Molecular Detection and Characterization of Wolbachia pipientis from Culex quinquefasciatus Collected from Lahore, Pakistan

Abstract.

The gram-negative, pleomorphic endosymbiont Wolbachia is known to infect a large number of insects and other arthropods naturally. This bacterium modifies the host biology, mainly causing reproductive alterations including feminization, death of male, parthenogenesis, and importantly cytoplasmic incompatibility. Wolbachia-induced cytoplasmic incompatibility results in nonviable offspring and vector population suppression. In addition, this bacterium rapidly spreads and propagates within the host population. This study is the first report on Wolbachia detection and characterization from Culex quinquefasciatus collected from Lahore, Pakistan. For this purpose, mosquito adults were collected from different localities of Lahore and identified at the species level. A total of 145 pairs of ovaries were individually subjected to DNA isolation, and polymerase chain reaction amplification of three (wsp, 16S rRNA, and ftsZ) genes were investigated. In all, 128 females were found positive, representing 82.3% infection rate. The phylogenetic analysis indicated that the detected endosymbiont had 100% homology with Wolbachia pipientis wPip strain and supergroup B. The detection of the local strain of Wolbachia (wPip) will be useful in investigating its potential for the control of dengue vector (Aedes aegypti) and reducing dengue transmission in Pakistan.

INTRODUCTION

Wolbachia is a gram-negative endosymbiotic bacterium, and it belongs to the phylum α-proteobacteria, order Rickettsiales,¹ and family Anaplasmataceae.² Wolbachia was first detected as Rickettsia-like organisms from the common house mosquito Culex pipiens.³ Since then, Wolbachia has been reported in a large number of arthropods and filarial nematodes. It is abundantly found in more than 65% of insects in nature.^4,5 In Cx. pipiens, 76–98% of total microbiota comprises Wolbachia.⁶

Wolbachia is considered as a reproductive parasite and causes various reproductive modifications in its hosts including parthenogenesis, feminization of males, death of males, and cytoplasmic incompatibility.⁷ Cytoplasmic incompatibility is one of the most important characteristics of Wolbachia that results in reduction of the viable progeny. Cytoplasmic incompatibility can be either unidirectional in which Wolbachia-infected sperm fertilizes uninfected egg,⁸ or bidirectional where sperm and egg both are infected but with different strains of Wolbachia, resulting in failure of egg hatching and leading to suppression of host population.⁹

There is a large variety of Wolbachia strains present in arthropods. Multiple Wolbachia strains and various changes in Wolbachia sequences within the same host have been reported.¹⁰ A huge variety of Wolbachia strains have been reported in the recent decades. Wolbachia has incorporated a wide variety of branches in phylogenetic hierarchy, and 14 supergroups have been described so far.¹¹ Supergroups A and B, being the most abundant, are found in insects.⁹ Molecular approach targeting different genes for detection and identification of Wolbachia is considered as a reliable method. The most widely used detection method is carried out by amplifying specific regions of the Wolbachia surface protein (wsp) gene by polymerase chain reaction (PCR). Other different molecular markers include the 16S rRNA gene, dnaA gene which is crucial for the initiation of DNA replication process, the ftsZ (filamenting temperature sensitive) protein-encoding gene, the groE operon encoding two important heat shock proteins of bacteria, hcpA, gltA, fbpA, gatB, and coxA.¹²

Many classified strains of Wolbachia (wMelPop and wMelPop-CLA) are known to inhibit transmission of parasites or pathogens through infected mosquito vectors and to decrease the rate of disease transmission.^13,14 It has been suggested that introduction of specific Wolbachia strains in mosquito vectors and release of these infected vectors into a local population of vectors could prevent the transmission of arboviruses and other human parasites or pathogens such as dengue viruses and Plasmodium.^15,16 The use of Wolbachia as a biological tool for mosquito vector control, detection, and identification of its strains in local insects and other organisms is of prime importance. It is being well documented that Wolbachia is abundantly found in reproductive tissues of various insects. Objectives of the current study are the molecular detection of Wolbachia in the reproductive tissues of Culex mosquitoes collected from various sites of Lahore and the assessment of the phylogenetic status of detected Wolbachia on the basis of wsp, 16S rRNA, and ftsZ genes.

METHODS

Culex quinquefasciatus collection and identification.

Surveillance of Cx. quinquefasciatus mosquitoes was conducted for a period of 4 months from July to October 2014. Adults were collected from four different (indoor and outdoor) locations (Cantonment, Katchery Road, Model Town, and Mughalpura) of Lahore, Pakistan (Figure 1), using a backpack aspirator (John W. Hock Company, Gainesville, FL). Geographical coordinates were collected using GPS Garmin GPSMAP^®; 76CSx. The collected mosquito samples were reared in the insectary, GC University Lahore, Pakistan, under standard conditions (temperature: 27 ± 2°C, relative humidity: 80% ± 5%, and light dark cycle: 12:12 hours). The identification of adult Culex mosquitoes was carried out up to the species level using standard morphological keys.^17,18

Figure 1.

Map of Lahore, Punjab, Pakistan showing sampling sites of Culex quinquefasciatus for the screening of Wolbachia. This figure appears in color at www.ajtmh.org.

Dissections and separation of ovaries.

The females were isolated from males by examining mouth parts, antennae, and the last portion of the abdomen. The selected females were used in the screening process and were paralyzed at 4°C for 5–10 minutes, using the freeze shock method. The mosquitoes were dipped 3× in sterile water, followed by rinsing in 70% ethanol for 5 minutes, and then transferred to successive sterile water baths 5× and once in sterilized 0.8% NaCl.¹⁹ Each individual female was transferred to a clean glass slide containing a drop of phosphate buffer saline (PBS). The ovaries were dissected with the help of sterile dissecting needles under dissecting microscope. A single pair of ovaries was considered as one sample.

PCR amplification of target genes.

Whole genomic DNA was extracted from each sample as described previously.²⁰ Exponential amplification of the extracted DNA (template) was carried out with a PCR thermal cycler (Techne Progene, Cambridge, United Kingdom) in a final volume of 50 µL containing 1× Taq buffer (without MgCl₂), 1.5 mM MgCl₂, 0.2 mM dNTPs, 0.4 mM each primer, 1 U Taq polymerase, and 2 µL whole genomic DNA. Genomic DNA from Aedes aegypti and Aedes albopictus was used as negative and positive control, respectively. The reagents were mixed in 0.5-mL PCR tubes placed on ice in a safety cabinet. The primer sequences targeting three genes (wsp, 16S rRNA, and ftsZ) along with the respective annealing temperature used in PCR are mentioned in Table 1. The following thermal profiles were used: initial denaturation at 94°C for 2 minutes followed by 35 cycles (denaturation at 94°C for 1 minute, annealing optimized at 51°C for 16S rRNA and wsp, and 55°C for ftsZ for 1 minute, and extension at 72°C for 1 minute), and final extension at 72°C for 10 minutes.

Table 1.

The details of gene primers used for the detection and characterization of Wolbachia from Cx. quinquefasciatus collected from Lahore Pakistan

Primers pair 5′-3′	Annealing	Target gene	Estimated product size	GenBank accession number
wsp_F	55°C	wsp	510 bp	KX650071
AAGGAACCGAAGTTCATG
wsp_R
AAAAATTAAACGCTACTCCA
16S rRNA_F	51°C	16S rRNA	890 bp	KX611381
TTGTAGCCTGCTATGGTATAACT
16S rRNA _R
GAATAGGTATGATTTTCATGT
ftsZ_F	55°C	ftsZ	570 bp	KY753917
TACTGACTGTTGGAGTTGTAACTAAGCCGT
ftsZ_R
TGCCAGTTGCAAGAACAGAAACTCTAACTC

Agarose gel electrophoresis.

The PCR products were subjected to 2% agarose gel electrophoresis using 0.5 μg/mL ethidium bromide and 1× TAE buffer. Four microliters of PCR products along with 2 μL of 3× loading dye (bromophenol blue) was loaded with 1-kb ladder as a standard to determine the size of the PCR products. The amplicons were visualized and photographed by using a UV transilluminator and BioDoc-It^® TS imaging system (Ultra-Violet Products Limited, Cambridge, United Kingdom). The DNA samples were stored at −20°C until DNA sequencing.

Sequencing of amplicons and data analysis.

The selected amplified PCR products (two samples from each locality) were purified using gel extraction method followed by DNA sequencing from First BASE Laboratories Sdn Bhd, Kembangan, Malaysia. Briefly, the PCR products underwent Sanger sequencing in both directions using their respective (forward and reverse) primers using a DNA sequencer (96-capillary 3730xl DNA Analyzer; Applied Biosystems, Foster City, CA) and an ABI BigDye Terminator v3.1 cycle sequencing kit.

The quality of the obtained results (chromatogram) was observed using Chromas Lite software (version 2.5.1), and then FASTA format of the forward and reverse partial gene sequences was aligned using the MEGA6 software. Ambiguous sequences were omitted from the results. The partial DNA sequences of selected gene were subjected to BLAST search against the National Center for Biotechnology Information (NCBI) public sequence database (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The nucleotide sequences generated in the present study were deposited in GenBank, and accession numbers were obtained. The phylogenetic tree of each strain was constructed with other taxa of related Wolbachia strains using the Maximum Likelihood method rooted on the Tamura-Nei model with the help of MEGA6 software. Maximum composite likelihood approach was used, and all possible codon frames were considered in the analysis after eliminating gaps.

RESULTS

The present study involves detection and characterization of Wolbachia from local Cx. quinquefasciatus adults collected from the selected localities of Lahore, Pakistan, using the PCR method. Wolbachia infection was calculated as 82.3% (128/145) in collected Cx. quinquefasciatus females using Wolbachia-specific wsp gene primers in PCR. Partially amplified DNA fragments of wsp, 16S rRNA, and ftsZ genes revealed 510, 890, and 570 bp bands of selected four samples on agarose gel (Figure 2). DNA sequencing results of all genes revealed the presence of a single strain of Wolbachia in Culex mosquitoes collected from selected localities.

Figure 2.

Gel electrophoresis analysis of polymerase chain reaction products using wsp (A), 16S rRNA (B), and ftsZ (C) gene primers targeting genomic DNA of Culex quinquefasciatus collected from different areas of Punjab, Pakistan.

Wsp gene sequence was submitted to GenBank with Accession no. KX650071 and its NCBI BLAST results (Table 2) showed 100% homology (Max score 926) with Wolbachia endosymbiont of Cx. quinquefasciatus (Accession no. KJ140126), Culex modestus from China (Accession no. KU723567), and Cx. pipiens from Turkey (Accession no. KT964225). The wsp-gene based phylogenetic tree with the highest log likelihood (−4,762.2634) is given in Figure 3. The final dataset involved 13 nucleotide sequences with 501 positions. The evolutionary tree inferred closeness with Cx. modestus (Accession no. KJ140126) Cx. quinquefasciatus, followed by EruWolCpip2 of Cx. pipiens (Accession no. KT964225).

Table 2.

Details of arthropods having identical gene sequences with wsp partial cds (Accession KX650071) of wPip Wolbachia in Cx. quinquefasciatus collected from Lahore Pakistan

Sr. No.	Strain/isolate	Host	Order, family	Country/origin	Total score	Query coverage (%)	E value	Ident (%)	Accession
1	GD13098	Culex quinquefasciatus	Diptera, Culicidae	China	926	100	0.0	100	KJ140126
2	AlSK-w035	Culex modestus	Diptera, Culicidae	China	926	100	0.0	100	KU723567
3	EruWolCpip3	Culex pipiens	Diptera, Culicidae	Turkey	926	100	0.0	100	KT964225
4	wTde-HEB	Trichogramma dendrolimi	Hymenoptera, Trichogrammatidae	China	926	100	0.0	100	JX027991
5	EW 13-7	Polygonia calbum	Lepidoptera, Nymphalidae	Not Available	926	100	0.0	100	JN093149
6	Not available	Hercinothrips femoralis	Thysanoptera, Thripidae	Japan	926	100	0.0	100	AB245521
7	Wbra2	Trichogramma brassicae	Hymenoptera, Trichogrammatidae	China	926	100	0.0	100	AF452646
8	WDen Qiqihae	T. dendrolimi	Hymenoptera, Trichogrammatidae	China	926	100	0.0	100	DQ017751
9	WHecCI1	Eurema hecabe	Lepidoptera, Pieridae	Japan	926	100	0.0	100	AB094393
10	WBra	Mamestra brassicae	Lepidoptera, Noctuidae	Japan	926	100	0.0	100	AB094375
11	Wds	Cx. pipiens pallens	Diptera, Culicidae	China	926	100	0.0	100	AF216860
12	EruWolCpip2	Cx. pipiens	Diptera, Culicidae	Turkey	924	99	0.0	100	KT964224
13	wPip	Cx. quinquefasciatus	Diptera, Culicidae	Not available	922	99	0.0	100	AM999887
14	EruWolCpip6	Cx. pipiens	Diptera, Culicidae	Turkey	920	100	0.0	99	KT964228
15	wtauFJ1	Bactrocera tau	Diptera, Tephritidae	China	920	100	0.0	99	DQ450892
16	WDen	E. hecabe	Lepidoptera, Pieridae	China	920	100	0.0	99	DQ017750

Figure 3.

wsp gene-based phylogenetic tree of Wolbachia pipientis wPip strain found in Culex quinquefasciatus using maximum likelihood method (Accession no. KX650071).

The 16S rRNA gene sequence of Wolbachia pipientis was submitted to GenBank as Accession no. KX611381. NCBI BLAST results of the obtained 16S rRNA sequence showed 99% homology with the wPip strain of Wolbachia endosymbiont found in Cx. quinquefasciatus Pel, indicating that the strain obtained in this study belongs to subgroup wPip. The evolutionary tree was traced on 13 nucleotide sequences with 895 positions in the final dataset including the highest log likelihood (−7,883.4825). The phylogenetic tree shows that the query sequence is closely related to Wolbachia of Ectropis grisescens (Lepidoptera, Geometridae) (Accession no. KT862198) and wPip strain of Cx. quinquefasciatus (Accession no. AM999887) (Figure 4).

Figure 4.

16Sr RNA gene-based phylogenetic tree of Wolbachia pipientis wPip strain found in Culex quinquefasciatus using maximum likelihood method (Accession no. KX611381).

DNA sequence of the ftsZ gene was submitted to NCBI GenBank under Accession no. KY753917. NCBI BLAST results indicated 98% homology with Wolbachia of Cx. pipiens from Argentina (Accession no. GU901160) and wPip Wolbachia of Cx. quinquefasciatus (Accession no. AM99887) reported from Australia. The tree was constructed with 13 nucleotide sequences with the highest log likelihood (−6,983.9439) including 570 positions. The phylogenetic tree indicated a close relationship of the obtained ftsZ gene sequence to the supergroup B wPip isolate of Cx. quinquefasciatus (Accession no. AM99887) (Figure 5).

Figure 5.

ftsZ gene-based phylogenetic tree of Wolbachia pipientis wPip strain found in Culex quinquefasciatus using maximum likelihood method (Accession no. KY753917).

DISCUSSION

Wolbachia has received increased attention in recent years because of its high rates of distribution in several insects and its unique effects on host physiology. They are the most widely occurring intracellular bacteria in arthropods found in major insect orders, including Orthoptera, Diptera, Coleoptera, Hemiptera, Lepidoptera, and Hymenoptera.²¹ These obligate parasites are also found naturally in some of the medically important insects including mosquitoes such as Culex and Ae. albopictus, which are important vectors for the transmission of viruses such as West Nile Virus and Dengue viruses etc. respectively. The detection of Wolbachia strain in any given organism is done either by using staining methods^3,22 or by amplification of Wolbachia-specific genes including 16S rRNA, wsp and ftsZ genes, etc.²³ The molecular approach, including gene amplification and characterization, is more significant to find out the phylogenetic status of Wolbachia.⁷ The current study deals with the use of 16S rRNA and wsp and ftsZ genes for the detection and molecular characterization of Wolbachia isolates from Cx. quinquefasciatus collected from the different regions of Lahore, Pakistan.

In this study, 82.3% Wolbachia infection was found in Cx. quinquefasciatus female mosquitoes. Various Wolbachia infection levels have been reported in different regions of the world. In a study from Iran,²⁴ all of the Cx. quinquefasciatus tested were found to be positive whereas other species including Culex tritaeniorynchus and Culex theileri were found to be negative for Wolbachia. It has also been reported previously that Wolbachia infection frequency in Cx. quinquefasciatus from three villages of South India was 91.2%.²⁵ In addition, Kittayapong et al.²⁶ conducted a survey of Wolbachia infection in mosquitoes from Thailand and found 42.1% Wolbachia infection in 29 species of the genus Culex by targeting ftsZ and wsp genes. The authors did not find any Wolbachia infection in Anopheles mosquitoes.

In another report, 14 mosquito species related to five genera (Aedes, Culex, Anopheles, Ochlerotatus, and Culiesta) from North America were tested for the presence of Wolbachia. Only species of the Cx. pipiens complex were found to be positive.²⁷ Ricci et al.²⁸ investigated 26 mosquito species out of which five (three Culex and two Aedes species) carried Wolbachia infection. Karami et al.²⁹ screened Wolbachia in Cx. pipiens collected from three provinces of Iran and found 87.3% infection. In a report of Wolbachia infection in the Cx. pipiens complex of mosquitoes from Germany and the Philippines, Wolbachia infection was confirmed in all of the Culex mosquitoes tested based on the of 16S rRNA gene of Wolbachia.³⁰

A number of valuable molecular methods have provided the basis for phylogenetic studies. General Wolbachia primers and Wolbachia supergroup A- and B-specific primers may be used for the wsp gene.

Characterization of the detected strain of Wolbachia in the current study showed that it is related to supergroup B and subgroup (strain) wPip. The current results are consistent with some previously reported studies in different regions of the world. In India, Patole and Shouche¹² found Wolbachia in Cx. quinquefasciatus which was related to the wPip strain and supergroup B. In another study, it was also reported that three tested Culex species (Culex torrentium, Cx. pipiens, and Cx. modestus) fall in supergroup B.²⁸ Recently Karami et al.²⁹ also placed a type strain from Cx. pipiens within supergroup B. Furthermore, Kittayapong et al.²⁶ reported Wolbachia in three Culex species (Cx. quinquefasciatus, Culex fuscocephala, and Culex sitiens) collected from the Southeast Asian region belonging to supergroup B and wPip strain. Similar findings were also reported by Yildirim et al.⁵ who studied Cx. pipiens.

The current study reports the detection and characterization of Wolbachia in Cx. quinquefasciatus for the first time in Pakistan. The information obtained so far about Wolbachia abundance in different arthropods found in Pakistan is inadequate. Therefore, there is dire need to determine the distribution and type of Wolbachia infections in insects. Moreover, the potential of Wolbachia strain may be evaluated as biological control agent to combat vector-borne diseases (dengue and malaria) in endemic areas of Pakistan.