Skip to main content
PMC home page
PLOS ONE logoLink to PLOS ONE
. 2018 May 2;13(5):e0196680. doi: 10.1371/journal.pone.0196680

The use of the hypervariable P8 region of trnL(UAA) intron for identification of orchid species: Evidence from restriction site polymorphism analysis

Rajkumar Kishor 1,¤,*, G J Sharma 1
Editor: Serena Aceto2
PMCID: PMC5931654  PMID: 29718976

Abstract

The P8 stem-loop region of the trnL intron, which is known to be hypervariable in size with multiple repeat motifs and created difficulties in alignment, is always excluded in phylogenetic as well as barcode analyses. This region was investigated for species discrimination in 98 taxa of orchids belonging to the tribe Vandeae using in silico mapping of restriction site polymorphism. The length of the P8 regions varied from 200 nucleotides in Aerides rosea to 669 nucleotides in Dendrophylax sallei. Forty two taxa had unique lengths, while as many as eight shared a common length of 521 nucleotides. Of the 35 restriction endonucleases producing digestions in the P8 regions, three, viz., AgsI, ApoI and TspDTI turned out to have recognition sites across all the 98 taxa being studied. When their restriction data were combined, 92 taxa could be discriminated leaving three taxon pairs. However, Acampe papillosa and Aeranthes arachnites despite having similar restriction sites differed in their P8 lengths. This is the first report on thorough investigation of the P8 region of trnL intron for search of species specific restriction sites and hence its use as a potential plant DNA barcode.

Introduction

For the past few decades there has been a hunt for a short DNA segment which can be used as a universal marker, popularly termed as DNA Barcode, for identification of faunal and floral species inhabiting this planet. For animal identification the mitochondrial gene cytochrome c oxidase subunit 1 (COX1) has proved successful [1] however, there is still difficulty in fixing a universal barcode for plants because of a more complex genetic background. Various nuclear and plastid coding and non-coding loci, viz., ITS1, ITS2, accD, matK, ndhJ, rpoB, rpoC1, ycf5, atpF-H, psbK-I, rbcL, rbcLa, trnH-psbA, trnL-F, etc. have been tested for validation either singly or in combination of two or more loci [2–4].

The chloroplast trnL-F non-coding region includes the trnL(UAA) intron ranging from 350 to 600 base pairs (bp) and the intergeneric spacer between trnL(UAA) 3′ exon and the trnF(GAA) gene [5,6]. The trnL(UAA) intron interrupts the anticodon loop of the tRNALeu, which is encoded in the large single copy region of the plastid genome. In the chloroplast DNA, trnL is the only Group I intron region having conserved secondary structure [7,8] with alternation of conserved and variable regions [9]. They are capable of catalyzing their own splicing from the flanking exons. The secondary structure of trnL intron contains regions of complimentary sequences that form nine stem-loop structures (P1-P9) [10]. Within these stems there are four regions (P, Q, R and S) conserved in primary sequences among all group I introns [11] and they are known as the catalytic core [12]. The P8 stem-loop region of the trnL intron is known to be hypervariable in size with multiple repeat motifs [12,13] and created difficulties in alignment. Therefore, this region is always excluded in phylogenetic as well as barcode analyses [14–17].

Orchidaceae comprises of 850 genera and 20,000 species which are arranged in five subfamilies, 22 tribes and 70 sub-tribes [18]. The tribe Vandeae consists of five sub-tribes, 139 genera with 2600 species of monopodial epiphytes distributed in tropical America, tropical and southern Africa, tropical and sub-tropical Asia, eastern Australia and Tasmania, much of the tropical Pacific south to New Zealand and east to Tahiti [19]. Considering the hypervariability to be an intrinsic property of the P8 region of trnL(UAA) intron, the present investigation was undertaken to find out whether the locus had any potential in discrimination of closely related species belonging to the tribe Vandeae based on in silico restriction site polymorphism analysis.

Materials and methods

Gene sequences

One hundred and twenty five sequences of tRNALeu (trnL) gene for orchids belonging to tribe Vandeae were downloaded from GenBank. These included ten sequences (GU185926, GU185928, GU185931, GU185932, GU185933, GU185934, GU185935, GU185938, GU185939 and GU185940) generated and submitted by the first author. Methods followed for DNA extraction and PCR amplification were given by Kishor and Sunitibala [20]. Sequencing was done using 3730 DNA Analyzer (Applied Biosystems, Warrington, UK) available at DNA Sequencing Facility, University of Delhi, South Campus. The primer pair ‘c’ (3′CGAAATCGGTAGACGCTACG5′) and ‘d’ (3′GGGGATAGAGGGACTTGAAC5′) [5] were used for amplification as well as sequencing.

In silico analysis of restriction site polymorphism for species discrimination

The trnL intron borders were delimited by identifying the binding sites of the primers ‘c’ and ‘d’. We looked for the P8 region by delimiting the borders following the method of Borsch et al. [13] and by considering the secondary structures of trnL of Campylopus flexuous [21] and Nymphaea odorata [13]. The correctness of the borders was again verified by considering the secondary structures of the P8 regions drawn for Aerides odorata, A. sukauensis and A. krabiensis [16].

In silico restriction mapping was done using the online software RestrictionMapper Version 3 (http://restrictionmapper.org/). Selection was made to include all commercially available restriction enzymes and find the base pair position where each enzyme cut the trnL P8 region for all the taxa. The program was set to allow providing maximum cuts with a minimum site length of 5 nucleotides. As many as 35 restriction endonucleases were found to have recognition sites in the P8 regions; however, only four, viz., AgsI, ApoI, TspDTI and VspI (five and six base cutters) were selected for the analysis because each of them had their recognition sites in the region across all the taxa.

The in silico mapped restrictions produced by the four enzymes were scored by presence (1) or absence (0). Further analyses were done using the computer package NTSYS [22]. Similarity matrix was generated using the program Qualitative in NTSYS 2.20e package. This matrix was subjected to the unweighted pair group method with arithmetical averages (UPGMA). Cluster analysis was performed on the similarity matrix with the SAHN program using UPGMA and the dendrograms were generated with the TREE program. Analysis was done for each enzyme as well as for combination of two, three and four of them.

Results

Length variation of trnL P8 region

The downloaded trnL sequences for the 125 accessions contained many with incomplete sequences. After establishing the borders, only 98 taxa with complete sequence of the P8 region could be selected for the analysis. The length of the P8 regions varied from 200 nucleotides (Aerides rosea) to 669 nucleotides (Dendrophylax sallei) (Fig 1, Table 1). Forty two taxa had unique lengths, while as many as eight shared a common length of 521 nucleotides (Aeranthes arachnites, Aeranthes grandiflora, Angraecum conchiferum, Angraecum dives, Angraecum leonis, Bonniera appendiculata, Phalaenopsis amboinensis, and Phalaenopsis modesta). Within the genus Phalaenopsis, which is represented by 23 species in the present study, length variation of the P8 regions ranged from 494 (P. tetraspis) to 538 nucleotides (P. lindenii); while in eight taxa of Vanda, it ranged from 471 (V. testaceae) to 562 nucleotides (V. grifithii).

Fig 1. Length variation of the trnL(UAA) intron P8 regions of the 98 taxa of orchids versus number of taxa sharing common lengths.

Fig 1

Open in a new tab

Table 1. Sequence lengths of trnL P8 regions of 98 orchid taxa along with the restriction sites for the endonucleases AgsI, ApoI, TspDTI and VspI.

Taxa GenBank Accession No. Length of P8 region
(nucleotides)		 Restriction endonucleases and their respective restriction sites (nucleotides)
Ags1 (TTSAA) Apo1 (RAATTY) TspDTI (ATGAA) VspI (ATTAAT)
Acampe ochracea DQ091438 421 259, 265, 293, 357, 400, 406 146, 180, 344, 380 27, 193, 289, 345, 361 121, 192
Acampe papillosa DQ091439 420 259, 265, 293, 357, 400 146, 180, 344, 380 27, 193, 289, 345, 361, 418 121, 192
Aeranthes arachnites DQ091536 521 259, 265, 293, 357, 400 146, 180, 344, 380 27, 193, 289, 345, 361, 418 121, 192
Aeranthes grandiflora DQ091537 521 238, 400, 428, 434, 452, 500 145, 238, 445 27, 263, 405, 463, 519 120, 301
Aerides crassifolia EF670402 492 195, 397, 403, 428, 471 146, 189, 196, 415, 451, 472 27, 201, 221, 226, 318, 374, 432 121, 263
Aerides crispa EF670407 484 189, 361, 389, 395, 412, 420, 463 140, 183, 190, 407, 443, 464 27, 195, 215, 310, 366, 424 115, 230, 241
Aerides krabiensis EF670404 217 196 155, 190, 197 27, 202 130
Aerides multiflora DQ194983 216 195 146, 189, 196 27, 190, 201 121
Aerides odorata EF670389 450 166, 327, 355, 361, 386, 429 125, 160, 167, 373, 409, 430 27, 172, 192, 197, 276, 332, 390 100, 221
Aerides rosea EF670405 200 138, 179 138, 173, 180 27, 174, 185 113
Aerides sukauensis EF670408 479 195, 356, 384, 390, 415, 458 189, 196, 402, 459 27, 201, 221, 305, 361, 419 121, 236
Ancistrorhynchus cephalotes EF670435 619 345, 526, 532, 598 145, 345, 544 27, 199, 370, 503 120, 603, 120, 603
Angraecum calceolus DQ091546 505 238, 420, 484 145, 238, 431 27, 263, 447 120, 294, 489
Angraecum conchiferum DQ091539 521 238, 428, 434, 500 145, 238, 446 27, 263, 405, 463 120, 301, 505
Angraecum dives DQ091547 521 238, 400, 428, 434, 500 145, 238, 446 27, 263, 405
Angraecum eichlerianum AF506341 639 145, 238, 446 147, 359, 558 27, 194, 201, 384, 517, 575 122, 617, 623
Angraecum florulentum DQ091550 513 237, 392, 420, 426, 492 145, 237, 438 27, 262, 397, 455 120, 293, 497
Angraecum leonis DQ091551 521 238, 400, 428, 434, 500 145, 238, 446 27, 263, 405, 463 120, 301, 505
Angraecum magdalenae AF519973 616 334, 490, 524, 595 145, 254, 334, 536 27, 210, 359, 495, 553 120, 243, 391, 600
Angraecum rutenbergianum DQ091548 443 321, 349, 355, 421 145, 367 27, 326, 384 120, 222, 426
Angraecum teres DQ091552 542 145, 252, 266, 421, 449, 455, 521 266, 467 27, 291, 426, 484 120, 322, 526
Arachnis labrosa GU185926 478 195, 357, 385, 391, 416, 459 146, 189, 196, 403, 460 27, 201, 221, 306, 362, 420 121, 236, 250
Ascocentrum curvifolium EF670423 494 187, 371, 399, 405, 430, 473, 479 146, 180, 188, 417, 438, 453 27, 193, 213, 320, 376, 434 121, 228, 250, 265
Beclardia macrostachya DQ091497 523 259, 411, 439, 445, 502 145, 259, 457 27, 192, 198, 284, 416 120, 312, 507
Bonniera appendiculata DQ091541 521 238, 428, 434, 451, 500 145, 238, 446 27, 263, 405, 463 120, 301, 505
Christensonia vietnamica EF670413 497 200, 367, 395, 401, 426, 476, 482 146, 193, 201, 413, 434, 449 27, 206, 226, 316, 372, 43027, 206, 226, 316, 372, 430 121, 247
Cleisostoma racemiferum GU185928 525 231, 402, 430, 436, 461, 504, 510 146, 224, 232, 448, 484 27, 163, 214, 230, 237, 257, 351, 407, 465 121, 204, 273, 296
Cryptopus elatus DQ091450 523 240, 402, 430, 436, 453, 502 145, 240, 448 27, 265, 407, 465 120, 303, 507
Cryptopus paniculatus DQ091451 514 233, 393, 421, 427, 444, 493 145, 233, 439 27, 258, 398, 456 120, 498
Dendrophylax sallei AY147234 669 186, 379, 509, 582, 648 145, 379, 594 27, 192, 210, 272, 404, 553, 560, 611 120, 653
Dimorphorchis rossii var. graciliscapa EF670429 519 214, 396, 424, 430, 455, 498, 504 141, 208, 215, 278, 284, 442, 478 27, 220, 240, 345, 401, 459 116, 255, 269
Holcoglossum kimballianum EF670419 629 218, 506, 534, 540, 565, 608 146, 212, 219, 552, 588, 609 27, 224, 244, 455, 511, 569 121, 255, 262, 285, 292, 315, 322
Holcoglossum subulifolium EF670409 467 187, 344, 372, 378, 446 146, 181, 188, 390, 426, 447 27, 193, 213, 293, 349, 407 121, 224
Jumellea maxillarioides DQ091554 506 238, 408, 419, 485 145, 238, 431 27, 263, 392, 450 120, 286
Jumellea sagittata DQ091555 508 238, 387, 415, 421, 487 145, 238, 433 27, 263, 390, 448 120, 288, 492
Lemurorchis madagascariensis DQ091556 528 238, 407, 435, 441, 507 145, 238, 453 27, 412, 470 120, 512
Listrostachys pertusa DQ091509 524 238, 403, 431, 437, 454, 503 145, 238, 398, 449 27, 157, 263, 408, 466 120
Luisia trichorrhiza EF670428 605 213, 482, 510, 516, 541, 584 146, 207, 214, 376, 499, 528, 564, 585 219, 239, 243, 259, 263, 279, 387, 431, 487, 545 121, 303
Luisia tristis EF670426 596 219, 473, 501, 507, 532, 575 161, 213, 220, 490, 519, 576 225, 245, 249, 265, 269, 285, 374, 393, 422, 478, 536 136, 309
Microcoelia stolzii DQ091530 480 221, 359, 387, 393, 459 145, 221, 354, 405 27, 309, 364, 422 120
Neofinetia falcata EF670421 497 187, 374, 402, 408, 433, 476, 482 146, 181, 188, 391, 420, 456 27, 193, 213, 273, 323, 379, 437 121, 228, 237, 253
Oeonia rosea DQ091452 516 395, 423, 429, 495 145, 233, 441 27, 258, 400, 458 120, 296, 500
Paraphalaenopsis labukensis EF670425 507 384, 412, 418, 443 146, 401, 430, 466, 487 27, 210, 217, 222, 229, 314, 333, 389, 447 121, 250, 264
Pelatantheria insectifera GU185931 482 187, 383, 389, 406, 414, 461, 467 146, 180, 188, 401, 422, 437 27, 193, 213, 320, 382, 388, 418 121, 260
Phalaenopsis amboinensis AY273643 521 178, 398, 426, 432, 457, 500, 506 137, 172, 179, 444, 480 27, 184, 204, 211, 403, 461 112, 226, 234, 286
Phalaenopsis bellina AY273632 495 178, 372, 400, 406, 431, 474, 480 137, 172, 179, 418, 454 27, 184, 204, 377, 435 112, 219, 227, 246, 260
Phalaenopsis celebensis AY265799 507 187, 384, 412, 418, 443, 486, 492 146, 181, 188, 430 27, 193, 213, 389, 447 121, 228, 242, 262
Phalaenopsis corningiana AY273670 508 178, 385, 413, 419, 444, 487, 493 137, 172, 179, 431, 467 27, 184, 204, 390, 448 112, 219, 235, 249
Phalaenopsis cornu-cervi AY265751 501 378, 406, 412, 437, 480, 486 137, 172, 424 27, 184, 204, 383, 441 112, 219, 227, 242, 256
Phalaenopsis deliciosa DQ091444 415 292, 320, 326, 351, 394, 400 146, 181, 338, 374 27, 193, 297, 355 121
Phalaenopsis inscriptiosinensis AY273673 498 178, 375, 403, 409, 434, 477, 483, 676, 873, 901, 907, 932, 975, 981 137, 172, 179, 421, 457, 635, 670, 677, 919, 955 27, 184, 204, 380, 438, 525, 682, 702, 878, 936 112, 219, 241, 263, 610, 717, 739, 761
Phalaenopsis lamelligera AY273679 501 178, 378, 406, 412, 437, 480, 486 137, 172, 179, 424, 460 27, 184, 204, 321, 383, 441 112, 219, 227, 242, 256
Phalaenopsis lindenii AY273649 538 211, 415, 443, 449, 474, 517, 523 146, 205, 212, 461, 497 27, 217, 237, 420, 478 121, 252, 270, 284
Phalaenopsis lueddemanniana AY273640 517 394, 422, 428, 453, 496, 502 137, 172, 179, 440, 476 27, 184, 204, 399, 457 112, 219, 227, 246, 268
Phalaenopsis maculata AY273641 519 396, 424, 430, 455, 498, 504 147, 189, 197, 442, 478 27, 201, 222, 401, 459 122, 254, 268
Phalaenopsis mannii AF519969 523 185, 400, 428, 434, 459, 502, 508 137, 179, 186, 446, 482 27, 191, 211, 405, 463 112, 226, 234, 267, 288
Phalaenopsis mariae AY265770 519 396, 424, 430, 455, 498, 504 137, 172, 179, 442, 478 27, 184, 204, 231, 401, 459 112, 219, 227, 247, 261, 284
Phalaenopsis micholitzii AY273701 505 178, 382, 410, 416, 441, 484, 490 137, 172, 179, 428, 464 27, 184, 204, 387, 445 112, 219, 227, 246, 260
Phalaenopsis modesta AY265793 521 178, 398, 426, 432, 457, 500, 506 137, 172, 179, 444, 480 27, 184, 204, 403, 461 112, 236, 262, 272, 286
Phalaenopsis pantherina AY273666 501 178, 378, 406, 412, 437, 480, 486 137, 172, 179, 424, 460 27, 184, 204, 217, 321, 383, 441 112, 219, 242, 256
Phalaenopsis philippinensis AY273656 511 192, 388, 416, 422, 447, 490, 496 151, 186, 193, 434, 470 27, 198, 218, 393, 451 126, 245, 259
Phalaenopsis pulchra AY273639 517 394, 422, 428, 453, 496, 502 137, 179, 440, 476 27, 204, 399, 457 112, 218, 226, 245, 267, 281
Phalaenopsis schilleriana AY265781 511 192, 388, 416, 422, 447, 490, 496 151, 186, 193, 434, 470 27, 198, 218, 393, 451 126, 245, 259
Phalaenopsis stuartiana AY273654 507 384, 412, 418, 443, 486, 492 146, 181, 430, 466 27, 193, 213, 389, 447 121, 240, 254
Phalaenopsis sumatrana AY273695 508 178, 385, 413, 419, 444, 487, 493 137, 172, 179, 431, 467 27, 184, 204, 390, 448 112, 219, 235, 249
Phalaenopsis tetraspis AY265784 494 178, 371, 399, 405, 430, 473, 479 137, 172, 179, 417, 453 27, 184, 204, 376, 434 112, 219, 235, 249, 259
Phalaenopsis violacea AY273635 507 178, 384, 412, 418, 443, 486, 492 137, 172, 179, 430, 466 27, 184, 204, 389, 447 112, 219, 227, 246, 272
Pomatocalpa diffusum EF670432 471 187, 348, 376, 382, 399, 407, 450, 456 146, 180, 188, 394 213, 297, 353, 411 121, 228
Pomatocalpa spicatum EF670431 490 146, 187, 367, 395, 418, 426, 469 146, 180, 188, 413, 470 27, 193, 213, 316, 372, 430 121, 228, 247
Rangaeris amaniensis DQ091512 517 238, 424, 430, 496 145, 238, 442 27, 263, 401, 408, 459 120
Rangaeris rhipsalisocia DQ091511 515 145, 239, 427, 433, 494 239, 440 27, 185, 264, 404, 457 120
Renanthera imschootiana GU185932 472 147, 188, 349, 377, 383, 400, 408, 451, 457 147, 182, 189, 343, 395, 416, 431 27, 194, 214, 298, 354, 412 122, 229
Renanthera matutina AY273688 498 146, 375, 409, 434, 483 146, 181, 188, 421 27, 213, 324, 380 121, 228, 246, 256, 275, 448
Renantherella histrionica AY273692 496 146, 187, 386, 414, 420, 445 146, 181, 188, 380, 432, 468 27, 193, 208, 213, 335, 391, 449 121, 228, 241, 265
Rhipidoglossum kamerunense DQ091492 512 238, 418, 424, 491 145, 238, 437 27, 263, 269, 395, 454 120, 496
Rhipidoglossum rutilum DQ091494 522 238, 428, 434, 501 145, 238, 447 27, 263, 269, 405, 464 120, 506
Rhipidoglossum subsimplex DQ091496 512 238, 418, 424 145, 238, 437 27, 263, 269, 395, 454 120, 496
Rhynchostylis gigantea EF670411 479 195, 356, 384, 390, 407, 415, 458 146, 189, 196, 402, 438, 459 27, 73, 201, 221, 305, 361, 419 121, 236, 250
Rhynchostylis retusa EF670424 501 378, 406, 412, 429, 480 146, 424, 445, 460, 481 27, 201, 327, 383, 441 121, 226, 246, 265
Sedirea japonica EF670433 473 350, 378, 384, 401, 409, 452 146, 396, 432, 453 27, 193, 200, 355, 413 121, 222, 244
Seidenfadenia mitrata EF670414 490 200, 367, 395, 401, 426, 469, 475 146, 193, 201, 413, 449 27, 206, 226, 316, 372, 430 121, 247
Smitinandia micrantha EF670415 481 187, 319, 325, 353, 410, 417, 460, 466 146, 180, 188, 404, 440 27, 193, 213, 349, 405, 421 121, 228, 252
Sobennikoffia humbertiana DQ091558 514 238, 393, 421, 427, 493 145, 238, 439 27, 263, 398, 456 120, 295, 498
Trichoglottis atropurpurea DQ091440 430 330, 335, 341, 366, 409 146, 188, 302, 353, 410 27, 201, 256, 312, 370 121, 196, 200
Trichoglottis bipunctata EF670430 531 187, 436, 442, 459, 467, 510 146, 180, 188, 403, 454, 511 27, 193, 219, 356, 412, 471 121, 248, 279
Tridactyle crassifolia DQ091515 530 55, 145, 244, 437, 443, 509 244, 455 27, 269, 414, 472 120
Tridactyle filifolia DQ091516 530 145, 244, 437, 443, 509 244, 455 27, 269, 414, 472 120
Tridactyle tanneri DQ091520 518 239, 358, 425, 431, 497 146, 239, 443 27, 158, 264, 402, 460 121
Vanda alpina GU185933 526 187, 403, 431, 437, 462, 505, 511 146, 180, 188, 449, 485 27, 193, 213, 352, 408, 466 121, 228, 259, 277, 295
Vanda coerulea GU185935 549 208, 426, 454, 460, 485, 528, 534 146, 201, 209, 472, 508 27, 214, 234, 375, 431, 489 121, 257, 271, 275, 294, 311, 328
Vanda flabellata EF670410 477 187, 354, 382, 388, 413, 456, 462 146, 180, 187, 400, 436 27, 193, 213, 303, 359, 417 121, 234
Vanda griffithii GU185934 562 187, 444, 472, 478, 541, 547 146, 180, 188 27, 193, 213, 375, 393, 449, 503 121, 228, 245, 276, 302, 320, 338
Vanda luzonica AY273699 511 187, 387, 415, 421, 447, 490, 496 146, 180, 188, 434, 470 27, 193, 213, 336, 392, 451 121, 262
Vanda motesiana* GU185938 510 187, 387, 415, 421, 438, 446, 489, 495 180, 188, 433, 469 27, 193, 213, 336, 392, 450 121, 228, 248, 262
Vanda stangeana# GU185939 525 187, 402, 430, 436, 461, 504, 510 146, 180, 188, 448, 484 27, 193, 220, 230, 332, 350, 406, 465 121, 245, 277
Vanda testacea GU185940
 471 187, 348, 376, 382, 399, 407, 450, 456 180, 188, 394, 430 27, 193, 213, 297, 353, 411 121, 228, 242
Vandopsis gigantea EF670417
 482 187, 348, 376, 382, 407 146, 180, 188, 394, 430, 451, 462 27, 193, 213, 297, 353, 411 121, 228, 242
Vandopsis lissochiloides EF670418 471 187, 348, 376, 382, 407, 450 146, 180, 188, 394, 451 27, 193, 213, 297, 353, 411 121, 228, 242
Open in a new tab

R = A or G, S = C or G, Y = C or T; while submitting to GenBank the trnL sequences

Vanda motesiana* was entered as V. stangeana and

V. stangeana# entered as V. tessellate

In silico analysis of restriction site polymorphism

The result of the in silico restriction site analysis is presented in Table 1. Of all the commercially available restriction endonucleases being tried for the in silico restriction mapping using the online software ‘RestrictionMapper’, 35 endonucleases (AflII, AccI, AgsI, ApoI, AsuII, BciVI, BclI, BdaI, BglII, BsaAI, BsaBI, BsmI, CspCI, Eco57I, Eco57MI, EcoRI, EcoRV, HaeIV, MfeI, MboII, MslI, NdeI, PsiI, SmlI, SnaBI, Spe1, SspI, TfiI, TspDTI, TspGWI, TspRI, VspI, XbaI, XhoII and XmnI) were found to have recognition sites in the P8 region. Number of restriction endonucleases digesting the region varied from eight in Aerides krabiensis, A. odorata and A. rosea to 25 in Microcoelia stolzii (Fig 2). Again, from amongst the 35 restriction endonucleases, only three, viz., AgsI, ApoI and TspDTI turned out to have recognition sites across all the 98 taxa being studied; while VspI had in all excepting Angraecum dives. Hence, the above four were selected for subsequent analysis of the restriction site polymorphism.

Fig 2. Graph representing diversity of restriction endonucleases showing recognition sites in the P8 regions of the trnL(UAA) intron of the 98 taxa of orchids (1–98 represent names of 98 orchids in alphabetical order as presented in Table 1).

Fig 2

Open in a new tab

Species discrimination by single restriction endonuclease

The restriction sites recognized by AgsI ranged from one (Aerides krabiensis and A. multiflora) to 14 (Phalaenopsis inscriptiosinensis) (Table 1). From the dendrogram constructed by the UPGMA method which showed similarity coefficient ranging from 0.91 to 1.00 (Fig 3), it was found that AgsI exhibited species specific restriction sites in 80 taxa; however, it could not provide discrimination for 18 taxa which included the taxon pairs Acampe papillosa and Aeranthes arachnites; Angraecum dives and Angraecum leonis; Phalaenopsis lamelligera and P. pantherina, P. lueddemanniana and P. pulchra; Phalaenopsis philippinensis and P. schilleriana; Phalaenopsis maculata and P. mariae; Phalaenopsis amboinensis and P. modesta; Phalaenopsis corningiana and P. sumatrana; Pomatocalpa diffusum and Vanda testacea. Each of these taxon pairs shared the same AgsI restriction sites.

Fig 3. UPGMA dendrogram based on SAHN clustering of data from in silico restriction site polymorphism analysis of the trnL(UAA) intron P8 region using the restriction endonuclease AgsI among the 98 taxa of orchids.

Fig 3

Open in a new tab

The ApoI recognized restriction sites ranged from two (in six taxa) to ten (Phalaenopsis inscriptiosinensis) (Table 1). As evidenced from the UPGMA dendrogram (Fig 4), of the 98 taxa analysed ApoI digestion discriminated 77 species, however; it could not show species specific restriction sites in 21 taxa. The following taxon pairs or groups shared the same restriction sites, Acampe ochraceae, Acampe papillosa and Aeranthes arachnites, Angraecum calceolus and Jumellea maxillarioides, Angraecum conchiferum, Angraecum dives, Angraecum leonis and Bonniera appendiculata, Rhipidoglossum kamerunense and Rhipidoglossum subsimplex, Tridactyle crassifolia and Tridactyle filifolia, Phalaenopsis amboinensis and P. modesta, Phalaenopsis lamelligera and P. pantherina, Phalaenopsis corningiana and P. sumatrana, Phalaenopsis philippinensis and P. schilleriana. This dendrogram showed similarity coefficient ranging from 0.92 to 1.00.

Fig 4. UPGMA dendrogram based on SAHN clustering of data from in silico restriction site polymorphism analysis of the trnL(UAA) intron P8 region using the restriction endonuclease ApoI among the 98 taxa of orchids.

Fig 4

Open in a new tab

TspDTI exhibited species specific restriction patterns for 78 taxa and could not discriminate 20 taxa (Table 1, Fig 5). These twenty included the taxon pairs or groups Acampe papillosa and Aeranthes arachnites; Christensonia vietnamica and Seidenfadenia mitrata; Phalaenopsis celebensis and Phalaenopsis stuartiana; Phalaenopsis philippinensis and P. schilleriana; Phalaenopsis corningiana and P. sumatrana; Vanda testacea, Vandopsis lissochiloides and Vandopsis gigantean; Rhipidoglossum kamerunense and Rhipidoglossum subsimplex; Tridactyle crassifolia and Tridactyle filifolia. The UPGMA dendrogram showed similarity coefficient ranging from 0.92 to 1.00.

Fig 5. UPGMA dendrogram based on SAHN clustering of data from in silico restriction site polymorphism analysis of the trnL(UAA) intron P8 region using the restriction endonuclease TspDTI among the 98 taxa of orchids.

Fig 5

Open in a new tab

VspI also exhibited species specific restriction patterns for 66 taxa and could not discriminate 32 taxa (Table 1, Fig 6). These 32 include the taxon pairs or groups, Acampe ochraceae, Acampe papillosa and Aeranthes arachnites; Aerides multiflora, Phalaenopsis deliciosa and Tridactyle tanneri; Christensonia vietnamica and Seidenfadenia mitrata; Arachnis labrosa and Rhynchostylis gigantean; Vanda testacea, Vandopsis lissochiloides and Vandopsis gigantea; Angraecum conchiferum, Angraecum leonis and Bonniera appendiculat; Listrostachys pertusa, Microcoelia stolzii, Rangaeris amanuensis, Rangaeris rhipsalisocia, Tridactyle crassifolia and Tridactyle filifolia; Rhipidoglossum kamerunense and Rhipidoglossum subsimplex; Phalaenopsis philippinensis and P. schillerian; Phalaenopsis bellina and Phalaenopsis micholitzii; Phalaenopsis cornu-cervi and Phalaenopsis lamelligera; Phalaenopsis corningiana and P. sumatrana. The UPGMA dendrogram showed similarity coefficient ranging from 0.90 to 1.00.

Fig 6. UPGMA dendrogram based on SAHN clustering of data from the in silico restriction site polymorphism analysis of the trnL(UAA) intron P8 region using the restriction endonuclease VspI among the 98 taxa of orchids.

Fig 6

Open in a new tab

Species discrimination using combined data of restriction endonucleases

Analysis of the in silico restriction mapping using the combined data of AgsI and ApoI resulted in discrimination of 86 taxa (Fig 7) as against their individual resolutions of 80 and 77 taxa respectively. Those which had exactly the same restriction sites included six taxon pairs, Acampe papillosa and Aeranthes arachnites; Angraecum dives and Angraecum leonis; Phalaenopsis lamelligera and P. pantherina; Phalaenopsis amboinensis and P. modesta; Phalaenopsis corningiana and P. sumatrana; Phalaenopsis philippinensis and P. schilleriana. The UPGMA dendrogram showed similarity coefficient ranging from 0.91 to 1.00.

Fig 7. UPGMA dendrogram based on SAHN clustering of the combined data from in silico restriction site polymorphism analyses of the trnL(UAA) intron P8 region using the restriction endonuclease AgsI and ApoI among the 98 taxa of orchids.

Fig 7

Open in a new tab

Again, when ApoI, AgsI and TspDTI restriction data were combined, 92 taxa could be discriminated while the three taxon pairs which could not be discriminated from each other included Acampe papillosa and Aeranthes arachnites; Phalaenopsis corningiana and P. sumatrana; Phalaenopsis philippinensis and P. schilleriana (Table 1, Fig 8). The UPGMA dendrogram showed similarity coefficient ranging from 0.92 to 1.00.

Fig 8. UPGMA dendrogram based on SAHN clustering of the combined data from in silico restriction site polymorphism analyses of the trnL(UAA) intron P8 region using the restriction endonuclease AgsI, ApoI and TspDTI among the 98 taxa of orchids.

Fig 8

Open in a new tab

Combination of data of all the four enzymes ApoI, AgsI, TspDTI and VspI also gave the same result as that of the above three enzymes with no discrimination of the following three pairs Acampe papillosa and Aeranthes arachnites; Phalaenopsis corningiana and P. sumatrana; Phalaenopsis philippinensis and P. schilleriana (Table 1, Fig 9). The UPGMA dendrogram showed similarity coefficient ranging from 0.92 to 1.00.

Fig 9. UPGMA dendrogram based on SAHN clustering of the combined data from in silico restriction site polymorphism analyses of the trnL(UAA) intron P8 region using the restriction endonuclease AgsI, ApoI, TspDTI and VspI among the 98 taxa of orchids.

Fig 9

Open in a new tab

Discussion

The P8 stem-loop region is reported to be the most length-variable region of the trnL intron which is due to presence of repeats of various sizes [21]. These repeats together with the enormous length and sequence variation hampered alignment in most of the plant groups being studied for phylogeny or barcoding and therefore, this region is often excluded from analysis of trnL intron sequences [14–16]. Due to this exclusion, the results inferred from analysis of the trnL intron sequences do not represent the exact information it should naturally infer. By virtue of its hypervariability, the P8 region should be having certain information which may be analysed and interpreted for applying in species level identification or barcoding, if not for phylogenetic inference. As there is difficulty in sequence alignment of the P8 regions, the only other method for analysis should be the restriction analysis. In silico restriction site polymorphism was opted over the conventional PCR-Restriction Fragment Length Polymorphism (PCR-RFLP) as there were already a large number of trnL sequences deposited to GenBank. Moreover, the PCR-RFLP may not show the true picture in case two fragments of equal lengths coming from different parts of the sequence cannot be distinguished by observing the gel picture. For plant species identification PCR-RFLP is seldom used, however, a few investigators employed it for identification of mangrove and mangrove associate species [23], fine roots of trees from the Alps [24], Cinnamomum spp. [25], upland grassland species from roots [26] and Vasconcellea species [27], Dendrobium orchids [28].

Sequence length analysis

The tribe Vandeae (Family: Orchidaceae) is very robust consisting of 2600 species of monopodial epiphytes under 139 genera. Some previous investigators had already worked on phylogeny of these orchids using trnL intron sequences [15–17]. As an objective of the present investigation we aimed to discriminate closely related species belonging to a genus or a subtribe or a tribe. While searching the GenBank database, 125 accessions of trnL intron sequence for taxa, under the tribe Vandeae, was available when we started the investigation and they were retrieved for analysis. Upon further investigation 98 out of the 125 sequences had complete P8 hypervariable regions, and thus were considered for the final analysis. Sequence length variation of the P8 regions could discriminate 92 out of the 98 taxa of orchids being investigated. It was observed that the length of the P8 regions of all the taxa being varied from 200 (Aerides rosea) to 669 nucleotides (Dendrophylax sallei). Dendrophylax sallei had 30 more nucleotides longer than Luisia curtisii (Orchidaceae) which was reported earlier to be the longest recorded angiosperm P8 (639 nucleotides) [16]. As evidenced from our finding, those taxa sharing a common length did not necessarily belong to the same genus and that there could be great differences in P8 lengths within the same genus, which is in conformity with that of Kocyan et al. [16]. This difference in P8 lengths might be due to slipped-strand mispairing (SSM) resulting into high repetition of A motifs [21, 29].

Restriction site polymorphism analysis

Our study represents the first ever in silico restriction analysis of the P8 region of trnL in an attempt to utilize the genetic information present in it for a meaningful interpretation in species identification of a certain group of angiospermic plants. From all the UPGMA dendrograms generated in this investigation it is evidenced that species belonging to one genus are clustered with those belonging to other genus or genera, or in the other sense they are haphazardly clustered owing to the hypervariable nature of the P8 regions. This showed that the present approach might not be applicable for phylogenetic inference of the taxa being investigated. However, since 95.9% of these taxa could be discriminated based on restriction site polymorphisms and sequence length data, this technique might be adopted for rapid species identification and hence as a plant DNA barcode.

So far there has not been much report on utilization of PCR-RFLP for identification of orchid species except for certain Thai Dendrobium orchids using rDNA-ITS and cpDNA regions [28]. Some investigators already showed the efficacy of double digestion or using two or more restriction endonucleases over single in generation of more polymorphic fragments in PCR-RFLP experiments. PCR-RFLP of the chloroplast trnS-psbC gene regions using a combination of two enzymes, HaeIII and MspI could successfully identify all the 119 accessions of millet into 7 species [30]. 579 grasses roots were distinguished to ten species using PCR-RFLP of trnL intron, with one or two enzyme digest [26]. Again, 16 taxa out of 30 tree species from the Alps were identified using PCR-RFLP with four restriction endonucleases TaqI, HinfI, RsaI and CfoI [24]. However, in our investigation, it was observed that as many as 35 restriction endonucleases had their recognition sites in the region. Combined data from analyses of the P8 regions with three restriction endonucleases ApoI, AgsI and TspDTI, could discriminate 92 of the 98 taxa based on species specific restriction sites. Hence, the advantage of screening a large number of restriction endonucleases is required for higher success rate in species discrimination of the plant specimens being investigated.

Aerides rosea, having the shortest P8 length of 200 nuclotides, showed to have recognition sites of at least eight enzymes, while Dendrophylax sallei despite having the longest P8 length (669 nucleotides) had recognition sites for only 20 enzymes. Microcoelia stolzii with a P8 length of 480 nucleotides had the maximum number (25) of restriction endonucleases cutting the region. Again, considering the number of recognition sites per restriction endonuclease for an individual taxon, Phalaenopsis inscriptiosinensis, with a P8 length of 498 nucleotides, had as many as 14 AgsI, 10 ApoI, 10 TspDTI and 8 VspI recognition sites. Hence, our result showed that the longest P8 length neither had the maximum number of restriction endonuclease recognizing it nor maximum number of recognition sites for an individual enzyme.

It was observed that there were 20 restriction endonucleases having recognition sites in the P8 regions of both Acampe papillosa and Aeranthes arachnites. These two taxa also exhibited the same number of restriction sites for all the twenty enzymes. The UPGMA trees drawn for each of the four enzymes as well as those for their combined data revealed them to have 100% genetic similarity. Hence, the only information to differentiate them as different species would be their P8 sequence lengths, 420 nucleotides for Acampe papilosa and 521 nucleotides for Aeranthes arachnites.

Phalaenopsis corningiana and P. sumatrana are treated as two separate species [31–33]. Our investigation revealed that both of them had the same P8 length (508 nucleotides) and identical sequence and hence could not be distinguished from each other as they had similar restriction sites for all the 19 restriction enzymes. Tsai [34] also could not separate the two taxa based on information derived from nrITS, IGS and atpB-rbcL sequences. The only morphological differences between them are in callus and marking patterns on the petals. Distribution of P. sumatrana is widespread ranging from Myanmar, Thailand, Vietnam, Indonesia, Malaysia and the Philippines; whereas P. corningiana is restricted to Borneo and Sarawak. Phalaenopsis philippinensis and P. schilleriana are also endemic to Philippines and they have distinct distinguishing morphological characters. From our analysis, it is observed that both possessed identical P8 sequences and hence identical restriction endonucleases and their restriction sites. Whether these two taxon pairs should be treated as natural hybrids or ecotypes may need evidences from other coding, non-coding sequences or protein markers.

It was suggested that for a gene region to be practical as a DNA barcode the following three criteria must be fulfilled: (i) contain significant species-level genetic variability and divergence, (ii) possess conserved flanking sites for developing universal PCR primers for wide taxonomic application, and (iii) have a short sequence length so as to facilitate current capabilities of DNA extraction and amplification [3]. From our result, it is learnt that P8 regions of the 98 taxa contained good amount of genetic variation either in sequence length or restriction sites of the enzymes being used. Those taxa which could not be discriminated might require understanding of their maternal origin, in case of natural hybridization; plastid DNA barcodes will fail in case of natural hybrids. Second, the primer pair (c and d) used to amplify trnL intron is well conserved from brayophytes to angiosperms [35]. The present study also employed this primer pair for both PCR amplification as well as sequencing. Using these primers, the whole trnL region could be amplified and sequenced and from it an intact P8 region be retrieved easily, which is an advantage. Third, sequence lengths of the P8 regions observed in the present investigation ranged from 200 to 669 nucleotides which were short enough to be considered as DNA barcodes. The only disadvantage of the P8 region lie in their inability to be aligned due to hypervariability, and hence cannot be used for further processing using standardized phylogenetic or barcoding techniques.

Conclusions

A technique for molecular identification using sequence length variation and in silico restriction site polymorphism analysis of the trnL intron P8 sequence was developed and utilized to discriminate 94 out of 98 taxa of orchids to the level of species. Investigations using this technique for species level discrimination across all the angiospermic families may be tried. The four restriction endonucleases ApoI, AgsI, TspDTI and VspI could be utilized for further analysis of the trnL intron P8 sequences of other uninvestigated orchid taxa either in silico or in PCR-RFLP. A plant DNA barcoding system using restriction site polymorphism of the trnL P8 region has not been suggested yet; and with this report there is high possibility of using this tool to establish a barcoding system.

Acknowledgments

This work was supported by the Council of Scientific and Industrial Research (CSIR), Government of India by granting Senior Research Associateship to Rajkumar Kishor (Grant No. SRA-8627A).

Data Availability

All relevant data are within the paper.

Funding Statement

This work was supported by the Council of Scientific and Industrial Research (CSIR), Government of India by granting Senior Research Associateship to Rajkumar Kishor (grant no. SRA-8627A).

References

  • 1.Hebert PDN, Ratnasingham S, De Waard JR. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related animals. Proc Roy Soc London, Ser B, Biol Sci. 2003; 270: S96–S99. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Chase MW, Cowan RS, Hollingsworth PM, van den Berg C, Madrinan S, Petersen G, et al. A proposal for a standardized protocol to barcode all land plants. Taxon 2007; 56: 295–299. [Google Scholar]
  • 3.Kress W J, Erickson D L. DNA barcodes: Genes, genomics, and bioinformatics. Proc Natl Acad Sci U S A. 2008; 105: 2761–2762. doi: 10.1073/pnas.0800476105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Hollingworth PM, Grahm SW, Little DP. Choosing and using a plant DNA Barcode. PLos One. 2011; 6(5)e19254:1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Taberlet P, Gielly L, Pautou G, Bouvet J. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol Biol. 1911; 17: 1105–l109. [DOI] [PubMed] [Google Scholar]
  • 6.Gielly L, Taberlet P. A phylogeny of European gentians inferred from chloroplast trnL(UAA) intron sequences. Bot J Linnean Soc.1996; 120: 57–75. [Google Scholar]
  • 7.Davies RW, Waring RB, Ray JA, Brown TA, Scazzocchio C. Making ends meet—a model for RNA splicing in fungal mitochondria. Nature.1982; 300: 719–724. [DOI] [PubMed] [Google Scholar]
  • 8.Michel F, Jacquier A, Dujon B. Comparison of fungal mitochondrial introns reveals extensive homologies in RNA secondary structure. Biochimie. 1982; 64: 867–88. [DOI] [PubMed] [Google Scholar]
  • 9.Quandt D, Muller K, Stech M, Frahm JP, Frey W, Hilu KW, et al. Molecular evolution of the chloroplast trnL-F region in land plants. Monogr Syst Bot Missouri Botanic Garden. 2004; 98:13–37. [Google Scholar]
  • 10.Gielly L, Taberlet P. The use of chloroplast DNA to resolve phylogenies: noncoding versus rbcL sequences. Mol Biol Evol. 1994; 11: 769–777. doi: 10.1093/oxfordjournals.molbev.a040157 [DOI] [PubMed] [Google Scholar]
  • 11.Kushel M G, Strickland R, Palmer JD. An ancient group I intron shared by Eubacteria and chloroplasts. Science. 1990; 250: 1570–l 573. [DOI] [PubMed] [Google Scholar]
  • 12.Cech TR, Damberg SH, Gutell RR. Representation of the secondary and tertiary structure of group I introns. Nat Struct Biol. 1994; 1: 273–280. [DOI] [PubMed] [Google Scholar]
  • 13.Borsch T, Hilu KW, Quandt D, Wilde V, Neinhuis C, Barthlott W. Noncoding plastid trnT–trnF sequences reveal a well resolved phylogeny of basal angiosperms. J Evol Biol. 2003; 16: 558–576. [DOI] [PubMed] [Google Scholar]
  • 14.Borsch T, Hilu KW, Wiersema JH, Lohne C, Barthlott W, Wilde V. Phylogeny of Nymphaea (Nymphaeaceae): Evidence from substitutions and microstructural changes in the chloroplast trnT-trnF region. Int J Plant Sci. 2007; 168: 639–671. [Google Scholar]
  • 15.Carlsward BS, Whitten WR, Williams NH, Bytebier B. Molecular phylogenetics of Vandeae (Orchidaceae) and the evolution of leaflessness. Am J Bot. 2006; 93:770–786. doi: 10.3732/ajb.93.5.770 [DOI] [PubMed] [Google Scholar]
  • 16.Kocyan A, de Vogel EF, Conti E, Gravendeel B. Molecular phylogeny of Aerides (Orchidaceae) based on one nuclear and two plastid markers: A step forward in understanding the evolution of the Aeridinae. Mol Phylogenet Evol.2008; 48: 422–44. doi: 10.1016/j.ympev.2008.02.017 [DOI] [PubMed] [Google Scholar]
  • 17.Tsai CC, Chiang YC, Huang SC, Chen CH, Chou CH. Molecular phylogeny of Phalaenopsis Blume (Orchidaceae) on the basis of plastid and nuclear DNA. Plant Syst Evol. 2010; 288: 77–98. [Google Scholar]
  • 18.Dressler RL. Phylogeny and classification of the orchid family Dioscorides Press, Portland, OR: 1993. [Google Scholar]
  • 19.Schuiteman A. Dendrobieae and Aeridinae In: Pridgeon AM, Cribb PJ, Chase MW, Rasmussen FN, editors. Genera Orchidacearum: Volume 6: Epidendroideae, Part 3, Oxford University Press; 2014. [Google Scholar]
  • 20.Kishor R, Sunitibala DH. Induction of multiple shoots in a monopodial orchid hybrid (Aerides vandarum Reichb.f x Vanda stangeana Reichb.f) using thidiazuron and analysis of their genetic stability. Plant Cell Tiss Organ Cult. 2009; 97: 121–129. [Google Scholar]
  • 21.Quandt D, Stech M. Molecular evolution of the trnL(UAA) intron in bryophytes. Mol Phylogenet Evol 2005; 36: 429–443. doi: 10.1016/j.ympev.2005.03.014 [DOI] [PubMed] [Google Scholar]
  • 22.Rolf FJ. NTSYS-PC Numerical Taxonomy and Multivariate Analysis System, Exter Software, Setauket, NY. 1993
  • 23.Parani M, Lakshmi M, Ziegenhagen B, Fladung M, Senthilkumar P, Parida A. Molecular phylogeny of mangroves VII. PCR-RFLP of trnS-psbC and rbcL gene regions in 24 mangrove and mangrove-associate species. Theor Appl Genet. 2000; 100:454–460. [Google Scholar]
  • 24.Brunner I, Brodbeck S, Buchler U, Sperisen C. Molecular identification of fine roots of trees from the Alps: reliable and fast DNA extraction and PCR-RFLP analyses of plastid DNA. Mol Ecol. 2001; 10:2079–2087. [DOI] [PubMed] [Google Scholar]
  • 25.Kojoma M, Kurihara K, Yamada K, Sekita S, Satake M, Iida O. Genetic identification of cinnamon (Cinnamomum spp.) based on the trnL-trnF chloroplast DNA. Planta Medica. 2002; 68: 94–96. doi: 10.1055/s-2002-20051 [DOI] [PubMed] [Google Scholar]
  • 26.Ridgway KP, Duck JM, Young JPW. Identification of roots from grass swards using PCR-RFLP and FFLP of the plastid trnL (UAA) intron. BMC Ecology. 2003; 3: 8 doi: 10.1186/1472-6785-3-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Van Droogenbroeck B, Kyndt T, Maertens I, Romeijn-Peeters E, Scheldeman X, Romero-Motochi JP, et al. Phylogenetic analysis of the highland papayas (Vasconcellea) and allied genera (Caricaceae) using PCR-RFLP. Theor Appl Genet. 2004; 108:1473–1486. doi: 10.1007/s00122-003-1575-7 [DOI] [PubMed] [Google Scholar]
  • 28.Peyachoknagula S, Mongkolsiriwatanab C, Wannapinpongd S, Huehnea PS, Srikulnatha K. Identification of native Dendrobium species in Thailand by PCR-RFLP of rDNA-ITS and chloroplast DNA. ScienceAsia. 2014; 40:113–120 [Google Scholar]
  • 29.Levinson G, Gutman GA. Slipped-strand mispairing: a major mechanism for DNA sequence evolution. Mol Biol Evol. 1987; 4: 203–21. doi: 10.1093/oxfordjournals.molbev.a040442 [DOI] [PubMed] [Google Scholar]
  • 30.Parani M, Rajesh K, Lakshmi M, Parducci L, Szmidt AE, Parida A. Species identification in seven small millet species using polymerase chain reaction–restriction fragment length polymorphism of trnS-psbC gene region. Genome 2001; 44: 495–499 [DOI] [PubMed] [Google Scholar]
  • 31.Sweet HR. Revision of the genus Phalaenopsis, Part 2. Am Orchid Soc Bull. 1968; 37: 1089–1104. [Google Scholar]
  • 32.Fowlie JA. A note on Phalaenopsis sumatrana and Phalaenopsis corningiana. Orchid Digest. 1969; 33: 301. [Google Scholar]
  • 33.Christenson E A. Phalaenopsis Timber Press, Portland Oregon, 2001; pp 330. [Google Scholar]
  • 34.Tsai CC. Molecular Phylogeny and Biogeography of Phalaenopsis Species In: Chen W-H, Chen HH editors. Orchid Biotechnology II. World Scientific, 2011. [Google Scholar]
  • 35.Taberlet P, Coissac E, Pompanon F, Gielly L, Miquel C, Valentini A, et al. Power and limitations of the chloroplast trnL(UAA) intron for plant DNA barcoding. Nucleic Acid Res.2007; 35: e14 doi: 10.1093/nar/gkl938 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All relevant data are within the paper.

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES