript is apparently in accord with the intron definition of splicing. One possible explanation for this paradox is that the critical factor in determining the mode of recognition is the distance between adjacent splice sites. Those sequences, whether exon or intron, separated by the shortest distance between splice sites determine whether the exon or the intron definition, respectively, is followed in splicing. We note that exon 3 of Sh2 is short (123 nucleotides) relative to the flanking introns (476 and 284 nucleotides), whereas intron 12 is short (70 nucleotides) compared with the adjacent exons (87 and 105 nucleotides). Berget (1995) similarly noted this possibility in reference to observations that increases in exon length in genes with short exons and long introns or expanding introns in genes with short introns and long exons led to aberrant splicing.

ACKNOWLEDGMENTS

We thank Dr. Gerry Neuffer for sh2-i, Dr. Oliver Nelson for sh2-7460, Dr. Peter Quail for the plant expression vector, and Dr. Prem Chourey for the maize tissue culture cells. Synthesis of DNA primers and DNA sequencing were done in the facilities of the Interdisciplinary Center for Biotechnology Research at the University of Florida, Gainesville.

Abbreviations:

AGP

ADP-Glc pyrophosphorylase

RT-PCR

reverse transcription-PCR

Footnotes

1

This research was supported in part by the National Science Foundation (grant nos. IBN-9316887 and MCB-9420422) and by the U.S. Department of Agriculture Competitive Grants Program (grant nos. 94-37300-453, 97-36306-4461, 95-37301-2080, and 98-01006). This is Florida Agricultural Experiment Station journal series no. R-06349.

LITERATURE  CITED

  1. Aroian RV, Levy AD, Kago M, Oshima Y, Kramer JM, Sternberg PW. Splicing in Caenorhabditis elegans does not require an AG at the 3′ splice acceptor site. Mol Cell Biol. 1993;13:626–637. doi: 10.1128/mcb.13.1.626-637.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Arpaia E, Dumbrille-Ross A, Maler T, Neote K, Tropak M, Stirling JL, Pitts JS, Bapat B, Lamhonwah AM. Identification of an altered splice site in Ashkenazi Tay-Sachs disease. Nature. 1988;333:85–86. doi: 10.1038/333085a0. [DOI] [PubMed] [Google Scholar]
  3. Barta A, Sommergruber K, Thompson D, Harmuth K, Matzke ME, Matzke AJM. The expression of nopaline synthase-human growth hormone chimeric gene in transformed tobacco and sunflower callus tissue. Plant Mol Biol. 1986;6:347–357. doi: 10.1007/BF00034942. [DOI] [PubMed] [Google Scholar]
  4. Berget SM. Exon recognition in vertebrate splicing. J Biol Chem. 1995;270:2411–2414. doi: 10.1074/jbc.270.6.2411. [DOI] [PubMed] [Google Scholar]
  5. Brown JWS. Arabidopsis intron mutations and pre-mRNA splicing. Plant J. 1996;10:771–780. doi: 10.1046/j.1365-313x.1996.10050771.x. [DOI] [PubMed] [Google Scholar]
  6. Brown JWS. Splice site selection in plant pre-mRNA splicing. Annu Rev Plant Physiol Plant Mol Biol. 1998;49:77–95. doi: 10.1146/annurev.arplant.49.1.77. [DOI] [PubMed] [Google Scholar]
  7. Brown WR, Kacskovics I, Amendt BA, Blackmore NB, Rothschild M, Shinde R, Butler JE. The hinge deletion allelic variant of porcine IgA results from a mutation at the splice acceptor site in the first Cα intron. J Immunol. 1994;154:3836–3842. [PubMed] [Google Scholar]
  8. Burbulis IA, Lacobucci M, Shirley BW. A null mutation in the first enzyme of flavonoid biosynthesis does not affect male fertility in Arabidopsis. Plant Cell. 1996;8:1013–1025. doi: 10.1105/tpc.8.6.1013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Callis J, Fromm M, Walbot V. Introns increase gene expression in cultured maize cells. Genes Dev. 1987;1:1183–1200. doi: 10.1101/gad.1.10.1183. [DOI] [PubMed] [Google Scholar]
  10. Carle-Urioste JC, Brendel V, Walbot V. A combinational role for exon, intron and splice site sequences in splicing in maize. Plant J. 1997;11:1253–1263. doi: 10.1046/j.1365-313x.1997.11061253.x. [DOI] [PubMed] [Google Scholar]
  11. Carle-Urioste JC, Ko CH, Bonito M, Walbot V. In vivo analysis of intron processing using splicing-dependent reporter gene assays. Plant Mol Biol. 1994;26:1785–1795. doi: 10.1007/BF00019492. [DOI] [PubMed] [Google Scholar]
  12. Chourey PS, Zurawski D. Callus formation from protoplasts of a maize cell culture. Theor Appl Genet. 1981;59:341–344. doi: 10.1007/BF00276446. [DOI] [PubMed] [Google Scholar]
  13. Christensen AH, Quail PH. Ubiquitin promoter-based vectors for high level expression of selectable and/or screenable marker genes in monocotyledonous plants. Transgenic Res. 1996;5:213–218. doi: 10.1007/BF01969712. [DOI] [PubMed] [Google Scholar]
  14. Church GM, Gilbert W. Genomic sequencing. Proc Natl Acad Sci USA. 1984;81:1991–1995. doi: 10.1073/pnas.81.7.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Clancy M, Vasil V, Hannah LC, Vasil IK. Maize shrunken1 intron and exon regions increase gene expression in maize protoplasts. Plant Sci. 1994;98:151–161. [Google Scholar]
  16. Dunn JM, Phillips RA, Zhu X, Becker A, Gallie BL. Mutations in the RB1 gene and their affects on transcription. Mol Cell Biol. 1989;9:4596–4604. doi: 10.1128/mcb.9.11.4596-4604.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Giroux MJ, Boyer C, Feix G, Hannah LC. Coordinated transcriptional regulation of storage product genes in the maize endosperm. Plant Physiol. 1994;106:713–722. doi: 10.1104/pp.106.2.713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Giroux MJ, Hannah LC. ADP-glucose pyrophosphorylase in shrunken2 and brittle2 mutants of maize. Mol Gen Genet. 1994;243:400–408. doi: 10.1007/BF00280470. [DOI] [PubMed] [Google Scholar]
  19. Giroux MJ, Shaw GB, Cobb BG, Greene T, Okita T, Hannah LC. A single gene mutation increases maize seed weight. Proc Natl Acad Sci USA. 1996;93:5824–5829. doi: 10.1073/pnas.93.12.5824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gniadkowski M, Hammings-Mieszczak M, Klahre U, Liu H, Filipowicz W. Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia. Nucleic Acids Res. 1996;24:619–627. doi: 10.1093/nar/24.4.619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Golovikin M, Reddy AS. Structure and expression of a plant U1 snRNP 70K gene: alternative splicing of U1 snRNP 70K pre-mRNAs produces two different transcripts. Plant Cell. 1996;8:1421–1435. doi: 10.1105/tpc.8.8.1421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Goodall GJ, Filipowicz W. The AU-rich sequences present in the introns of plant nuclear pre-mRNAs are required for splicing. Cell. 1989;58:473–483. doi: 10.1016/0092-8674(89)90428-5. [DOI] [PubMed] [Google Scholar]
  23. Goodall GJ, Filipowicz W. Different effects of intron nucleotide composition and secondary structure on pre-mRNA splicing in monocot and dicot plants. EMBO J. 1991;10:2635–2644. doi: 10.1002/j.1460-2075.1991.tb07806.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Gorlach J, Raesecke HR, Abel G, Wehrli R, Amrhein N, Schmid J. Organ-specific differences in the ratio of alternatively spliced chorismate synthase (LeCS2) transcripts in tomato. Plant J. 1995;8:451–456. doi: 10.1046/j.1365-313x.1995.08030451.x. [DOI] [PubMed] [Google Scholar]
  25. Greene T, Chantler SE, Kahn B, Preiss J, Okita TW. Mutagenesis of the potato ADP-glucose pyrophosphorylase and characterization of an allosteric mutant defective in 3-phosphoglycerate activation. Proc Natl Acad Sci USA. 1996;93:1509–1513. doi: 10.1073/pnas.93.4.1509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Hannah LC, Tuschall DM, Man RJ. Multiple forms of maize endosperm ADP-glucose pyrophosphorylase and their control by Shrunken-2 and Brittle-2. Genetics. 1980;95:961–970. doi: 10.1093/genetics/95.4.961. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Iglesias AA, Barry GF, Myer C, Bloksberg L, Nakata PA, Greene T, Laughlin MJ, Okita TW, Kishore GM, Preiss J. J Biol Chem. 1993;268:1081–1086. [PubMed] [Google Scholar]
  28. Jacobsen SE, Binkowski K, Olszewski NE. SPINDLY: a tetratricopeptide repeat protein involved in gibberellin signal transduction in Arabidopsis. Proc Natl Acad Sci USA. 1996;93:9292–9296. doi: 10.1073/pnas.93.17.9292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Keith B, Chua N-H. Monocot and dicot pre-mRNAs are processed with different efficiencies in transgenic tobacco. EMBO J. 1986;5:2419–2425. doi: 10.1002/j.1460-2075.1986.tb04516.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kiss-Laszlo Z, Blanc S, Hohn T. Splicing of cauliflower mosaic virus 35S RNA is essential for viral infectivity. EMBO J. 1992;14:3552–3562. doi: 10.1002/j.1460-2075.1995.tb07361.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Krawczak M, Reiss J, Cooper DN. The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: causes and consequences. Hum Genet. 1992;90:41–54. doi: 10.1007/BF00210743. [DOI] [PubMed] [Google Scholar]
  32. Liu HX, Filipowicz W. Mapping of branchpoint nucleotides in mutant pre-mRNAs expressed in plant cells. Plant J. 1996;9:381–389. doi: 10.1046/j.1365-313x.1996.09030381.x. [DOI] [PubMed] [Google Scholar]
  33. Long JA, Moan EI, Medford JI, Barton MK. A member of KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature. 1996;379:66–69. doi: 10.1038/379066a0. [DOI] [PubMed] [Google Scholar]
  34. Lou H, McCullough AJ, Schuler MA. 3′ Splice site selection in dicot plant nuclei is position dependent. Mol Cell Biol. 1993;13:4485–4493. doi: 10.1128/mcb.13.8.4485-4493.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Luehrsen KR, Walbot V. Intron creation and polyadenylation in maize are directed by AU-rich RNA. Genes Dev. 1994;8:1117–1130. doi: 10.1101/gad.8.9.1117. [DOI] [PubMed] [Google Scholar]
  36. Mandel MA, Gustafson-Brown C, Savidge B, Yanofsky MF. Molecular characterization of the Arabidopsis floral homeotic gene APTALA1. Nature. 1992;360:273–277. doi: 10.1038/360273a0. [DOI] [PubMed] [Google Scholar]
  37. Maniatis T, Fritsch EF, Sambrook KJ. Molecular Cloning. A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1993. [Google Scholar]
  38. McCarty DR. A simple method for extraction of RNA from maize tissue. Maize Genet Coop Newslett. 1986;60:61. [Google Scholar]
  39. McCullough AJ, Bayton CE, Schuler MA. Interaction across exons can influence splice site recognition in plant nuclei. Plant Cell. 1996;12:2295–2307. doi: 10.1105/tpc.8.12.2295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. McCullough AJ, Lou H, Schuler MA. Factors affecting authentic 5′ splice site selection in plant nuclei. Mol Cell Biol. 1993;13:1323–1331. doi: 10.1128/mcb.13.3.1323-1331.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. McNellis TW, von Arnim AG, Araki T, Komeda Y, Misera S, Deng X-W. Genetic and molecular analysis of an allelic series of cop1 mutants suggests functional roles for multiple protein domains. Plant Cell. 1994;6:487–500. doi: 10.1105/tpc.6.4.487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Meyer CR, Ghosh P, Nadler S, Preiss J. Cloning, expression, and sequence of an allosteric mutant ADPglucose pyrophosphorylase from Escherichia coli B. Arch Biochem Biophys. 1993;302:64–71. doi: 10.1006/abbi.1993.1181. [DOI] [PubMed] [Google Scholar]
  43. Moore MJ, Query CC, Sharp PA. Splicing of precursors to messenger RNAs by the spliceosome. In: Gestland R, Atkins J, editors. The RNA World. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1993. pp. 303–308. [Google Scholar]
  44. Moore MJ, Sharp PA. Evidence of two active sites in the spliceosome provided by stereochemistry of pre-mRNA. Nature. 1993;365:364–368. doi: 10.1038/365364a0. [DOI] [PubMed] [Google Scholar]
  45. Nishihama R, Banno H, Kawahara E, Irie K, Machida Y. Possible involvement of differential splicing in regulation of the activity of Arabidopsis ANP1 that is related to mitogen-activated protein kinase kinase kinase (MAPKKKs) Plant J. 1997;12:39–48. doi: 10.1046/j.1365-313x.1997.12010039.x. [DOI] [PubMed] [Google Scholar]
  46. Okumiya T, Ishii S, Kase R, Kamei S, Sakuraba H, Yoshiyki S. α-Galactosidase gene mutations in Fabry disease: heterogeneous expressions of mutant enzyme proteins. Hum Genet. 1995;95:557–556. doi: 10.1007/BF00223869. [DOI] [PubMed] [Google Scholar]
  47. Parker R, Guthrie C. A point mutation in the conserved hexa-nucleotide at a yeast 5′ splice site junction uncouples recognition, cleavage and ligation. Cell. 1985;41:107–118. doi: 10.1016/0092-8674(85)90065-0. [DOI] [PubMed] [Google Scholar]
  48. Parker R, Siliciano PG. Evidence for an essential non-Watson-Crick interaction between the first and last nucleotides of a nuclear pre-mRNA intron. Nature. 1993;361:660–662. doi: 10.1038/361660a0. [DOI] [PubMed] [Google Scholar]
  49. Pautot V, Brzezinski R, Tepfer M. Expression of mouse metallothionein gene in transgenic plant tissue. Gene. 1989;77:133–140. doi: 10.1016/0378-1119(89)90367-3. [DOI] [PubMed] [Google Scholar]
  50. Sharp PJ. Split genes and RNA splicing. Cell. 1994;77:805–815. doi: 10.1016/0092-8674(94)90130-9. [DOI] [PubMed] [Google Scholar]
  51. Shaw JR, Hannah LC. Genomic sequence of the wild type Shrunken-2 allele of Zea mays. Plant Physiol. 1992;98:1214–1216. doi: 10.1104/pp.98.3.1214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Sieburth LE, Running MP, Meyerowitz EM. Genetic separation of the third and fourth whorl functions of AGAMOUS. Plant Cell. 1995;7:1249–1258. doi: 10.1105/tpc.7.8.1249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Simpson CG, Brown JWS. Efficient splicing of AU-rich antisense intron sequence. Plant Mol Biol. 1993;21:205–211. doi: 10.1007/BF00019937. [DOI] [PubMed] [Google Scholar]
  54. Simpson CG, Clark G, Davidson D, Smith P, Brown JWS. Mutation of putative branchpoint consensus sequences in plant introns reduces splicing efficiency. Plant J. 1996;9:369–380. doi: 10.1046/j.1365-313x.1996.09030369.x. [DOI] [PubMed] [Google Scholar]
  55. Simpson CG, Filipowicz W. Splicing of precursors to mRNA in higher plants: regulation and sub-nuclear organization of the spliceosomal machinery. Plant Mol Biol. 1996;32:1–41. doi: 10.1007/BF00039375. [DOI] [PubMed] [Google Scholar]
  56. Smith CJW, Chu TT, Nadal-Ginard B. Scanning and competition between AGs are involved in 3′ splice site selection in mammalian introns. Mol Cell Biol. 1993;13:4939–4952. doi: 10.1128/mcb.13.8.4939-4952.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Smith CJW, Patton JG, Nadal-Ginard B. Alternative splicing in the control of gene expression. Annu Rev Genet. 1989;23:527–577. doi: 10.1146/annurev.ge.23.120189.002523. [DOI] [PubMed] [Google Scholar]
  58. Taylor MG, Vasil IK. Histology of, and physical factors affecting, transient GUS expression in plant millet (Pennisetum glaucum (Li) R. Rv.) embryos following microprojectile bombardment. Plant Cell Rep. 1991;10:120–125. doi: 10.1007/BF00232041. [DOI] [PubMed] [Google Scholar]
  59. Tsai CY, Nelson OE. Starch deficient maize mutant lacking ADP-glucose pyrophosphorylase activity. Science. 1966;151:341–343. doi: 10.1126/science.151.3708.341. [DOI] [PubMed] [Google Scholar]
  60. van Santen VL, Spritz RA. Splicing of plant pre-mRNAs in animal system and vice versa. Gene. 1987;56:253–265. doi: 10.1016/0378-1119(87)90142-9. [DOI] [PubMed] [Google Scholar]
  61. Vasil V, Clancy M, Ferl RJ, Vasil IK, Hannah LC. Increased gene expression by the first intron of maize shrunken-1 locus in grass species. Plant Physiol. 1989;91:1575–1579. doi: 10.1104/pp.91.4.1575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Waigmann E, Barta A. Processing of chimeric introns in dicot plants: evidence for close cooperation between 5′ and 3′ splice sites. Nucleic Acids Res. 1992;20:75–81. doi: 10.1093/nar/20.1.75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Weil CF, Wessler SR. The effects of plant transposable element insertion on transcription initiation and RNA processing. Annu Rev Plant Physiol. 1991;42:527–552. [Google Scholar]
  64. Wiebauer K, Herrero J-J, Filipowicz W. Nuclear pre-mRNA processing in plants: distinct modes of 3′-splice-site selection in plants and animals. Mol Cell Biol. 1988;8:2042–2051. doi: 10.1128/mcb.8.5.2042-2051.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Yanofsky MF, Ma H, Bowman JL, Drews GN, Feldmann KA, Meyerowitz EM. The protein encoded by the Arabidopsis homeotic gene agamous resembles transcription factors. Nature. 1990;346:35–39. doi: 10.1038/346035a0. [DOI] [PubMed] [Google Scholar]
  66. Yi Y, Jack T. An intragenic suppressor of the Arabidopsis floral organ identity mutant apetala3-1 functions by suppressing defects in splicing. Plant Cell. 1998;10:1465–1477. doi: 10.1105/tpc.10.9.1465. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Plant Physiology are provided here courtesy of Oxford University Press

RESOURCES