The role of ethylene in the regulation of ovary senescence and fruit set in tomato (Solanum lycopersicum)

ABSTRACT

Fruit set is the developmental transition from ovary to young fruit, and generally requires pollination and fertilization. Although the mechanism for fruit set remains elusive, several lines of evidence have demonstrated that fruit set is triggered by activated metabolism of or increased sensitivity to the plant hormones auxin or gibberellins (GAs), which stimulate cell division and expansion within the ovary. Our recent study with tomato (Solanum lycopersicum) suggested that the gaseous hormone ethylene connects auxin and GA, suppressing initiation of fruit set by down-regulating GA accumulation. By contrast, reduced sensitivity to ethylene triggers accumulation of GA, but not auxin, through increasing bioactive GA biosynthesis and decreasing GA inactivation. These changes induce parthenocarpy accompanied by pollination-independent cell expansion in the ovary. Here, we provide evidence that ethylene likely promotes mRNA expression of the senescence-associated genes SlSAG12 and SlNAP in unpollinated ovaries. These results suggest that ethylene acts downstream of auxin and upstream of GA, and also suggest that ethylene promotes senescence of ovary that fail to set fruit in tomato.

In angiosperms, the fruit protects developing seeds and attracts vectors for seed dispersal. Fruits differentiate from the ovary, termed fruit set, is critically important for agriculture since it is a main factor that determines yield of fruit-bearing crops.¹ In tomato (Solanum lycopersicum), pollination and subsequent fertilization induce the rapid accumulation of several hormones, including auxin and GA, which play key roles in inducing fruit set.^2,3 In plants bearing fleshy fruit, the ovary typically does not develop into fruit without pollination. However, ectopic application of auxins or GAs,⁴ or increases in their biosynthesis^5,6 or sensitivity^7,8 can induce pollination-independent fruit set, termed parthenocarpy. In zucchini (Cucurbita pepo), reduced sensitivity to the gaseous hormone ethylene can induce parthenocarpy, either by inhibition of ethylene biosynthesis or response.⁹ We recently found that tomato plants treated with the ethylene action inhibitor 1–methylcyclopropene (1-MCP) or carrying either of two allelic mutations in the ethylene receptor S. lycopersicum ethylene receptor 1 (Sletr1-1 and Sletr1-2) that impose ethylene insensitivity, can also result in parthenocarpy.¹⁰ However, compared with fruits induced by pollination, these parthenocarpic fruits were smaller and elongated; a phenotype similar to GA-induced parthenocarpic fruits⁷ (Fig. 1). Ethylene and GA appear to act in a hierarchical cascade in the regulation of fruit set; reduced sensitivity to ethylene activates GA metabolism through increasing mRNA expression of the GA-biosynthesis gene GA20-oxidase3 (GA20ox3) and decreasing mRNA expression of GA-catabolic genes GA2ox4 and GA2ox5.¹⁰ Additionally, bioactive GA₁ contents increased in the unpollinated Sletr1-1 ovaries during fruit set, but indole acetic acid (IAA) contents were comparable to unpollinated wild-type (WT) ovaries.¹⁰ These results support the notion that ethylene acts downstream of auxin and upstream of GA. However, there is also evidence that GA treatment can suppress ethylene biosynthesis and signaling during fruit set,¹¹ suggesting the existence of a non-linear signaling cascade in the fruit set mechanism.

Figure 1.

Parthenocarpic fruits of tomato Sletr1 mutants. Representative fruits of WT, Sletr1-1, and Sletr1-2 at 50 days after anthesis (DAA). Pollination was performed at anthesis. Bar = 1 cm.

Ovaries that fail to set fruits are fated to senesce, although the molecular mechanism for ovary senescence remains largely unclear compared to that of the other organs such as leaves and petals. Ethylene can promote senescence of various plant organs including unpollinated ovaries.^12,13 Ethylene production in tomato pistils transiently increases within several hours after pollination, whereas ethylene production begins to decrease within a day after pollination.¹⁴ In fact, mRNA expression of system–1 ethylene biosynthesis and ethylene signaling genes decrease, along with decreases in levels of ethylene production by the pistils, in early developing fruits.^8,10,11 By contrast, ethylene production by the unpollinated WT pistils fated to senesce remains higher than pollinated WT pistils most likely due to higher mRNA accumulation of the ethylene biosynthesis genes.¹⁰ These suggest that ethylene metabolism plays a role in tomato ovary senescence.

To characterize senescence of unpollinated ovaries and developing fruits in tomato at molecular level, we used quantitative reverse transcription (qRT)-PCR (primers shown in Table 1) and examined mRNA expression of tomato SlSAG12 and SlNAP, orthologues of the Arabidopsis senescence-associated genes SAG12 and AtNAP. The Arabidopsis SAG12 encodes a papain-like Cys protease specifically expressed in senescing tissues and is thus believed to be a feasible marker of plant organ senescence.^13,15 The AtNAP encodes a NAC transcription factor, whose expression increases with early senescence of leaves^16,17 and fruits,¹⁸ and is required for normal senescence of these organ.¹⁷ The mRNA levels of tomato orthologues of these two genes, SlSAG12 and SlNAP, drastically increased at 2 and 4 days after anthesis (DAA) in the unpollinated WT ovaries but not in the other fruit-growing samples, including pollinated WT and unpollinated Sletr1-1 ovaries (Fig. 2A). We further examined whether expression of these two genes was regulated by ethylene in ovaries of emasculated flowers treated with 1-MCP. Indeed, the mRNA levels of SlSAG12 and SlNAP were down-regulated by 1-MCP treatment (Fig. 2B). We have previously shown that ethylene levels did not change and persisted between 2 and 4 DAA in WT unpollinated ovaries (Shinozaki et al., 2015), unlike mRNA fluctuation of senescence-associated genes shown in this study (Fig. 2A). This may suggest that increased mRNA expression of SlSAG12 and SlNAP in unpollinated ovaries was not due to a higher ethylene levels, but rather result from promoted ovary senescence.

Table 1.

List of primers used for qRT-PCR

Target gene	Locus	Primer name	Sequence (5′ – 3′)	Amplicon length (bp)	Reference
SAND	Solyc03g115810	SAND-F	TTGCTTGGAGGAACAG ACG	164	Expósito-Rodríguez et al., 2008
		SAND-R	GCAAACAGAACCCCTG AATC
SlSAG12	Solyc02g076910	SlSAG12-F1	CTGTTACCCCTATCAAGGACCAAAT	148	This study
		SlSAG12-R1	TCGCCTTCGACATCACAATC
SlNAP	Solyc04g005610	SlNAP-F1	GAGGTTGGATGATTGGGTACTTT	101	This study
		SlNAP-R1	TTTGAGGTTCTTGTGTGTCTTCTTC

Figure 2.

The mRNA levels of genes associated with senescence in (A) Sletr1-1 ovaries and (B) 1-MCP-treated WT ovaries at 8 DAA. qRT-PCR analysis and 1-MCP treatment were performed as previously described.¹⁰ SAND was used as an internal control gene. Expression levels were normalized to 0 DAA of WT (A) or control (B). Values are means ± SEs of three biological replicates. Asterisks indicate significant differences from the unpollinated WT or control (**P < 0.01, *P < 0.05; Student's t-test). Pollination was performed at anthesis. DAA, days after anthesis; Poll., Pollinated; Unpoll., unpollinated.

Ethylene promotes ovule senescence in unpollinated pea (Pisum sativum) and Arabidopsis ovaries, which limits capacity to induce their fruit set in response to GA treatment,^12,13 suggesting that viable ovules are required for GA-dependent fruit set. Taken together with the fact that ethylene can suppress GA biosynthesis and signaling,^21-23 inhibition of ethylene signaling can affect the ovule senescence as well as GA activity, which may result in GA-dependent fruit set in tomato. Ethylene may suppress fruit set through promoting ovule senescence and suppressing GA activity in unpollinated ovaries (Fig. 3). Further studies are needed to understand whether the suppression of GA activity in unpollinated tomato ovaries is directly regulated by ethylene signaling or mediated by senescence of ovarian tissues.

Figure 3.

A model for the role of ethylene in tomato fruit set. (A) Ethylene may promote ovule senescence in the unpollinated ovaries. High levels of ethylene and/or promoted ovule senescence can inhibit activation of GA. (B) Pollination induces activation of auxin and GA, which can inactivate ethylene biosynthesis and subsequent ovule senescence. Releasing the suppression by ethylene and/or ovule senescence could also activate GA metabolism and signaling, resulting in fruit set.

Funding Statement

This work was supported by Program to Disseminate Tenure Tracking System, and JSPS bilateral program to TA and by Science and Technology Research Promotion Program for Agriculture, Forestry, Fisheries and Food Industry, Japan (grant no. 26013A). Seeds of Micro-Tom WT (TOMJPF00001), Sletr1-1 (TOMJPE5803), and Sletr1-2 (TOMJPE5704) were obtained from the National BioResource Project, Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan

Disclosure of potential conflicts of interest

No potential conflicts of interest were disclosed.