Abstract
Background
Nosocomial outbreak due to carbapenem-resistant Enterobacteriaceae has become serious challenge to patient treatment and infection control. We describe an outbreak due to a multidrug-resistant Providencia rettgeri from January 2016 to January 2017 at a University Hospital in Seoul, Korea.
Methods
A total of eight non-duplicate P. rettgeri isolates were discovered from urine samples from eight patients having a urinary catheter and admitted in a surgical intensive care unit. The β-lactamase genes were identified using polymerase chain reaction and direct sequencing, and strain typing was done with pulsed-field gel electrophoresis (PFGE).
Results
All isolates showed high-level resistance to extended-spectrum cephalosporins, aztreonam, meropenem, ertapenem, ciprofloxacin, and amikacin. They harbored the blaNDM-1 carbapenemase and the blaPER-1 type extended-spectrum β-lactamases genes. PFGE revealed that all isolates from eight patients were closely related strains.
Conclusions
The 13-month outbreak ended following reinforcement of infection control measures, including contact isolation precautions and environmental disinfection. This is the first report of an outbreak of a P. rettgeri clinical isolates co-producing NDM-1 and PER-1 β-lactamase.
Keywords: Providencia rettgeri, Outbreak, Urinary tract infection, NDM-1, PER-1
Background
The genus Providencia comprises part of the natural human gut flora but may also cause infections, including travelers’ diarrhea, urinary tract infections, and other nosocomial infections [1]. Treatment of these infections is challenging because Providencia rettgeri strains are intrinsically resistant to many antimicrobials including ampicillin, first generation cephalosporins, polymyxins and tigecycline [2]. Furthermore, in recent years P. rettgeri has become increasingly important because of the emergence of carbapenemase-producing strains [3, 4]. Carbapenemases are enzymes known to hydrolase almost all types of β-lactams [5]. The New Delhi metallo-β-lactamase (NDM-1) has been firstly identified in 2009 in a Swedish patient who had been previously hospitalized in New Delhi, India [6]. The first occurrence of NDM-1 producers was reported in clinical isolates of P. rettgeri in Israel in 2013 [7]. Since then, other cases have been reported in Mexico, Brazil, Argentina, Ecuador, Canada, and Nepal [3, 4, 8–13].
PER-1 enzyme is belong to class A extended-spectrum β-lactamases (ESBLs) and firstly discovered in a plasmid of Pseudomonas aeruginosa in France [14]. Later, it has also found among several Gram-negative species including Acinetobacter baumannii, Salmonella enterica serovar Typhimurium, and also in P. rettgeri [15, 16]. PER-1 is widely spread in Turkey, however, high prevalence of PER-1 ESBL in A. baumannii has been reported in Korea [17].
Here, we report the first outbreak of multidrug-resistant P. rettgeri strain co-producing NDM-1 and PER-1 in Korea.
Materials and methods
Patients and bacterial isolates
From January 2016 to January 2017, a total of eight P. rettgeri isolates from eight patients were included in this study. Bacterial identification was done with a Vitek-MS (bioMérieux, Marcy I’Etoile, France). Medical records of the patients were retrospectively reviewed. This study protocol was approved by the hospital institutional review board.
Antimicrobial susceptibility testing
Minimum inhibitory concentrations (MICs) for cefotetan, cefotaxime, ceftazidime, cefepime, ertapenem, imipenem, meropenem, aztreonam, amikacin, ciprofloxacin, gentamicin, and tigecycline were determined using Etest strips (bioMérieux) on the Mueller–Hinton agar (Becton–Dickinson, Sparks, MD, USA). Colistin MIC was determined by broth microdilution. When available, antimicrobial susceptibility was interpreted based on the Clinical and Laboratory Standards Institute (CLSI) guideline [18]. For tigecycline and colistin, the European Committee for Antimicrobial Susceptibility Testing (EUCAST) criteria were used [19].
Detection of β-lactamase genes
The carbapenemase genes and ESBL genes were detected using specific PCR primers (Table 1) [20–27]. Amplified products were directly sequenced on the ABI 3730xl automatic sequencer (Applied Biosystems, Foster City, CA, USA) using the same primer pair. The sequences obtained were compared to those in GenBank (www.ncbi.nlm.nih.gov/GenBank) using the BLAST program (www.ncbi.nlm.nih.gov/BLAST/).
Table 1.
Primers used in this study for identifying antimicrobial resistance genes
| Classification | Primer | Target | Nucleotide sequence, 5′ to 3′ | Product size, bp | References |
|---|---|---|---|---|---|
| Class A β lactamases | VEB-1F | bla VEB | CGACTTCCATTTCCCGATGC | 642 | [20] |
| VEB-1R | GGACTCTGCAACAAATACGC | ||||
| PER-1F | bla PER-1 | ATGAATGTCATTATAAAAGCT | 927 | [20] | |
| PER-1R | TTAATTTGGGCTTAGGG | ||||
| CTX-M-1F | bla CTX-M-1 | GCAGCACCAGTAAAGTGATGG | 591 | [21] | |
| CTX-M-1R | GCTGGGTGAAGTAAGTGACC | ||||
| CTX-M-825F | bla CTX-M-8 | CGCTTTGCCATGTGCAGCACC | 307 | [22] | |
| CTX-M-825R | GCTCAGTACGATCGAGCC | ||||
| CTX-M-914F | bla CTX-M-9 | GCTGGAGAAAAGCAGCGGAG | 474 | [22] | |
| CTX-M-914R | GTAAGCTGACGCAACGTCTG | ||||
| SHV-OS5 | bla SHV | TTATCTCCCTGTTAGCCA | 797 | [23] | |
| SHV-OS6 | GATTTGCTGAATTCGCTC | ||||
| TEM-A | bla TEM | TAAAATTCTTGAAGACG | 1074 | [23] | |
| TEM-B | TTACCAATGCTTAATCA | ||||
| KPC-F | bla KPC | ATGTCACTGTATCGCCGTCT | 893 | [24] | |
| KPC-R | TTTTCAGAGCCTTACTGCCC | ||||
| Class B β lactamases | VIM-F | bla VIM | GATGGTGTTTGGTCGCATA | 390 | [25] |
| VIM-R | CGAATGCGCAGCACCAG | ||||
| IMP-F | bla IMP | GGAATAGAGTGGCTTAATTC | 232 | [26] | |
| IMP-R | TCGGTTTAATAAAACAACCACC | ||||
| NDM-1-F | bla NDM-1 | CAATATTATGCACCCGGTCG | 726 | [27] | |
| NDM-1-R | ATCATGCTGGCCTTGGGGAA | ||||
| Class D β lactamases | OXA-10F | bla OXA-10 | TATCGCGTGTCTTTCGAGTA | 760 | [20] |
| OXA-10R | TTAGCCACCAATGATGCCC | ||||
| OXA-F | bla OXA-48 | GCGTGGTTAAGGATGAACAC | 438 | [26] | |
| OXA-R | CATCAAGTTCAACCCAACCG |
Pulsed-field gel electrophoresis
The bacterial genetic relatedness was evaluated by Pulsed-field gel electrophoresis (PFGE). Genomic DNA was digested with SfiI enzyme, and DNA fragments were separated on a CHEF-DRII System (Bio-Rad, Hercules, CA, USA). A lambda ladder (Bio-Rad) was used as a DNA size marker. The band patterns were analyzed using UVIband/Map software (UVItech Ltd., Cambridge, UK) and the dendrograms were generated based on the unweighted pair group method using arithmetic averages from the Dice coefficient. Isolates that exhibited a PFGE profile with more than 90% similarity (pulsotype) were considered as closely related strains.
Results
The characteristics of these patients and antimicrobial susceptibility patterns of P. rettgeri isolates were summarized in Table 2. In total, eight P. rettgeri isolates were recovered from urine samples of eight patients admitted in a surgical intensive care unit (SICU). All patients were admitted to a SICU from hospitalization and had a urinary catheter. The median days of the SICU stay before P. rettgeri isolation was 21.5 days (range, 8–38 days) (Fig. 1). All patients except one (P5) were recovered and discharged during the outbreak. A patient (P5) died following Enterococcus faecalis bacteremia. All P. rettgeri isolates showed similar antibiogram with high MIC levels to various classes of antimicrobial agents tested (cefotetan, cefotaxime, ceftazidime, cefepime, azteronam, meropenem, ertapenem, ciprofloxacin, amikacin, and tigecycline). Imipenem MICs were 0.5–4 μg/mL (6/8 susceptible isolates, 1/8 intermediate isolate, and 1/8 resistant isolate) and gentamicin MICs were 8–16 μg/mL (4/8 intermediate isolates and 4/8 resistant isolates). Molecular testing revealed that all the P. rettgeri isolates were positive for blaNDM-1 and blaPER-1. No amplicons were observed for the other primer pairs for blaVEB, blaCTX-M-1, blaCTX-M-8, blaCTX-M-9, blaSHV, blaTEM, blaKPC, blaVIM, blaIMP, blaOXA-10, and blaOXA-48. PFGE revealed that all isolates closely related one pulsotype with > 90% similarity (Fig. 2). The eight isolates had the three kinds of dendrogram patterns.
Table 2.
Clinical characteristics of the outbreak cases and antimicrobial susceptibility profiles of Providencia rettgeri isolates
| Patient ID | P1 | P2 | P3 | P4 | P5 | P6 | P7 | P8 |
|---|---|---|---|---|---|---|---|---|
| Isolate no. | KN756 | KN762 | KN764 | KN774 | KN779 | KN784 | KN803 | KN804 |
| Sex/age (year) | M/63 | M/50 | M/52 | M/66 | F/75 | M/81 | F/40 | M/53 |
| Diagnosis | Brain hemorrhage | Deep neck infection | Central nervous system infection | Bladder cancer | Pneumonia | Pneumonia | Brain hemorrhage | Brain hemorrhage |
| Comorbidities | – | Diabetes mellitus | – | – | Cerebral infarction | Diabetes mellitus | – | – |
| Outcome | Survival | Survival | Survival | Survival | Death | Survival | Survival | Survival |
| Hospital admission date | 18-Dec-15 | 05-Apr-16 | 28-Apr-16 | 01-Jul-16 | 28-Jul-16 | 14-Aug-16 | 16-Dec-16 | 19-Dec-16 |
| P. rettgeri collection date | 11-Jan-16 | 09-May-16 | 19-May-16 | 08-Aug-16 | 19-Aug-16 | 22-Aug-16 | 30-Dec-16 | 05-Jan-17 |
| Antimicrobial agents used before P. rettgeri isolation (days) | Colistin (13), piperacillin-tazobactam (8), teicoplanin (11) | Colistin (21), metronidazole (10), piperacillin-tazobactam (10), ampicillin-sulbactam (3), teicoplanin (20), netilmicin (5), levofloxacin (9) | Colistin (13), piperacillin-tazobactam (3), vancomycin (8), teicoplanin (13), meropenem (7) | Ceftriaxone (6), tigecycline (4), doripenem (7), piperacillin-tazobactam (18), flomoxef (3), teicoplanin (5) | Metronidazole (10), moxifloxacin (6), piperacillin-tazobactam (2), teicoplanin (2) | Piperacillin-tazobactam (5), ampicillin-sulbactam (3) | Ceftriaxone (3) | Ceftriaxone (8) |
| MIC (μg/mL) | ||||||||
| Cefotetan | > 256 | > 256 | > 256 | > 256 | > 256 | > 256 | > 256 | > 256 |
| Cefotaxime | > 32 | > 32 | > 32 | > 32 | > 32 | > 32 | > 32 | > 32 |
| Ceftazidime | > 256 | > 256 | > 256 | > 256 | > 256 | > 256 | > 256 | > 256 |
| Cefepime | > 256 | > 256 | > 256 | > 256 | > 256 | > 256 | > 256 | > 256 |
| Aztreonam | > 256 | > 256 | > 256 | > 256 | > 256 | > 256 | > 256 | > 256 |
| Imipenem | 0.5 | 0.5 | 2 | 4 | 0.5 | 1 | 0.5 | 0.5 |
| Meropenem | > 32 | > 32 | > 32 | > 32 | > 32 | > 32 | > 32 | > 32 |
| Ertapenem | > 32 | > 32 | > 32 | > 32 | > 32 | > 32 | > 32 | > 32 |
| Ciprofloxacin | > 32 | > 32 | > 32 | > 32 | > 32 | > 32 | > 32 | > 32 |
| Amikacin | > 256 | > 256 | > 256 | > 256 | > 256 | > 256 | > 256 | > 256 |
| Gentamicin | 8 | 16 | 16 | 16 | 8 | 16 | 8 | 8 |
| Tigecycline | 4 | 4 | 4 | 8 | 4 | 8 | 8 | 8 |
| Colistin | 2 | 2 | 8 | 2 | 2 | 64 | 4 | 4 |
MIC minimum inhibitory concentration
Fig. 1.

Time course of the outbreak by multidrug-resistant Providencia rettgeri. Black bars indicate the pre-infection period and gray bars the post-infection period in the surgical intensive care unit. Solid lines indicate the period during patients was hospitalized in a general ward
Fig. 2.

Pulsed-field gel electrophoresis patterns of Providencia rettgeri clinical isolate co-producing NDM-1 and PER-1. All eight isolates from the outbreak were closely related strains
Discussion
In the present study we reported and characterized an outbreak of blaNDM-1 and blaPER-1 carrying P. rettgeri. All patients were admitted to the same SICU and had a urinary catheter. P. rettgeri is well known to be isolated from urine of hospitalized and catheterized patients [16]. Although periods of hospitalization of our patients were not completely overlapping, PFGE revealed that all isolates were closely related. This suggests clonal cross-transmission of this strain in the SICU, and there is a possibility of transmission between patients and medical personnel by hand colonization or by environmental contamination. Infection control measures were reinforced in the SICU to include extensive environmental disinfection, active screening for carbapenemase-producing Enterobacteriaceae, and exhaustive contact isolation precautions. The outbreak did not eradicate in a short time, but the outbreak was eventually interrupted in January 2017.
Carbapenem resistance in Enterobacteriaceae has become a major public health challenge [28]. While carbapenem is a drug of choice for treatment of Enterobacteriaceae producing ESBL and plasmid-mediated AmpC cephalosporinase, production of carbapenemase in Enterobacteriaceae can be emerged. Carbapenemase gene is important due to its potential transferability to other species, by plasmids and transposons [28]. NDM-1 encoding plasmids are diverse and can also carry other antimicrobial resistance genes, including carbapenemase genes, ESBL genes, plasmid-mediated cephalosporinase genes, and aminoglycoside resistance genes [28, 29]. Among these, most ESBLs found with NDM-1 have been reported to be as CTX-M-15 type [29, 30]. Until now, this is the first report of Enterobacteriaceae co-carrying NDM-1 and PER-1 type ESBL. Although the NDM-1 enzyme is known to inactivate all β-lactams except aztreonam [6], our P. rettgeri isolates showed high MIC to aztreonam, possibly due to production of PER-1 type ESBL. The range of MIC to imipenem revealed 0.5–4 μg/mL. Imipenem MICs for Providencia spp. tend to be higher (e.g., MICs in the intermediate or resistant range) naturally. These isolates may have elevated imipenem MICs by mechanisms other than production of carbapenemases [18].
It is known that the multidrug-resistant bacteria have superior ability to survive and spread successfully in a hospital environment. In addition, the patient’s risk factor is also responsible for the nosocomial transmission of multidrug-resistant bacteria. Patient’s underlying disease, exposure to antimicrobial agents, and history of having invasive procedures are known as risk factors for the acquisition of carbapenem-resistant Enterobacteriaceae [28]. This outbreak persisted for 13 months, although the prompt infection control strategy was initiated after recognition of the first few cases. Because ICU admission patients often have one or more of risk factors, so it could be very difficult to eradicate once the outbreak occurs.
In conclusion, we report an alarming outbreak of high-level of multidrug-resistant P. rettgeri isolates co-producing NDM-1 and PER-1 β-lactamases. Infection prevention and control efforts should be continuously made to prevent nosocomial transmission of these threatening bacteria.
Author’s contributions
SS performed the experiment, data analysis, and wrote the manuscript. SHJ, HL, JSH, and MJP performed the experiment and gave advice. WS designed study, data analysis, and critically reviewed and edited the manuscript. All authors read and approved the final manuscript.
Acknowledgements
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Availability of data and materials
All data generated or analyzed during this study are included in this published.
Ethics approval and consent to participate
This study protocol was approved by the hospital institutional review board.
Funding
This study has been funded by grant from the Korean Health Technology R&D Project, Ministry of Health & Welfare, Republic of Korea (HI12C0756).
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Saeam Shin, Email: ugine01@naver.com.
Seok Hoon Jeong, Email: kscpjsh@yuhs.ac.
Hyukmin Lee, Email: HMLEE71@yuhs.ac.
Jun Sung Hong, Email: jumphong2@naver.com.
Min-Jeong Park, Email: mjpark@hallym.or.kr.
Wonkeun Song, Phone: +82-2-829-5259, Email: swonkeun@hallym.or.kr.
References
- 1.O’Hara CM, Brenner FW, Miller JM. Classification, identification, and clinical significance of Proteus, Providencia, and Morganella. Clin Microbiol Rev. 2000;13(4):534–546. doi: 10.1128/CMR.13.4.534-546.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, Harbarth S, Hindler JF, Kahlmeter G, Olsson-Liljequist B, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18(3):268–281. doi: 10.1111/j.1469-0691.2011.03570.x. [DOI] [PubMed] [Google Scholar]
- 3.Mataseje LF, Boyd DA, Lefebvre B, Bryce E, Embree J, Gravel D, Katz K, Kibsey P, Kuhn M, Langley J, et al. Complete sequences of a novel blaNDM-1-harbouring plasmid from Providencia rettgeri and an FII-type plasmid from Klebsiella pneumoniae identified in Canada. J Antimicrob Chemother. 2014;69(3):637–642. doi: 10.1093/jac/dkt445. [DOI] [PubMed] [Google Scholar]
- 4.Tada T, Miyoshi-Akiyama T, Dahal RK, Sah MK, Ohara H, Shimada K, Kirikae T, Pokhrel BM. NDM-1 Metallo-beta-Lactamase and ArmA 16S rRNA methylase producing Providencia rettgeri clinical isolates in Nepal. BMC Infect Dis. 2014;14:56. doi: 10.1186/1471-2334-14-56. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Nordmann P, Poirel L. Emerging carbapenemases in Gram-negative aerobes. Clin Microbiol Infect. 2002;8(6):321–331. doi: 10.1046/j.1469-0691.2002.00401.x. [DOI] [PubMed] [Google Scholar]
- 6.Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K, Walsh TR. Characterization of a new metallo-beta-lactamase gene, bla(NDM-1), and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother. 2009;53(12):5046–5054. doi: 10.1128/AAC.00774-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Gefen-Halevi S, Hindiyeh MY, Ben-David D, Smollan G, Gal-Mor O, Azar R, Castanheira M, Belausov N, Rahav G, Tal I, et al. Isolation of genetically unrelated bla(NDM-1)-positive Providencia rettgeri strains in Israel. J Clin Microbiol. 2013;51(5):1642–1643. doi: 10.1128/JCM.00381-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Barrios H, Garza-Ramos U, Reyna-Flores F, Sanchez-Perez A, Rojas-Moreno T, Garza-Gonzalez E, Llaca-Diaz JM, Camacho-Ortiz A, Guzman-Lopez S, Silva-Sanchez J. Isolation of carbapenem-resistant NDM-1-positive Providencia rettgeri in Mexico. J Antimicrob Chemother. 2013;68(8):1934–1936. doi: 10.1093/jac/dkt124. [DOI] [PubMed] [Google Scholar]
- 9.Carvalho-Assef AP, Pereira PS, Albano RM, Beriao GC, Chagas TP, Timm LN, Da Silva RC, Falci DR, Asensi MD. Isolation of NDM-producing Providencia rettgeri in Brazil. J Antimicrob Chemother. 2013;68(12):2956–2957. doi: 10.1093/jac/dkt298. [DOI] [PubMed] [Google Scholar]
- 10.Pasteran F, Meo A, Gomez S, Derdoy L, Albronoz E, Faccone D, Guerriero L, Archuby D, Tarzia A, Lopez M, et al. Emergence of genetically related NDM-1-producing Providencia rettgeri strains in Argentina. J Global Antimicrob Resist. 2014;2(4):344–345. doi: 10.1016/j.jgar.2014.07.003. [DOI] [PubMed] [Google Scholar]
- 11.Zurita J, Parra H, Gestal MC, McDermott J, Barba P. First case of NDM-1-producing Providencia rettgeri in Ecuador. J Global Antimicrob Resist. 2015;3(4):302–303. doi: 10.1016/j.jgar.2015.07.003. [DOI] [PubMed] [Google Scholar]
- 12.Carmo Junior NV, Filho HF, Gomes ECDA, Calvalcante AJ, Garcia Dde O, Furtado JJ. First report of a NDM-producing Providencia rettgeri strain in the state of Sao Paulo. Braz J Infect Dis. 2015;19(6):675–676. doi: 10.1016/j.bjid.2015.08.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Bocanegra-Ibarias P, Garza-Gonzalez E, Morfin-Otero R, Barrios H, Villarreal-Trevino L, Rodriguez-Noriega E, Garza-Ramos U, Petersen-Morfin S, Silva-Sanchez J. Molecular and microbiological report of a hospital outbreak of NDM-1-carrying Enterobacteriaceae in Mexico. PLoS ONE. 2017;12(6):e0179651. doi: 10.1371/journal.pone.0179651. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Nordmann P, Ronco E, Naas T, Duport C, Michel-Briand Y, Labia R. Characterization of a novel extended-spectrum beta-lactamase from Pseudomonas aeruginosa. Antimicrob Agents Chemother. 1993;37(5):962–969. doi: 10.1128/AAC.37.5.962. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Bradford PA. Extended-spectrum β-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin Microbiol Rev. 2001;14(4):933–951. doi: 10.1128/CMR.14.4.933-951.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Bahar G, Erac B, Mert A, Gulay Z. PER-1 production in a urinary isolate of Providencia rettgeri. J Chemother. 2004;16(4):343–346. doi: 10.1179/joc.2004.16.4.343. [DOI] [PubMed] [Google Scholar]
- 17.Yong D, Shin JH, Kim S, Lim Y, Yum JH, Lee K, Chong Y, Bauernfeind A. High prevalence of PER-1 extended-spectrum beta-lactamase-producing Acinetobacter spp. in Korea. Antimicrob Agents Chemother. 2003;47(5):1749–1751. doi: 10.1128/AAC.47.5.1749-1751.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.CLSI . Performance standards for antimicrobial susceptibility testing; twenty-fifth informational supplement. Wayne: CLSI Document M100-S25, Clinical and Laboratory Standards Institute; 2015. [Google Scholar]
- 19.Testing ECoAS . Breakpoint tables for interpretation of MICs and zone diameters, version 5.0. Växjö: European Committee on Antimicrobial Susceptibility Testing; 2015. [Google Scholar]
- 20.Mirsalehian A, Feizabadi M, Nakhjavani FA, Jabalameli F, Goli H, Kalantari N. Detection of VEB-1, OXA-10 and PER-1 genotypes in extended-spectrum beta-lactamase-producing Pseudomonas aeruginosa strains isolated from burn patients. Burns. 2010;36(1):70–74. doi: 10.1016/j.burns.2009.01.015. [DOI] [PubMed] [Google Scholar]
- 21.Abdalhamid B, Pitout JD, Moland ES, Hanson ND. Community-onset disease caused by Citrobacter freundii producing a novel CTX-M beta-lactamase, CTX-M-30, in Canada. Antimicrob Agents Chemother. 2004;48(11):4435–4437. doi: 10.1128/AAC.48.11.4435-4437.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Pitout JD, Hossain A, Hanson ND. Phenotypic and molecular detection of CTX-M-β-lactamases produced by Escherichia coli and Klebsiella spp. J Clin Microbiol. 2004;42(12):5715–5721. doi: 10.1128/JCM.42.12.5715-5721.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.De Champs C, Sirot D, Chanal C, Bonnet R, Sirot J. A 1998 survey of extended-spectrum beta-lactamases in Enterobacteriaceae in France. The French Study Group. Antimicrob Agents Chemother. 2000;44(11):3177–3179. doi: 10.1128/AAC.44.11.3177-3179.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Schechner V, Straus-Robinson K, Schwartz D, Pfeffer I, Tarabeia J, Moskovich R, Chmelnitsky I, Schwaber MJ, Carmeli Y, Navon-Venezia S. Evaluation of PCR-based testing for surveillance of KPC-producing carbapenem-resistant members of the Enterobacteriaceae family. J Clin Microbiol. 2009;47(10):3261–3265. doi: 10.1128/JCM.02368-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Österblad M, Kirveskari J, Hakanen AJ, Tissari P, Vaara M, Jalava J. Carbapenemase-producing Enterobacteriaceae in Finland: the first years (2008–11) J Antimicrob Chemother. 2012;67(12):2860–2864. doi: 10.1093/jac/dks299. [DOI] [PubMed] [Google Scholar]
- 26.Poirel L, Walsh TR, Cuvillier V, Nordmann P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis. 2011;70(1):119–123. doi: 10.1016/j.diagmicrobio.2010.12.002. [DOI] [PubMed] [Google Scholar]
- 27.Samuelsen O, Thilesen CM, Heggelund L, Vada AN, Kummel A, Sundsfjord A. Identification of NDM-1-producing Enterobacteriaceae in Norway. J Antimicrob Chemother. 2011;66(3):670–672. doi: 10.1093/jac/dkq483. [DOI] [PubMed] [Google Scholar]
- 28.Nordmann P, Naas T, Poirel L. Global spread of Carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis. 2011;17(10):1791–1798. doi: 10.3201/eid1710.110655. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Kumarasamy KK, Toleman MA, Walsh TR, Bagaria J, Butt F, Balakrishnan R, Chaudhary U, Doumith M, Giske CG, Irfan S, et al. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study. Lancet Infect Dis. 2010;10(9):597–602. doi: 10.1016/S1473-3099(10)70143-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Nordmann P, Poirel L, Toleman MA, Walsh TR. Does broad-spectrum β-lactam resistance due to NDM-1 herald the end of the antibiotic era for treatment of infections caused by Gram-negative bacteria? J Antimicrob Chemother. 2011;66(4):689–692. doi: 10.1093/jac/dkq520. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data generated or analyzed during this study are included in this published.
