Incorporation of the δ-subunit into the epithelial sodium channel (ENaC) generates protease-resistant ENaCs in Xenopus laevis

Abstract

The epithelial sodium channel (ENaC) is a critical regulator of vertebrate electrolyte homeostasis. ENaC is the only constitutively open ion channel in the degenerin/ENaC protein family, and its expression, membrane abundance, and open probability therefore are tightly controlled. The canonical ENaC is composed of three subunits (α, β, and γ), but a fourth δ-subunit may replace α and form atypical δβγ-ENaCs. Using Xenopus laevis as a model, here we found that mRNAs of the α- and δ-subunits are differentially expressed in different tissues and that δ-ENaC predominantly is present in the urogenital tract. Using whole-cell and single-channel electrophysiology of oocytes expressing Xenopus αβγ- or δβγ-ENaC, we demonstrate that the presence of the δ-subunit enhances the amount of current generated by ENaC due to an increased open probability, but also changes current into a transient form. Activity of canonical ENaCs is critically dependent on proteolytic processing of the α- and γ-subunits, and immunoblotting with epitope-tagged ENaC subunits indicated that, unlike α-ENaC, the δ-subunit does not undergo proteolytic maturation by the endogenous protease furin. Furthermore, currents generated by δβγ-ENaC were insensitive to activation by extracellular chymotrypsin, and presence of the δ-subunit prevented cleavage of γ-ENaC at the cell surface. Our findings suggest that subunit composition constitutes an additional level of ENaC regulation, and we propose that the Xenopus δ-ENaC subunit represents a functional example that demonstrates the importance of proteolytic maturation during ENaC evolution.

Introduction

Mechanisms allowing salt and water conservation are some of the most important adaptations to a terrestrial environment and key in tetrapod evolution (1). The renin-angiotensin-aldosterone system evolved during water–land transition and is the major regulatory mechanism controlling the ionic composition of the extracellular milieu in vertebrates (1). A key target for the renin-angiotensin-aldosterone system is the epithelial sodium channel (ENaC)⁴ in the apical membrane of principal epithelial cells in the aldosterone-sensitive distal nephron (2). ENaC represents the rate-limiting step for apical uptake of sodium ions and, in concert with the basolateral Na⁺/K⁺-ATPase, transepithelial sodium and, consequently, water absorption.

ENaC is the only member of the degenerin (DEG)/ENaC superfamily of proteins, which is constitutively open (2) and is therefore one of the most stringently regulated ion channels in vertebrates. Hormones, such as aldosterone and glucocorticoids, control ENaC expression (3), whereas a complex network of intracellular kinases regulates its membrane abundance (4). ENaC open probability (P_o) is modulated by intramembrane lipids (2) and is sensitive to changes in the extracellular environment (2), including the concentration of sodium ions (5), pH (6), or mechanical stimuli (7). In addition to these regulatory mechanisms, ENaC activity is linked to its maturation state through proteolytic processing of its subunits (2).

The canonical ENaC is a heterotrimeric channel composed of three homologous subunits (α, β, and γ) (8). Each subunit has short intracellular N and C termini connected by a large extracellular loop. The extracellular loop probably represents a “handlike” structure, consisting of a “palm,” “ball,” “finger,” “thumb,” and “knuckle” domain (9). The extracellular loops of the α- and γ-subunits contain short inhibitory peptides in the finger domains, which are flanked by protease cleavage sites. The inhibitory peptide within the α-subunit is flanked by two cleavage sites that are recognized by the protease furin, whereas the inhibitory peptide within the γ-subunit contains only one furin cleavage site and additional cleavage sites for extracellular proteases (10). Furin, which is primarily present in the trans-Golgi network, cleaves the α-subunit twice and thereby releases its inhibitory peptide, whereas the γ-subunit is only cut once (2). Channels lacking this endogenous proteolytic maturation display a very low P_o, whereas furin-cleaved ENaCs that are translocated to the plasma membrane have moderate activity. Extracellular proteases cut the γ-subunit and thereby release its inhibitory peptide, resulting in ENaCs with a high P_o (2, 10). Proteolytic processing not only represents an additional level of ENaC regulation but was also suggested to be crucial for the transition of a stimulus-activated DEG/ENaC ancestor to a constitutively open channel during ENaC evolution (10).

In addition to the three subunits composing canonical ENaCs, a δ-subunit was identified, which can assemble with the β- and γ-subunits to form atypical ENaCs (11). The physiological importance of this subunit is not understood, but in vitro studies using human orthologues demonstrated that δβγ-ENaC has distinct properties from αβγ-ENaC (12). Complicating its physiological analysis, mice and rats lack a functional gene for δ-ENaC (13). However, δ-ENaC is present in amphibians, including the South African clawed frog Xenopus laevis, where it had originally been named ϵ-ENaC (14). Given the lack of an appropriate animal model to study this ion channel and the fact that X. laevis is an established model organism in molecular cell biology as well as physiology, this study investigated the molecular physiology of ENaC containing the δ-subunit in this species.

We demonstrate that δ-ENaC has a different expression pattern compared with α-ENaC and that δ-containing channels display an intrinsic dynamic open probability. We show that incorporation of the δ-subunit renders this amphibian ENaC completely insensitive to proteolytic activation by extracellular proteases due to intersubunit interactions involving γ-ENaC. We suggest that subunit composition provides an additional level of ENaC regulation but also propose that Xenopus δ-ENaC represents a functional example for ENaC at the interface of stimulus-activated and constitutively open DEG/ENaC ion channels, demonstrating the importance of proteolytic maturation in ENaC evolution.

Results

The δ-ENaC subunit is predominantly expressed in urogenital tissues in X. laevis

Due to the lack of specific antibodies that allow discrimination of α- and δ-ENaC, expression of these subunits was investigated in adult X. laevis via RT-PCR (Fig. 1). Control reactions were performed with cDNA samples that were generated without the addition of reverse transcriptase. These reactions were always negative and did not show any DNA signals in the MidoriGreen fluorescence of the agarose gels after the PCRs (data not shown). Transcripts for the δ-ENaC subunit were almost exclusively found in urogenital tissues (kidney, urinary bladder, testes, ovary, oocytes, and cloaca), whereas expression of the α-subunit was more diversely distributed (skin, lung, liver, parts of the gastrointestinal and urogenital tract, brain, and spinal cord). All δ-ENaC–expressing tissues, except the ovary, also contained transcripts for the α-subunit.

Figure 1.

The δ-ENaC subunit is predominantly expressed in urogenital tissues in X. laevis. Tissues from adult X. laevis were screened for expression of δ- and α-ENaC subunit mRNA via RT-PCR. Amplicons for δ-ENaC (320 bp) were found in tissue samples from kidney, urinary bladder, testes, ovary, oocytes, and the cloaca. With the exception of the ovary, these tissues also expressed α-ENaC (291 bp). Amplification of β-actin mRNA (610 bp) served as a control. Control reactions have been performed without reverse transcriptase but are omitted from the figure for clarity. These reactions did not show any DNA signals in the MidoriGreen fluorescence of agarose gels after PCR. Numbers in parentheses indicate the quantity of positively tested samples with respect to the total amount of samples from different animals.

The presence of the δ-subunit alters ENaC characteristics

Functional characterization of αβγ- and δβγ-ENaC was achieved by expression of either channel isoform in X. laevis oocytes. Although transcripts for δ-ENaC were detected in oocytes (Fig. 1) injection of β- and γ-ENaC RNA does not produce amiloride-sensitive transmembrane current (I_M) (14), excluding a potential contamination by endogenous δ-ENaC. Electrophysiological assessment of whole-cell I_M at membrane potentials (V_M) from −100 to +40 mV revealed an inward current at negative V_M with a reversal potential of 9.8 mV (αβγ-ENaC) and 14.2 mV (δβγ-ENaC) and was inhibited by the ENaC-blocker amiloride (Fig. 2a). Consistent with previous reports (14), channel isoforms exhibited different kinetics of I_M after washout of amiloride. Cells expressing αβγ-ENaC display a slow and steady current increase that eventually reaches a plateau, whereas channels containing the δ-subunit show a rapid, peaked increase in I_M followed by a continuous current decline (Fig. 2b). Despite this current rundown, amiloride-sensitive current fractions (ΔI_ami) of δβγ-ENaC–expressing oocytes were 2.4-fold larger than in αβγ-ENaC–expressing cells (Fig. 2c). The increased ΔI_ami mediated by δβγ-ENaC was also sustained after 14 min when the current eventually approached a plateau (Fig. 2, d and e).

Figure 2.

The δ-subunit alters ENaC characteristics. a, current (I_M)/voltage (V_M) plots of oocytes expressing αβγ- or δβγ-ENaC in the absence (left) or presence (right) of amiloride. b, representative I_M recordings of oocytes expressing αβγ- or δβγ-ENaC at −60 mV. Black bars, application of amiloride (a). c, amiloride-sensitive current fractions (ΔI_ami) in both ENaC isoforms derived from the second application of amiloride (Student's unpaired t test with Welch's correction). d and e, representative current traces (d) and corresponding mean values of I_M (e) of αβγ- or δβγ-ENaC–expressing oocytes, depicting the enhanced current rundown of δ-ENaC–containing channels over an extended time period. At any given time point, I_M mediated by δ-containing channels was significantly increased compared with αβγ-ENaC–mediated currents (*, p < 0.0003, Mann–Whitney U test). Lines and error bars, mean and S.E.

The increased ΔI_ami of δβγ-ENaC–expressing oocytes may result from changes in the single-channel conductance, P_o, or membrane abundance of these channels. Cell-attached patch-clamp recordings of oocytes expressing δβγ-ENaC revealed unitary channel characteristics similar to α-ENaC–containing channels (Fig. 3a). Analysis of individual recordings lasting for 120–180 s revealed no significant difference between ENaC isoforms in the number of visible channels or the slope conductance (G_slope), derived from V_M of −100 to −40 mV (Fig. 3, b and c). Although there was no difference in P_o compared with αβγ-ENaC, channels containing the δ-subunit displayed significantly prolonged open times and a tendency for extended mean closed times that did not reach statistical significance (Fig. 3, d and e). Consistent with whole-cell currents (Fig. 2d), patch-clamp recordings of δβγ-ENaC regularly showed a decline of channel activity (Fig. 3f), which impaired proper estimation of P_o. Therefore, P_o of αβγ- and δβγ-ENaC was additionally determined using 2-(trimethylammonium)ethylmethanethiosulfonate (MTSET)-sensitive β_S540C-ENaC mutant channels. Covalent modification of an introduced cysteine within the conserved degenerin site of β-ENaC by MTSET elevates P_o of ENaC containing the β_S540C mutation to 1.0 (16). Comparison of ΔI_ami before and after MTSET application allows estimation of channel P_o. The ΔI_ami of oocytes expressing αβ_S540Cγ- or δβ_S540Cγ-ENaC was not significantly different from that for cells expressing respective WT channels (Fig. 4a). P_o of αβ_S540Cγ- or δβ_S540Cγ-ENaC was estimated by measuring ΔI_ami before and after administration of MTSET (1 mm), which increased I_M mediated by both channels (Fig. 4, b and c), assuming that MTSET shifts the P_o of both channel isoforms to the same degree (close to 1.0). Although initial ΔI_ami of δβ_S540Cγ-ENaC was increased compared with α-ENaC–containing channels, this discrepancy was lost after application of MTSET (Fig. 4d). Comparison of the initial ΔI_ami with ΔI_ami after exposure to MTSET (P_o = 1.0) indicated a significantly larger initial P_o for ENaC containing the δ-subunit compared with αβ_S540Cγ-ENaC (Fig. 4e). Overall, these data suggest that the presence of the δ-subunit enhances the amount of current generated by ENaC due to an increased P_o rather than single-channel conductance, but also changes current into a transient form.

Figure 3.

Xenopus αβγ- and δβγ-ENaC single-channel characteristics. a, representative current traces from cell-attached patch-clamp recordings of αβγ- or δβγ-ENaC–expressing oocytes (V_M = −100 mV). Amplitude histograms depict Gaussian distribution of channel amplitudes. Dotted squares, areas of trace magnification (c, closed; 1, 2, number of open channels). b, number of visible channels in cell-attached recordings as presented in a (Student's unpaired t test). c, slope conductance (G_slope) of αβγ- and δβγ-ENaC derived from linear regression of unitary channel conductance at −40 to −100 mV. d, apparent open probability of both ENaC isoforms (Student's unpaired t test). e, estimation of single-channel kinetics revealed an increased open time (t_open) of δβγ-ENaC, but no significant change in closed time (t_closed) between ENaC isoforms (Dunn's multiple-comparison test). Evaluation of all single-channel characteristics was performed using current recordings with a duration of 120–180 s with a maximum of eight channels per patch. f, cell-attached recording of a δβγ-ENaC–expressing oocyte indicating a rundown of ENaC activity that impedes a precise determination of channel open probability. Lines and error bars, mean and S.E.

Figure 4.

The MTSET-sensitive β_S540C-ENaC mutant reveals an increased open probability of ENaCs containing the δ-subunit. a, amiloride-sensitive current fractions (ΔI_ami) of oocytes expressing αβγ- or δβγ-ENaC containing either WT β-ENaC or the β_S540C-ENaC mutation (Student's unpaired t test). b and c, representative I_M traces of oocytes expressing αβ_S540Cγ- or δβ_S540Cγ-ENaC. The open probability of both channel isoforms was determined by assessing ΔI_ami before and after the application of MTSET (1 mm). d, statistical comparison of ΔI_ami of oocytes expressing αβ_S540Cγ- or δβ_S540Cγ-ENaC before (initial) and after application of MTSET (initial, Student's unpaired t test; MTSET, Student's unpaired t test with Welch's correction). e, open probability of αβ_S540Cγ- and δβ_S540Cγ-ENaC determined by the ratio of ΔI_{ami initial}/ΔI_{ami MTSET} (Student's unpaired t test). Lines and error bars, mean and S.E.

The δ-subunit is not proteolytically processed and does not change membrane abundance compared with α-containing channels

Proteolytic processing of ENaC subunits by intra- and extracellular proteases impacts channel P_o (10). To monitor proteolytic cleavage of both αβγ- and δβγ-ENaC, epitope-tagged α_HA/V5- and δ_HA/V5-ENaC subunits containing an N-terminal HA tag and a C-terminal V5 tag were generated (Fig. 5a). Immunoblots from whole-cell lysates of oocytes expressing either α_HA/V5βγ- or δ_HA/V5βγ-ENaC targeted against the HA or V5 tag revealed a discrepancy in the endogenous cleavage pattern of both ENaC subunits (Fig. 5b). Blots targeting the N-terminal HA tag of the α_HA/V5-subunit displayed a full-length peptide at ∼75 kDa and two short peptides at ∼18 and ∼13 kDa, probably corresponding to cleavage products resulting from proteolysis by intracellular furin, which cuts the α-subunit twice (Xenopus α-ENaC: RVKR¹⁴⁵ and RVSR¹⁶⁸) (17). In contrast, only the full-length peptide of the δ_HA/V5-subunit at ∼75 kDa was detected, consistent with the lack of a minimal consensus sequence for furin-mediated cleavage (RXXR↓ (18)) in this ENaC subunit. These findings were confirmed by blots targeting the C-terminal V5 tags, which yielded two signals for α_HA/V5-ENaC, representing full-length (∼75 kDa) and cleaved (∼60 kDa) peptides but only one signal (∼75 kDa) representing the full-length δ_HA/V5-ENaC. Proteolysis by furin would occur in the trans-Golgi network. Therefore, glycosylation of the δ_HA/V5-subunit, which is also associated with this route for post-translational modification, was examined. Treatment of whole-cell lysates from oocytes expressingδ_HA/V5βγ-ENaC with PNGase F induced a downward migration shift of the signal in blots targeting the V5 tag (Fig. 5c). This indicates glycosylation of the δ-ENaC subunit and suggests passage through the trans-Golgi network. Epitope-tagged α_HA/V5- and δ_HA/V5-ENaC subunits were subsequently employed to compare membrane abundance of both channel isoforms by surface biotinylation. Similar to WT channels, the ΔI_amimediated by δ_HA/V5βγ-ENaC was increased compared with α_HA/V5βγ-ENaC (Fig. 5, d and e). Only a single signal (∼60 kDa) was detected in membrane fractions from α_HA/V5βγ-ENaC–expressing cells, indicating the absence of unprocessed α_HA/V5-ENaC peptides at the cell surface, whereas only unprocessed δ_HA/V5-ENaC peptides (∼75 kDa) could be detected in membrane and cytosolic fractions (Fig. 5f). Membrane abundance was determined by densitometric analysis of signal intensities from both membrane and cytosolic protein fractions in V5-targeted immunoblots. There was no difference in surface expression between α_HA/V5βγ- and δ_HA/V5βγ-ENaC (Fig. 5g), supporting the notion that an enhanced P_o rather than membrane abundance contributes to the increased I_M mediated by ENaC containing the δ-subunit. In sum, these data suggest that unlike α-ENaC, the δ-subunit does not undergo proteolytic maturation by the endogenous protease furin, and incorporation of this subunit does not affect channel membrane abundance.

Figure 5.

The δ-subunit is not subject to proteolytic maturation, and δβγ-ENaC membrane abundance is not changed compared with α-containing channels. a, schematic depiction of epitope-tagged ENaC subunits. The numbers indicate approximate molecular mass of peptides with/without furin cleavage, detected by immunoblots, as presented in b. b, immunoblots of whole-cell lysates from oocytes expressing α_HA/V5βγ- or δ_HA/V5βγ-ENaC using anti-HA and anti-V5 antibodies. c, a migration shift of the δ_HA/V5-subunit due to treatment with PNGase F indicates glycosylation of the protein. d, representative I_M recordings of oocytes expressing α_HA/V5βγ- or δ_HA/V5βγ-ENaC. e, amiloride-sensitive current fractions (ΔI_ami) of α_HA/V5βγ- and δ_HA/V5βγ-ENaC (Student's unpaired t test). f, immunoblot using an anti-V5-antibody of membrane (mem.) and cytosolic fractions from oocytes expressing α_HA/V5βγ- or δ_HA/V5βγ-ENaC. The bottom blot shows the results from reprobing of the same membrane with an anti-pan-actin antibody to verify proper fractionation. g, membrane abundance of α_HA/V5βγ- and δ_HA/V5βγ-ENaC derived from densitometric analysis of immunoblots as shown in f (Student's unpaired t test). Lines and error bars, mean and S.E.

ENaCs containing the δ-subunit are insensitive to activation by extracellular proteases

Because the δ-ENaC subunit is not processed by furin, the activation of αβγ- and δβγ-ENaC by extracellular proteases was compared. Oocytes expressing either ENaC isoform were exposed to chymotrypsin, which activates ENaC at the cell surface (19). The ΔI_ami of both channel isoforms was determined before and after perfusion of the cells with 2 μg/ml α-chymotrypsin (from bovine pancreas, TLCK-treated; Sigma) in ORS (90 mm NaCl, 1 mm KCl, 2 mm CaCl₂, 5 mm HEPES, pH 7.4) containing amiloride for 5 min (Fig. 6, a and d). Administration of chymotrypsin significantly increased ΔI_ami of oocytes expressing αβγ-ENaC (Fig. 6b). This activation was also present in cells incubated with furin inhibitor I (40 μm) before recordings. Inhibition of furin potentiated the proteolytic activation of αβγ-ENaC from a 4-fold to a 9-fold increase of ΔI_ami, whereas no change of ΔI_ami (-fold activation = 1) was observed in control groups that were perfused with ORS containing amiloride without chymotrypsin (Fig. 6c). Application of chymotrypsin did not increase currents mediated by δβγ-ENaC, regardless of preceding incubation with the furin inhibitor (Fig. 6, d–f). The same results were observed using trypsin (data not shown). These data indicate that currents generated by δβγ-ENaC are insensitive to activation by extracellular serine proteases, such as chymotrypsin and trypsin.

Figure 6.

ENaCs containing the δ-subunit are insensitive to activation by extracellular proteases. a, representative I_M traces of oocytes expressing αβγ-ENaC. Proteolytic channel activation was determined by assessing amiloride-sensitive current fractions (ΔI_ami) before and after application of chymotrypsin (CT; 2 μg/ml) together with amiloride (a). Current traces of oocytes previously incubated with furin inhibitor I (40 μm) are depicted as dotted gray lines. b, comparison of ΔI_ami before and after application of chymotrypsin in oocytes incubated with (+) or without (−) furin inhibitor I (one-way ANOVA; F = 15.31, p < 0.0001; Tukey's multiple comparison test). c, comparison of -fold activation in ΔI_ami between experimental groups (chymotrypsin +) and control groups (chymotrypsin −) (one-way ANOVA; F = 44.4, p < 0.0001; Tukey's multiple comparison test). d–f, I_M traces (d) and statistical evaluation of changes in ΔI_ami in oocytes expressing δβγ-ENaC. Data presentation is equivalent to a–c. e, Kruskal–Wallis test, p = 0.376; Dunn's multiple-comparison test. f, one-way ANOVA; F = 1.393, p = 0.2598; Tukey's multiple-comparison test. Lines and error bars, mean and S.E.

The presence of the δ-subunit prevents cleavage of the γ-subunit by extracellular proteases

Intracellular cleavage of the γ-ENaC subunit renders the channel susceptible to activation by extracellular proteases (20). Cleavage of γ-ENaC at the cell surface by extracellular proteases induces the release of its inhibitory peptide and activates the channel (21). Because the δ-subunit prevented ENaC activation by extracellular chymotrypsin, the cleavage states of the α-, δ-, and γ-subunits at successive stages of proteolytic ENaC processing were examined. Epitope-tagged subunits were expressed in oocytes together with WT ENaC subunits (α_HA/V5βγ, δ_HA/V5βγ, αβγ_HA/V5, and δβγ_HA/V5), and ΔI_ami of individual oocytes from each group with or without prior incubation in chymotrypsin (2 μg/ml; 5 min) was measured. After surface biotinylation, membrane fractions were isolated, and cleavage states of individual ENaC subunits were analyzed in immunoblots targeted at the C-terminal V5 epitope. Incubation with chymotrypsin enhanced ΔI_ami of α_HA/V5βγ-ENaC–expressing oocytes, whereas this activation was absent inδ_HA/V5βγ-ENaC–expressing cells (Fig. 7a). In corresponding immunoblots, two signals at ∼75 and ∼60 kDa were visible in cytosolic fractions for the α_HA/V5-ENaC subunit that represent uncleaved and furin-cleaved peptides, whereas only processed subunits were present in membrane fractions (Fig. 7b). Analogous stages of subunit maturation were not observed for the δ_HA/V5-subunit_, for which only one signal at ∼75 kDa was visible in cytosolic and membrane fractions. No additional cleavage products of α_HA/V5- and δ_HA/V5-ENaC were found in membrane fractions of chymotrypsin-treated oocytes, indicating no further subunit cleavage at the cell surface. However, examination of γ_HA/V5-ENaC cleavage stages revealed further processing of this subunit at the cell surface, which depended on its co-expression with α- or δ-ENaC. Whereas ΔI_ami mediated by αβγ_HA/V5-ENaC was increased in oocytes treated with chymotrypsin, activity of δβγ_HA/V5-ENaC was unaffected by the protease (Fig. 7c). Immunoblots of either α- or δ-ENaC–containing channels revealed two signals in cytosolic fractions that represent uncleaved (∼100-kDa) and cleaved (∼75-kDa) γ_HA/V5-ENaC peptides (Fig. 7d). Only one signal was present in the membrane fraction of these cells (∼75 kDa), indicating the absence of uncleaved γ_HA/V5-ENaC subunits at the cell surface. An additional cleavage product (∼70 kDa) appeared in the membrane fraction of αβγ_HA/V5-ENaC–expressing oocytes after incubation with chymotrypsin. However, chymotrypsin did not induce an additional cleavage product in membrane fractions of cells expressing δβγ_HA/V5-ENaC. The secondary cut of γ_HA/V5-ENaC by chymotrypsin is prevented in the presence of the δ-subunit, which probably contributes to the insensitivity of δβγ-ENaC to extracellular proteases. These data indicate that the presence of the δ-subunit prevents cleavage of the γ-subunit at the cell surface and activation by extracellular proteases.

Figure 7.

The presence of the δ-ENaC subunit prevents cleavage of the γ-subunit by extracellular proteases. a, comparison of ΔI_ami from oocytes expressing epitope-tagged α_HA/V5βγ- or δ_HA/V5βγ-ENaC with (+) or without (−) prior incubation with chymotrypsin (2 μg/ml, 5 min). b, V5-targeted immunoblots of cytosolic and membrane fractions from oocytes expressing α_HA/V5βγ- or δ_HA/V5βγ-ENaC that were treated with (+) or without (−) chymotrypsin. Blots were reprobed for pan-actin to verify proper isolation of membrane fractions. c, ΔI_ami of oocytes expressing epitope-tagged αβγ_HA/V5- or δβγ_HA/V5-ENaC with (+) or without (−) prior incubation with chymotrypsin. d, V5-targeted immunoblots of cytosolic and membrane fractions from oocytes expressing αβγ_HA/V5- or δβγ_HA/V5-ENaC, which were treated with (+) or without (−) chymotrypsin. Lines and error bars, mean and S.E.

Discussion

This study revealed that the presence of the δ-subunit changes properties of transmembrane currents generated by X. laevis ENaC. In contrast to the rather stable currents mediated by αβγ-ENaC, channels containing the δ-subunit mediated larger currents that had a more transient nature. These observations are consistent with findings from a previous study and can be attributed to differences in the speed of ENaC sodium self-inhibition (SSI) (14), which reflects the allosteric reduction of ENaC P_o in the presence of extracellular sodium ions (5). SSI kinetics are reduced in Xenopus ENaCs containing the δ-subunit (14). Human δβγ-ENaC also displays a slow progression of SSI (22) and reduced gating kinetics (11), suggesting a generally decreased gating velocity of ENaC containing the δ-subunit. This is supported by single-channel recordings of both ENaC isoforms presented in this study, which revealed prolonged mean open times and a tendency for longer closed times of δ-containing ENaCs. However, whereas the magnitude of SSI is decreased in human δβγ-ENaC (22), it is markedly pronounced in the Xenopus orthologue (14) and probably accounts for the rather transient current form observed for δβγ-ENaC in this study.

Despite this rundown, whole-cell currents of oocytes expressing δβγ-ENaC were consistently larger compared with αβγ-ENaC–expressing cells. Similarly, substitution of α- for the δ-subunit in human ENaC results in elevated whole-cell currents, which have been suggested to be caused by a larger single-channel conductance and an enhanced P_o (19). Channels resulting from co-expression of Xenopus δ-ENaC with the human β- and γ-ENaC subunits also exhibit a high spontaneous P_o, whereas their unitary conductance equaled those of α-ENaC–containing channels (23). Cell-attached patch-clamp recordings of Xenopus α- and δβγ-ENaC in the present study did not reveal differences in the conductance or P_o of these ENaC isoforms, supporting the concept that incorporation of the δ-ENaC subunit from X. laevis does not affect ENaC single-channel conductance. Without apparent differences in the number of visible channels and P_o of αβγ- and δβγ-ENaC obtained from patch-clamp recordings, the observed differences in amiloride-sensitive whole-cell currents could not be explained. A continuous decrease of channel activity was observed in patches containing δβγ-ENaC, which corresponds to the macroscopic decline of whole-cell transmembrane currents due to SSI and suggests an SSI-dependent temporal decrease in channel activity.

Alternative determination of P_o at the whole-cell level using mutant β_S540C-ENaC in combination with MTSET displayed a markedly increased P_o of δ-ENaC compared with α-ENaC–containing channels. The generated Xenopus β_S540C-ENaC mutation is analogous to the previously utilized rat β_S518C (24) and human β_S520C (19) constructs that target the conserved “degenerin” site of ENaC subunits, which corresponds to a domain essential for the gating of related DEG channels in Caenorhabditis elegans (25). Administration of MTSET to ENaC containing this mutation sets channel P_o to nearly 1.0 through the covalent addition of a bulky residue to the introduced cysteine near the channel gate (16), and we assumed that MTSET shifts the P_o of α- and δ-containing ENaCs to the same degree. Introduction of this mutation did not change baseline ENaC current, as initial ΔI_ami of channels containing the mutant β_S540C-subunit were not significantly different from respective WT channels. MTSET increased ΔI_ami of αβ_S540Cγ-ENaC and, to a lower extent, ΔI_ami of δβ_S540Cγ-ENaC. Assuming a similarly effective activation of both ENaC isoforms by MTSET and a negligible proportion of closed channels that are insensitive to chemical modification (16), the estimated P_o of αβ_S540Cγ-ENaC (0.2) correlates well to patch-clamp results in this (0.24) and a previous study (7). ENaC containing the δ-subunit displayed a P_o that was 3 times larger (0.6), which explains the enhanced whole-cell currents mediated by Xenopus δβγ-ENaC. Furthermore, equal levels of ΔI_ami in α- and δβ_S540Cγ-ENaC after application of MTSET indicate a similar membrane expression of both channel isoforms. This is further supported by the equal number of visible channels observed in patch-clamp recordings of α- and δβγ-ENaC as well as the similar membrane abundance of epitope-tagged α_HA/V5- or δ_HA/V5-ENaC subunits. Hence, an elevated P_o is the major determinant for increased whole-cell currents mediated by δβγ-ENaC, but P_o is not stable and decreases over time.

Interestingly, introduction of the β_S540C mutation abolished the transient nature of whole-cell currents mediated by δ-containing ENaC. This supports the conclusion that the transient activity of Xenopus δβγ-ENaC reflects its P_o, which is inhibited in the presence of extracellular sodium due to SSI. As a release from SSI and a resulting increase of ENaC P_o are essential for channel activation by proteolytic processing (26), the regulation of Xenopus δβγ-ENaC by proteases was investigated.

Initial proteolytic processing of ENaC occurs by selective cleavage of the α- and γ-ENaC subunits by furin (27). During this proteolytic maturation in the trans-Golgi network, furin cleaves the channel at three distinct sites. Two cleavage sites located in the finger domain of α-ENaC enclose a small inhibitory peptide that is released upon furin-mediated cleavage (28), whereas proteolysis at a single site on the γ-ENaC subunit primes the channel for further activation at the cell surface (20). Secondary proteolysis of the γ-ENaC subunit distal to the furin cleavage site entails the dissociation of another inhibitory peptide and thus facilitates activation of ENaC at the cell surface by further increasing P_o. Additional cleavage of γ-ENaC may be facilitated by various serine proteases like trypsin, channel-activating protease 1, or neutrophil elastase (2).

The present study demonstrates that the δ-subunit of Xenopus ENaC is not subject to proteolytic maturation by furin, and channels containing this subunit are insensitive to activation by extracellular proteases. Immunoblots targeting epitope-tagged α_HA/V5-, δ_HA/V5-, or γ_HA/V5-ENaC subunits revealed α- and γ-ENaC cleavage fragments. These fragments probably represent furin cleavage products, because both ENaC subunits contain conserved furin consensus sites (RXXR↓) (2), and channel activation by extracellular chymotrypsin is potentiated after inhibition of furin. By contrast, the absence of δ-ENaC cleavage fragments in oocyte whole-cell lysates and membrane fractions implies a lack of intracellular proteolytic processing and is consistent with the absence of a furin consensus site in the peptide sequence of this subunit. Furthermore, the stimulatory effect of extracellular proteases as observed for αβγ-ENaC was completely lost in δβγ-ENaC. Immunoblots targeting the V5 epitope of γ_HA/V5-ENaC revealed two signals, corresponding to uncleaved and furin-cleaved peptides, in cytosolic fractions, whereas the membrane fraction only contained one signal corresponding to the furin-cleaved peptide. This was observed for γ_HA/V5-ENaC after co-expression with the α- or δ-subunit, suggesting that the presence of the δ-subunit does not prevent intracellular maturation of γ-ENaC. After exposure to chymotrypsin, an additional immunoblot signal occurred in membrane fractions of αβγ_HA/V5-ENaC, representing a second cleavage event in the γ-subunit by the extracellular protease. In contrast, this was not observed in δβγ_HA/V5-ENaC, suggesting that the presence of the δ-subunit prevents cleavage of γ-ENaC by extracellular proteases. Extracellular cleavage of the γ-subunit is considered rate-limiting for maximal ENaC activation at the cell surface, thus explaining the lack of functional current stimulation of δβγ-ENaC by chymotrypsin.

The lack of an ENaC crystal structure complicates the mechanistic interpretation of this observation. The crystal structure of the homologous acid–sensing ion channel suggests that the finger domains play a prominent role in intersubunit interactions (9). Based on the location of the inhibitory peptides within the finger domains of the α- and γ-subunit (2), it could be hypothesized that cleavage of the α-subunit triggers structural changes that affect the neighboring γ-subunit. The lack of cleavage in the δ-subunit might prevent such a structural rearrangement and prevent extracellular proteases from accessing corresponding cleavage sites in the γ-subunit. This hypothesis is challenged by the fact that the presence of the inhibitory sequence rather than cleavage per se is responsible for low ENaC activity (2). However, the peptide sequence of the δ-subunit does not contain homologies to an inhibitory tract, and activity of δβγ-ENaC is generally higher than that of αβγ-ENaC. The lack of an inhibitory peptide in δ-ENaC might therefore lead to an enhanced ENaC P_o, but also prevent further increase in P_o by impeding the access of extracellular proteases to the γ-subunit.

The lack of proteolytic processing might also be reflected in the observed expression pattern of α- and δ-ENaC in Xenopus tissues. Protease/anti-protease balance is suggested as a mechanism regulating the volume of surface liquid lining pulmonary epithelia (29). This might explain the need for a protease-sensitive ENaC in lung epithelia and the lack of δ-ENaC in this organ. The presence of δ-ENaC in osmoregulatory organs, such as the kidney, might constitute an additional level of ENaC control, bypassing proteolytic regulation. Future studies will have to identify the precise cellular localization of α- and δ-ENaC as well as the mechanisms regulating the expression and P_o of δβγ-ENaC. Interestingly, δ-ENaC mRNA was detected in testes and oocytes/ovaries. Because experimental expression of the Xenopus ENaC β- and γ-subunits does not increase transmembrane currents in oocytes (14), which would occur due to complementation of the channel by endogenous δ-ENaC, it is likely that translation of (maternal) δ-ENaC mRNA is blocked by masking proteins (30). This, however, might suggest a role for δ-ENaC in early embryonic development. Extracellular serine proteases play an important role in Xenopus early embryonic development (31); a functional role for ENaC channels in embryogenesis, however, remains to be proven.

Finally, the data reported herein may provide insights into ENaC evolution. Kleyman's group suggested that proteolytic processing was a crucial step in the evolution of ENaC from a stimulus-activated DEG/ENaC ancestor to a constitutively open channel (10) and hence adaptation to terrestrial life. Unlike any other vertebrate ENaC characterized to date, Xenopus δ-ENaC is the only channel that is completely insensitive to proteolytic processing and also the only vertebrate ENaC that displays a strong current rundown that is almost comparable with transient currents triggered by acid–sensing ion channels, which are evolutionarily older than ENaC. Furthermore, Xenopus δ-ENaC is the only α-like subunit that does not generate currents when expressed alone in oocytes (14). Xenopus δ-ENaC might therefore provide functional evidence for Kleyman's hypothesis of proteolytic activation as a prerequisite for constitutively open ENaCs. Interestingly, cloning of three ENaC subunits from the Australian lungfish, Neoceratodus forsteri, revealed the presence of furin cleavage sites in the γ-subunit, but not in the α-subunit (32). Because lungfish are the oldest living ancestors of tetrapods, proteolytic sensitivity of the γ-subunit might have been a prerequisite for further evolution of proteolytic maturation in α-like ENaC subunits in higher tetrapods.

Overall, our findings suggest that subunit composition constitutes an additional level of ENaC regulation, and we propose that the Xenopus δ-ENaC subunit represents a functional example that demonstrates the importance of proteolytic maturation during ENaC evolution.

Experimental procedures

Isolation of X. laevis tissues

All procedures and experimental protocols were approved by the Animal Welfare Officer of the University of Giessen (registration number M_478/M_549) as well as the Animal Welfare and Ethical Review Body at Newcastle University (project ID 630). The animal housing facility (Giessen, Germany) was licensed by local authorities (Az: FD 62-§11 JLU Tierphysiologie). The methods used to humanely euthanize the animals were consistent with the recommendations of the AVMA Guidelines for the Euthanasia of Animals. Adult X. laevis were anesthetized for 15 min in 0.2% MS-222/H₂O (Pharmaq, New Hampshire, UK) at pH 6 and euthanized by decapitation and sounding of the spinal cord. Tissue samples used for RNA isolation were removed and immediately transferred into RNAlater solution (Qiagen, Hilden, Germany). Oocytes were isolated exactly as described previously (7) and kept in culture oocyte Ringer's solution (CulORS: 90 mm NaCl, 1 mm KCl, 2 mm CaCl₂, 5 mm HEPES, 2.5 mm sodium pyruvate, 0.06 mm penicillin G, and 0.02 mm streptomycin sulfate, pH 7.4). For some experiments, oocytes were purchased from the European Xenopus Resource Centre (Portsmouth, UK) or Ecocyte Bioscience (Castrop-Rauxel, Germany).

RNA isolation and RT-PCR

Total mRNA pools were isolated from X. laevis tissue samples employing the RNeasy extraction system (Qiagen, Hilden, Germany) according to the manufacturer's instructions. The mRNA was reverse-transcribed in cDNA using a poly(A) primer together with the ImProm-II reverse transcription system (Promega, Mannheim, Germany). For controls, identical reactions were performed without reverse transcriptase. The cDNA served as a template in a PCR (GoTaq DNA polymerase kit, Promega) using primers listed in Table 1. PCR conditions were an initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 45 s, annealing at 64 °C for 30 s, and elongation at 72 °C for 45 s. The reaction was terminated with a final extension at 72 °C for 10 min. Amplicons were separated on a 1% agarose gel and visualized by MidoriGreen (Nippon Genetics, Dueren, Germany) fluorescence.

Table 1.

Primer sequences used for RT-PCR

Target	Primer sequence (5′–3′)	Amplicon
		bp
α-ENaC
Forward	AGCAGGTCTGTGTCCGTTCT	291
Reverse	ATTGTCGGGACAGTGTGTGA
δ-ENaC
Forward	ACCACTTTCTGGCTTGTGCT	320
Reverse	CCTCCATTGACTTGGCCTGT
β-Actin
Forward	GCCCGCATAGAAAGGAGACA	610
Reverse	GTCTGTCAGGTCACGTCCAG

Plasmids and cRNA synthesis

Coding sequences for X. laevis δ-, α-, β-, and γ-ENaC were present in the pTNT expression vector (Promega). A MTSET-sensitive β_S540C-ENaC mutant was generated by site-directed mutagenesis (primers listed in Table 2) using the QuikChange Lightning Kit (Agilent Technologies, Waldbronn, Germany) according to the manufacturer's instructions. The δ-, α-, and γ-ENaC subunits were tagged with an HA epitope (YPYDVPDYA) at the N terminus and a V5 epitope (GKPIPNPLLGLDST) at the C terminus by PCR, using extended primers (Table 2) and Platinum Pfx DNA polymerase (Invitrogen, Karlsruhe, Germany). PCR was performed by initial denaturation for 5 min at 95 °C, followed by 35 cycles of denaturation for 45 s at 95 °C, annealing for 30 s at 70 °C, and elongation for 180 s at 72 °C. The reaction was terminated by elongation for 10 min at 72 °C, and amplicons were separated on 0.8% agarose gels. Bands of appropriate sizes were purified using a Gelextract minikit (5Prime, Darmstadt, Germany), and A-overhangs (3′) were generated employing the GoTaq DNA polymerase system (Promega). Amplicons were ligated (T4 Ligase, Promega) into the pGEM-T_easy vector (Promega) according to the manufacturer's protocol and transformed into competent Escherichia coli (K12, DH5α). Transformed clones were identified by ampicillin resistance and blue/white selection. Plasmids were isolated employing the QIAprep Spin Miniprep kit (Qiagen) and cut using restriction enzymes (XhoI/XbaI for δ-ENaC, SalI/NotI for α- and γ-ENaC; Promega). Fragments were separated on 0.8% agarose gels, and bands of appropriate sizes were purified (Gelextract Mini Kit; 5Prime) and ligated (T4 Ligase, Promega) into pTNT. All plasmids were sequenced (SeqLab, Goettingen, Germany) to verify successful mutagenesis and epitope tagging.

Table 2.

Primer sequences used for site-directed mutagenesis and epitope tagging

Single nucleotide exchanges for site-directed mutagenesis are in bold type. Kozak consensus sequences are displayed in italics, and sequences coding for HA or V5 epitope tags are underlined.

Primer	Primer sequence (5′–3′)
βS540C-ENaC
Forward	ACCGCCAAGTTGCACAGGAGCCAGAC
Reverse	GTCTGGCTCCTGTGCAACTTGGGCGGT
αHA/V5-ENaC
Forward	ACTCTCGAGGCCACCATGTACCCATACGATGTTCCAGATTACGCTGAGTCCACAGAAAAAGAGAAAAAG
Reverse	AGTTCTAGATTACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCGGAAAAGGTATTTATTTCCCCATTAAA
δHA/V5-ENaC
Forward	ACTGTCGACGCCACCATGTACCCATACGATGTTCCAGATTACGCTACTAAGGAGGAGAAGAATGAG
Reverse	GAATGCGGCCGCTTACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCGTTCCTTCTACCTCCATTCTCCTCATA
γHA/V5-ENaC
Forward	ACTGTCGACGCCACCATGTACCCATACGATGTTCCAGATTACGCTTCTAAAAGTGGGAAGAAACTG
Reverse	GAATGCGGCCGCTTACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCGAGTCTTTCTACATCCTCATCAGA

Plasmids encoding δ- and α-ENaC were linearized with BamHI, and plasmids encoding γ-ENaC were linearized with NaeI (both from Promega). Plasmids containing β-ENaC were not linearized due to the presence of BamHI and NaeI restriction sites in the DNA sequence. m⁷G-capped cRNA was generated by in vitro transcription using T7 RNA polymerase (RiboMAX large-scale RNA production system, Promega) according to the manufacturer's protocol. cRNAs were diluted in diethylpyrocarbonate-treated H₂O to a final concentration of 10 ng/μl per subunit for two-electrode voltage-clamp recordings, 20 ng/μl for patch-clamp recordings, and 300 ng/μl for immunodetection. Oocytes were injected with 32 nl of cRNA and incubated for 1–2 days at 16 °C in a low-sodium CulORS (10 mm NaCl, 80 mm N-methyl d-glucamine, 1 mm KCl, 2 mm CaCl₂, 5 mm HEPES, 2.5 mm sodium pyruvate, 0.06 mm penicillin G, and 0.02 mm streptomycin sulfate at pH 7.4). Patch-clamp recordings were performed 2–7 days after injection. To inhibit the endoprotease furin, furin inhibitor I (40 μm; Cayman Chemical, Hamburg, Germany) was added to the low-sodium CulORS.

Two-electrode voltage-clamp recordings

Recording of I_M was performed as described previously (7) using a Turbo Tec-03X amplifier (NPI, Tamm, Germany). If not stated otherwise, the V_M was clamped to −60 mV, and current signals were low-pass–filtered at 1 kHz. ENaC-mediated fractions of I_M were determined with the ENaC inhibitor amiloride (100 μm; Sigma-Aldrich, Taufkirchen, Germany) and defined as amiloride-sensitive currents (ΔI_ami). Unless stated otherwise, ΔI_ami was consistently determined after the oocyte was perfused with ORS for 3 min. All recordings were performed at room temperature.

Patch-clamp recordings

Patch-clamp recordings were performed in the cell-attached configuration using mechanically devitellinized oocytes. Patch-pipettes (6–9-megaohm resistance) were pulled from borosilicate glass capillaries employing a two-stage puller, PP-83 (Narishige, Tokyo, Japan), heat-polished, and filled with pipette solution (145 mm NaCl, 1.8 mm CaCl₂, 10 mm HEPES, 2 mm MgCl₂, and 5.5 mm glucose at pH 7.4). Chlorided silver wires served as recording electrodes and were either inserted into the patch pipette or connected to the bath solution (145 mm KCl, 1.8 mm CaCl₂, 10 mm HEPES, 2 mm MgCl₂, and 5.5 mm glucose at pH 7.4) using a 1 m KCl, 3% agar bridge. Current signals were amplified using an LM-PC patch-clamp amplifier (List-Medical, Darmstadt, Germany), low-pass filtered at 100 Hz (Frequency Devices, Haverhill, IL), and recorded at 2 kHz with Axon Clampex software (Axon Instruments, Foster City, CA) using an Axon 1200 interface. Single-channel analysis was performed with Clampfit version 10.7 (Axon Instruments). The amount of channels in each recording was stochastically estimated by comparing the number of visible channels with a theoretical amount derived from binomial distribution as described previously (7).

Immunodetection of epitope-tagged ENaC subunits

Oocyte expression of HA/V5-tagged ENaCs was confirmed by measuring V_M and excluding cells with a V_M ≤ 0 mV. Using a 26-gauge needle, 20–30 oocytes were lysed in 10 μl/oocyte of lysis buffer (83 mm NaCl, 10 mm HEPES, 1 mm MgCl₂, and 1% Triton X-100 at pH 7.4) supplemented with protease inhibitors (Complete mini EDTA-free protease inhibitor mixture tablets, Roche Applied Science). Lysates were centrifuged (1500 × g, 10 min, 4 °C), and supernatants were collected, avoiding transfer of the lipid-enriched layer. Lysates were mixed with SDS protein-loading buffer (Roti-Load 1, Roth, Karlsruhe, Germany), boiled for 5 min at 95 °C, and loaded (25 μl) on 4–20% SDS-polyacrylamide gels. Some protein samples were treated with PNGase F (New England Biolabs, Frankfurt am Main, Germany) according to the manufacturer's instructions. Following separation in a tank blot system (Mini-Protean Tetra Cell, Bio-Rad, Munich, Germany), proteins were transferred onto polyvinylidene difluoride membranes. Membranes were blocked for 60 min in TBST (150 mm NaCl, 15 mm Tris-HCl, 4.6 mm Tris-base, and 1% Tween 20, pH 7.6) containing 5% skim milk at room temperature. Membranes were incubated with mouse IgG anti-HA (1:10,000; Thermo Fisher Scientific) or anti-V5 (1:5000; BioLegend, San Diego, CA) antibodies at 4 °C overnight. After washing with TBST, membranes were incubated with a peroxidase-conjugated rabbit anti-mouse IgG antibody (1:5000; Thermo Fisher Scientific) in blocking buffer for 1 h at room temperature. After washing the membranes in TBST, detection of target proteins was performed using enhanced chemiluminescence solution and photoreactive films (Amersham Biosciences Hyperfilm ECL, GE Healthcare, Freiburg, Germany). Band intensities were quantified using ImageJ (National Institutes of Health, Bethesda, MD) as described previously (15).

Detection of ENaC cleavage fragments at the cell surface

Before biotinylation, ΔI_ami was measured, and oocytes were placed back into low-sodium ORS. All biotinylation procedures were conducted on ice. Oocytes (20–30 cells/experimental group) were washed in buffer A (90 mm NaCl, 5 mm triethanolamine, 3 mm KCl, 1 mm CaCl₂, pH 8.0) before incubation in buffer A containing 1 mg/ml biotin (EZ-Link Sulfo-NHS-SS-Biotin, Thermo Fisher Scientific) for 20 min with gentle agitation. Biotinylation was quenched by incubating the cells in buffer A supplemented with 50 mm glycine for 10 min. Using a 26-gauge needle, oocytes were lysed in 1 ml of lysis buffer (90 mm NaCl, 20 mm Tris, and 1% Triton X-100, pH 7.4) containing protease inhibitors (Roche Applied Science). Lysates were vortexed (20 s) and incubated for 20 min on ice. After centrifugation (8000 × g, 10 min, 4 °C), the aqueous phase of the supernatants was collected, avoiding transfer of the lipid-enriched layer. Immobilized neutravidin-agarose beads (100 μl; Pierce) were washed with 500 μl of lysis buffer and centrifuged (1500 × g, 3 min, 4 °C). Protein samples were added to the beads and incubated with gentle agitation at 4 °C overnight. Samples were centrifuged (1500 × g, 10 min, 4 °C), and the supernatants (cytosolic fraction) were collected. The beads were washed three times with 500 μl of lysis buffer (1500 × g, 3 min, 4 °C) and three times with 500 μl of lysis buffer supplemented with 300 mm NaCl (1500 × g, 3 min, 4 °C). Beads were transferred into 100 μl of 2× SDS protein-loading buffer (Roti-Load 1, Roth), boiled at 95 °C for 5 min, and loaded (25 μl) on 4–20% gradient SDS gels. Immunoblots were performed as described above. Proper fractionation of cytosolic and membrane proteins was confirmed by reprobing membranes with rabbit polyclonal anti-pan-actin antibody (1:1000; Cytoskeleton, Denver, CO) in TBST at 4 °C overnight and a peroxidase-conjugated goat anti-rabbit IgG antibody (1:3000; Cell Signaling, Danvers, MA) in blocking buffer for 1 h at room temperature.

Data evaluation

Data are presented in scatter plots with lines and error bars representing mean ± S.E. Oocytes for each experiment were derived from at least three different donors, and the number of individual experiments is noted in parentheses. Immunoblots are representative of at least three independent experiments. Statistical analyses were performed using GraphPad Prism version 7 (GraphPad Software Inc., La Jolla, CA). Gaussian distribution of individual data was assessed with the D'Agostino and Pearson omnibus normality test. Normally distributed data were analyzed by Student's unpaired t test (two-tailed). A Welch's correction was additionally performed if variances were different. Data that did not follow Gaussian distribution were compared using the Mann–Whitney U test (two-tailed). Multiple groups were compared by one-way ANOVA followed by a post hoc Tukey's multiple-comparison test (two-tailed) for normally distributed data or a Kruskal–Wallis test followed by Dunn's multiple-comparison test (two-tailed) for data not following Gaussian distribution. A p value ≤ 0.05 was considered significant. All graphics were assembled and finalized using Inkscape.

Author contributions

L. W. and M. A. conceptualization; L. W. and K. S. V. formal analysis; L. W. validation; L. W., K. S. V., and A. P. investigation; L. W. visualization; L. W., K. S. V., and M. A. methodology; L. W. and M. A. writing-original draft; L. W., K. S. V., A. P., I. M., and M. A. writing-review and editing; I. M. and M. A. resources; M. A. supervision; M. A. funding acquisition; M. A. project administration.