Comparative Immune- and Stress-Related Transcript Response Induced by Air Exposure and Vibrio anguillarum Bacterin in Rainbow Trout (Oncorhynchus mykiss) and Gilthead Seabream (Sparus aurata) Mucosal Surfaces

Ali Reza Khansari; Joan Carles Balasch; Eva Vallejos-Vidal; David Parra; Felipe E Reyes-López; Lluís Tort

doi:10.3389/fimmu.2018.00856

. 2018 May 2;9:856. doi: 10.3389/fimmu.2018.00856

Comparative Immune- and Stress-Related Transcript Response Induced by Air Exposure and Vibrio anguillarum Bacterin in Rainbow Trout (Oncorhynchus mykiss) and Gilthead Seabream (Sparus aurata) Mucosal Surfaces

Ali Reza Khansari ^1,^†, Joan Carles Balasch ^1,^†, Eva Vallejos-Vidal ¹, David Parra ¹, Felipe E Reyes-López ^1,^*, Lluís Tort ^1,^*

PMCID: PMC5940744 PMID: 29770134

Abstract

Fish have to face various environmental challenges that may compromise the efficacy of the immune response in mucosal surfaces. Since the effect of acute stress on mucosal barriers in fish has still not been fully elucidated, we aimed to compare the short-term mucosal stress and immune transcriptomic responses in a freshwater (rainbow trout, Oncorhynchus mykiss) and a marine fish (gilthead seabream, Sparus aurata) to bacterial immersion (Vibrio anguillarum bacterin vaccine) and air exposure stress in skin, gills, and intestine. Air exposure and combined (vaccine + air) stressors exposure were found to be inducers of the cortisol secretion in plasma and skin mucus on both species in a time-dependent manner, while V. anguillarum bacterin exposure induced cortisol release in trout skin mucus only. This was coincident with a marked differential increase in transcriptomic patterns of stress- and immune-related gene expression profiles. Particularly in seabream skin, the expression of cytokines was markedly enhanced, whereas in gills the response was mainly suppressed. In rainbow trout gut, both air exposure and vaccine stimulated the transcriptomic response, whereas in seabream, stress and immune responses were mainly induced by air exposure. Therefore, our comparative survey on the transcriptomic mucosal responses demonstrates that skin and gut were generally more reactive in both species. However, the upregulation of immune transcripts was more pronounced in gills and gut of vaccinated trout, whereas seabream appeared to be more stress-prone and less responsive to V. anguillarum bacterin in gills and gut. When fish were subjected to both treatments no definite pattern was observed. Overall, the results indicate that (1) the immune response was not homogeneous among mucosae (2), it was greatly influenced by the specific traits of each stressor in each surface and (3) was highly species-specific, probably as a result of the adaptive life story of each species to the microbial load and environmental characteristics of their respective natural habitats.

Keywords: mucosal immunity, cortisol, gene expression, skin, gills, gut

Introduction

Fish are living in a microbial-loaded environment involving an intense interaction of their mucosal surfaces with microbiota and therefore various immune responses in these surfaces. The diversity of the potential environmental or imposed stressors (i.e., changes in temperature, photoperiod, pH, oxygen saturation, population density, pathogen load, and virulence) biases the efficacy and time course of the mucosal immune responses in a species-specific manner (1–4). Thus, defensive responses in fish show great interspecific diversity and agglutinate the mucosal-associated structures in a common mucosal immunity framework (5, 6). When interacting with mucosal interfaces, exogenous bacteria and viruses skew the immune responsiveness depending on each surface. Pathogens, such as Vibrio anguillarum, are able to adhere preferentially to fish integument (7), modifying the thickness, quality, and secretory pattern of skin immune defenses which, in turn, vary depending on the interspecific susceptibility to diseases, pathogen virulence, and environmental toxicity (8).

The mucosal-associated lymphoid tissues (MALTs) comprise the skin-associated lymphoid tissue (SALT), the gill-associated lymphoid tissue (GIALT), the gut-associated lymphoid tissue (GALT), and the recently described nasopharynx-associated lymphoid tissue. Common features of these MALTs resemble those of mammals and include the following: (i) a copious mucus layer that actively barriers pathogen adherence and agglutinates (9); (ii) secreted antimicrobial proteins (such as lysozyme, lectins, complement proteins, histones, and defensins), antibodies (igm and igt/z isotypes), immune mediators (cytokines and chemokines), and enzymatic disruptors (mainly proteases, peroxidases, and phosphatases); and (iii) interposed myeloid and lymphoid immune cells (including mast cells, dendritic-like cells, macrophages, neutrophils, and B and T lymphocyte families), natural killer cells (NK/NCC-like), epithelial phagocytic cells, and immune-associated cells such as thrombocytes and erythrocytes (6, 8, 10–12).

Skin-associated lymphoid tissue is the largest and most functionally diverse mucosal surface. Teleost skin is an extensive metabolically active non-keratinized multilayered integument that produces a complex glycoprotein-based mucus cuticle (8, 13) and also plays a crucial role in communication, sensory perception, locomotion, respiration, and osmoregulation (14, 15). Fish SALT harbors a more diverse repertoire of innate humoral components than the mammalian one, including bacteriolytic molecules such as lysozyme, complement components, lectins, proteolytic enzymes, C-reactive protein, interferons, and immunoglobulins (16). A whole cast of resident leukocyte families complete the immunological properties of SALT (8). The GIALT system is highly similar to that of skin and consists of interposed mucus-secreting cells, antimicrobial peptides, and resident leukocyte populations (11). Fish GALT lacks the mammalian Peyer’s patches, but presents intraepithelial lymphocytes that include T cells and some B cells located among epithelial cells. M-cell analogs and dendritic-like cells have also been described, as well as plasma cells, granulocytes, macrophages, and neuroendocrine cells inhabiting the epithelium or distributed in the lamina propria (17, 18). All these plethora of resources enable fish to defend from external agents, although it is not yet known how cells from gut recognize pathogenic bacteria among the commensal ones. But, if fish did not have this recognition system, the immune response in intestine would be active all the time because there are millions of commensals interacting with the epithelial cells.

Environmental or aquaculture-related insults couple the mucosal defensive reactivity with the activation of fish hypothalamic–pituitary–interrenal (HPI) and sympathoadrenomedullary (SAM) stress axis (19). As in the case of mucosal immune system, fish react differently depending on the stressor and the influence of the immune response on survival remains species specific (20). Plasmatic cortisol is a well-known indicator of stress situation experienced by fish (21) and also a recurrent mediator of bidirectional immunoendocrine regulation (22). In acute stressed fish, cortisol is secreted within several minutes up to 1 h into circulation (23). The release of cortisol from the head kidney modulates the leukocyte-mediated response and negotiates the onset, lag, and efficacy of immune reactivity. This may influence the mucous adherence and virulence of some pathogens (24) and may destabilize the host–microbiota interaction in favor of opportunistic pathogens (17). Little is known about the mechanisms of cortisol secretion in the mucosal tissues, but it has been suggested that cortisol levels in skin mucus correlate with those of plasma (24, 25) and may modulate specific tissue receptors and cytokine expression in mucosae (26). In this way, it has been reported that the stress-mediated increment of mucus-producing cells in mucosal surfaces induced a reduction in the number of parasites in mucosae (6, 27). Thus, fish mucosal barriers are thought to act as sensors playing a significant role in monitoring stress.

Thus far, the effects of stress on the immune system have been described mainly in systemic compartments including blood, head kidney, liver, and spleen. From these results, it has been implicitly assumed that the physiological stress response is similar among different fish species (21, 28). Moreover, little attention has been paid on the interaction and cross-modulatory effects between endocrine and immune systems among different fish species under stress situations. In fact, it has been recently reported that the combination of stress hormones and pathogen antigens could differentially induce a species-specific response (29). On the other hand, at the local response level, few studies have addressed the effects of stressful stimuli on the fish mucosal immune system. To date, several investigations have focused on the acute (25) and chronic (30) stress effects in mucosal tissues, but no study has elucidated the modulatory effect of different types of stressors (biotic, abiotic, and the combination of them) on mucosal tissues.

Although most fish show a generalized stress reaction via activation of primary and secondary responses (31), there is a specificity on the pattern and magnitude of the response that may be affected by not only environmental factors (such as temperature and salinity) but also the nature of the stressor. Our hypothesis was that fish respond qualitatively similar to stressors but that this response can be significantly modulated by both genetic background and environmental conditions. Therefore, we focused our work in the differential response between the two species.

In this study, we describe the short-term (1, 6, and 24 h) effect of a biotic stressor (V. anguillarum bacterin bath), an abiotic stressor (air exposure), and the combination of both stressors in physiological indicators (plasmatic and skin mucus cortisol) and SALT, GIALT, and GALT mRNA abundance (stress- and immune-related genes). These treatments were selected as similar handling procedures may be also often present when fish are subjected to vaccination in the aquaculture industry. This study was carried out using two commercial relevant species that inhabit in two distinct milieu: rainbow trout (Oncorhynchus mykiss; a freshwater teleost) and gilthead seabream (Sparus aurata; marine teleost). We aimed not only to clarify the role of mucosal immunity in the overall immune response of these two species under stress situations but also to show how the mucosae of aquatic vertebrates react to stressors of different nature.

Materials and Methods

Experimental Animals

Juveniles of rainbow trout (mean weight: 130 g) and gilthead seabream (mean weight: 65 g) were obtained from local fish farms (TroutFactory and Aquicultura els Alfacs, Spain) and acclimatized for 3 weeks at the Universitat Autònoma de Barcelona fish facility (AQUA-UAB) in conic tanks (2.0 m³ total capacity) with water pump, recirculating chiller cooling system, sand filter, and biofilter. Fish were maintained at a photoperiod of 12L:12D and at their respective environmental temperature (15°C for trout; 20°C for seabream). Fish were fed a commercial pellet (Skretting) at 1.5% of total body weight/day. Water quality indicators (dissolved oxygen, ammonia, nitrite, and pH) were analyzed periodically. These conditions were maintained also for the experimental tanks. The experiment complied with the Guiding Principles for Biomedical Research Involving Animals (EU2010/63), the guidelines of the Spanish laws (law 32/2007 and RD 53/2013), and authorized by the Ethical Committee of the Universitat Autònoma de Barcelona (Spain) for the use of laboratory animals.

V. anguillarum Bacterin

An inactivated, formalin-killed V. anguillarum, serotype O1, O2α (the most pathogenic serogroup), and O2β, all with relative percentage survival ≥ 60% (Icthiovac^® VR, Hipra) was utilized as a source of antigen.

Experimental Design

For the experiment, fish were placed in 300 l conic tanks with the closed recirculating system provided with water pump, sand filter, and biofilter. The temperature (15°C for trout; 20°C for seabream) and photoperiod (12L:12D) were set accordingly. Fish were divided into three groups and maintained in eight independent tanks. (1) Vaccinated (v) group: 48 fish were vaccinated by immersion (1 min) with formalin-killed V. anguillarum bacterin according to manufacturer’s instructions (Hipra). Immediately after, fish were rinsed in a cleaned water cube to discard the vaccine excess. Fish were then equally distributed (n = 12) in four tanks, avoiding cross-contamination for vaccine. (2) Vaccinated and stressed (v + s) group: 24 h after vaccination, 24 fish randomly selected from the vaccinated group were stressed (acute air exposure stress, 1 min) and returned to two separated tanks. (3) Stressed (s) group: 24 non-vaccinated fish were maintained out of water, stressed (acute air exposure stress, 1 min), and returned to two separated tanks. Control fish (n = 24) were mock-vaccinated (water vaccine-free immersion) in the same conditions as the vaccinated group, returned to two different separated tanks, and sampled after 24 h. Concerning time course utilized for the vaccine group, it should be stated that the preliminary data did not show any effect of vaccine immersion after 1 h and 12 h post vaccine (hpv) (data not shown). Therefore, we decided to begin sampling 24 h after bath vaccination. “Time 0” for vaccinated and vaccine + stress groups represents 24 hpv, whereas in the stress group represents the initial point of the experiment. Fish (n = 8) were randomly sampled from the two separated tanks per treatment at 1, 6, and 24 h post-stress (air exposure) from each experimental group (control, v, v + s, and s) and sacrificed by overanesthetization in MS222 (200 mg/l).

Skin and Tissue Sampling

Rainbow trout and gilthead seabream skin mucus was sampled according to Xu et al. (32). After blood sampling, skin tissue samples (upper lateral line area behind the dorsal fin, left side, and roughly same size) were carefully taken to avoid muscle contamination. Gills (first lamella from both sides) were also sampled. For gut analysis, the body cavity was opened laterally, and midgut and hindgut were removed using a sterile scalpel and forceps. These harvested intestine sections were open longitudinally and feces and mucus carefully removed with forceps. Samples from all fish were immediately frozen in liquid nitrogen and stored at −80°C for further assays.

Quantification of Cortisol in Plasma and Skin Mucus

Cortisol level was measured by radioimmunoassay (33), and the radioactivity was quantified using a liquid scintillation counter (Scintillation Counter Wallac 1409; PerkinElmer). Anti-cortisol antibody was used for the assay at the final dilution of 1:4,500. Antibody cross-reactivity with cortisol was 100%, and the lower detection limit of the assay was 0.16 ng/ml. Cross-reactivity with other steroid hormones varied from 1.6% for corticosterone and was inferior to 0.7% for other tested steroids.

IgM Detection in Skin Mucus

Levels of IgM in rainbow trout and gilthead seabream skin mucus at 1, 6, and 24 h post-stress were determined by ELISA according to Cuesta et al with modifications (34). Rainbow trout skin mucus samples were 1/4 diluted in PBS + 10 mM EDTA. 50 µl/well was added and incubated at 4°C onto Maxisorp microplates (Thermo Fisher Scientific) in duplicate. The unbound antigen was removed by washing twice with 200 µl/well of PBS. Possible sites with no antigen bound were blocked with 100 µl/well non-fat milk 5% in PBS for 1 h at room temperature (RT) and washed twice with PBS. Antibody mouse anti-trout IgM 1.14 mAb (1/1,000 dilution in PBS) and anti-seabream IgM mAb (1/100 dilution in PBS determined by Western blot) (Aquatic Diagnostics Ltd., UK) were used as primary antibodies to detect the presence of IgM on skin mucus. Samples were incubated with 50 µl/well of primary antibody for 1 h at RT, followed by three times washing with 200 µl washing buffer (PBS + 0.15% Tween 20). Samples were incubated with 50 µl/well of goat-anti-mouse IgG conjugated with HRP (1/4,000 dilution in PBS). The microplate was washed five times with 200 µl/well of washing buffer, and 50 µl/well of Ultra-TMB (3,3′,5,5′-tetrametilbenzidine; Thermo Fisher Scientific) was added as a substrate. After incubation for 7 min at RT, 50 µl/well of H₂SO₄ (2 M) was added as stop solution and absorbance was determined at 450 (0.1 s) nm with a microplate reader (Victor3; Perkin Elmer). All samples were evaluated in duplicated.

Isolation of RNA and cDNA Synthesis

Total RNA was isolated from individual fish samples using TRI reagent (Sigma) according to manufacturer’s instructions. The RNA pellet was dissolved in autoclaved milli Q-water and immediately stored at −80°C until use. The RNA concentration was quantified by a NanoDropND-2000 spectrophotometer (Thermo Fisher Scientific). Total RNA (2 µg) was used as a template to synthesize cDNA using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems) according to manufacturer’s instructions and immediately stored at −20°C until use.

Quantitative Real-Time PCR

Fish mucosal samples including skin, gills, and gut were analyzed using real-time PCR. The analysis included the evaluation of stress and immune-related genes (lysozyme, c3, igm, hsp70, cox2, il1β, tnfα, il6, tgfβ1, and il10). We tested several housekeeping candidate genes in rainbow trout (ef1α and βactin) and seabream (18s, ef1α, and rpl27) to elucidate which one had less variation. β-Actin (for rainbow trout) and 18s (for seabream) were included on gene expression analysis. Specific primers used for rainbow trout (Table 1) and gilthead seabream (Table 2) are indicated. Primers were designed with Primer-Blast. The primer secondary structure and annealing specificity was checked with OligoAnalyzer (version 3.1) and Primer-Blast software, respectively. The undesirable PCR products appearance was previously verified by single peak in the melting curve for each primer set. The primer amplification efficiency was determined in all mucosal surfaces included in our study. Real-time PCR reactions were performed with iTaq universal sybr green supermix (Bio-Rad Laboratories) using 1:20 and 1:10 cDNA dilution made for genes of interest in rainbow trout and gilthead seabream, respectively. Primers for all genes were used at a final concentration of 500 nM. The thermal conditions used were 3 min at 95°C of pre-incubation followed by 40 cycles at 95°C for 30 s and 60°C for 30 s. All the reactions were performed in duplicate using CFX384 Touch Real-Time PCR Detection System (Bio-Rad Laboratories). Quantification was done according to the Pfaffl method (35) corrected for efficiency of each primer set obtained for each mucosal surface evaluated. Values for each experimental condition were expressed as normalized relative expression against those of the housekeeping gene β-actin and 18s for rainbow trout and seabream, respectively. Results are expressed as average of values obtained for the same treatment and time points evaluated.

Table 1.

Primers used for gene expression analysis in rainbow trout.

Gene	GenBank accession number	Sequence 5′–3′	Product size	Primer efficiency
βactin	NM_001124235.1	FW: GGACTTTGAGCAGGAGATGG	186	1.96
		RV: ATGATGGAGTTGTAGGTGGTCT

lys	X59491	FW: TGCCTGTCAAAATGGGAGTC	211	1.89
		RV: CAGCGGATACCACAGACGTT

c3	L24433	FW: GAGATGGCCTCCAAGAAGATAGAA	91	1.96
		RV: ACCGCATGTACGCATCATCA

igm	S63348.1	FW: AAGAAAGCCTACAAGAGGGAGA	157	1.85
		RV: CGTCAACAAGCCAAGCCACTA

hsp70	AB176854	FW: CGGGAGTTGTAGCGATGAGA	140	2.01
		RV: CTTCCTAAATAGCACTGAGCCATAA

cox2	NM_001124348.1	FW: AGCACTTCACCCACCAGTTC	180	1.85
		RV: GGTAGACCTCGCCGTTCAAA

il1β	NM_001124347.2	FW: TGAGAACAAGTGCTGGGTCC	148	1.92
		RV: GGCTACAGGTCTGGCTTCAG

tnfα	NM_001124357.1	FW: CACACTGGGCTCTTCTTCGT	155	1.88
		RV: CAAACTGACCTTACCCCGCT

il6	NM_001124657.1	FW: GAGTTTCAGAAGCCCGTGGA	149	2.04
		RV: AGCTGGTACACTTGCAGACC

tgfβ1	NM_001281366.1	FW: GCCAAGGAGGTCCACAAGTT	146	1.94
		RV: GTGGTTTTGATGAGCAGGCG

il10	NM_001245099.1	FW: CCGCCATGAACAACAGAACA	105	1.91
		RV: TCCTGCATTGGACGATCTCT

Open in a new tab

Table 2.

Primers used for gene expression analysis in gilthead seabream.

Gene	GenBank accession number	Sequence 5′–3′	Product size	Primer efficiency

18s	AY587263.1	FW: ACCAGACAAATCGCTCCACC	172	2.02
		RV: AGGAATTGACGGAAGGGCAC

lys	AM749959.1	FW: TCATCGCTGCCATCATCTCC	154	2.08
		RV: TGTTCCTCACTGTCCCATGC

c3	HM543456.1	FW: GTTCCACAACAACCCACAGC	183	1.91
		RV: ACATACGCCATCCCATCCAC

igm	JQ811851.1	FW: GATCGTGACATCGTCTGAGG	187	1.91
		RV: TGTTGGGTTGTGGTTGTAGG

hsp70	EU805481.1	FW: AGGTTGGGTCTGAAAGGAAC	174	1.96
		RV: TGAACTCTGCGATGAAGTGG

cox2	AM296029.1	FW: GAGTACTGGAAGCCGAGCAC	192	1.89
		RV: GATATCACTGCCGCCTGAGT

il1β	AJ277166.2	FW: TCAGCACCGCAGAAGAAAAC	115	1.97
		RV: TAACACTCTCCACCCTCCAC

tnfα	AJ413189.2	FW: TCGTTCAGAGTCTCCTGCAG	320	2.24
		RV: AAGAATTCTTAAAGTGCAAACACACCAAA

il6	EU244588.1	FW: ATCCCCTCACTTCCAGCAGA	129	1.86
		RV: GCTCTTCGGCTCCTCTTTCT

tgfβ1	AF424703.1	FW: AGACCCTTCAGAACTGGCTC	145	1.90
		RV: ACTGCTTTGTCTCCCCTACC

il10	JX976621.1	FW: GAGCGTGGAGGAATCTTTCAA	154	2.02
		RV: GATCTGCTGGATGGACTGC

Open in a new tab

Statistical Analysis

The statistical package for social science (SPSS, v20) software was used for the analysis. The Generalized Linear Model was utilized considering the stressors and time dynamics as a two between-subjects factor. This model is a more flexible statistical tool than the standard general linear model in terms of types of distribution and different covariance structure of the repeated measures, does not require homogeneity of variance, and it admits missing values. After the main analysis, appropriate pair-wise comparisons were carried out. Differences in all data were considered statistically significant if p-values < 0.05 among groups.

Results

Plasmatic and Skin Mucus Cortisol Level

In order to evaluate whether the application of air exposure, V. anguillarum bacterin, or the combination of both stressors induce a stress response systemic (plasmatic) and local (skin mucus), cortisol levels were evaluated. In trout, plasmatic cortisol levels augmented after air exposure (126.32 ng/ml) 1 h post-stress (Figure 1A; red line) and decreased at 6 h post-stress (49.57 ng/ml). The highest cortisol concentration was registered in the vaccine + air exposure group (159.85 ng/ml) at 1 h post-stress (Figure 1A; orange line). A slight decrease, although still higher than the control group, was also observed at 6 h post-stress in the vaccine + air exposure group (135.40 ng/ml). In the vaccinated group, no variations were registered on plasma cortisol (Figure 1A; blue line).

Cortisol and IgM levels on biotic (*Vibrio anguillarum* bacterin), abiotic (air exposure), or the combination of both stressors (vaccine + air exposure) at 1, 6, and 24 h post-stress. **(A)** Rainbow trout plasmatic cortisol (ng/ml). **(B)** Rainbow trout skin mucus (ng/ml) cortisol. **(C)** Gilthead seabream plasmatic cortisol. **(D)** Gilthead seabream skin mucus cortisol. **(E)** Total IgM (Abs 450) in rainbow trout (left side) and seabream (right side). Different colors indicate different treatments: red (air exposure), orange (vaccine + air exposure), blue (vaccine), and gray (ctrl; control). Time zero represents the end of the acute air exposure stress (for the air exposure and the vaccine + air exposure) or 24 h after bath vaccination (for vaccine group). Data are represented as mean ± SE (n = 8 per sampling time point). Significant differences are indicated by lower case in the air exposure group, by upper case in the vaccine + air exposure group, and by numbers in the vaccine group. Asterisk (*) indicates significant difference of each treatment versus control (p < 0.05).

The same secretion pattern was observed in skin mucus in the air exposure group. Cortisol levels augmented at 1 h post-stress (2.41 ng/ml), diminished at 6 h post-stress (1.34 ng/ml), and returned to control level at 24 h post-stress (0.20 ng/ml) (Figure 1B; red line). In the vaccine + air exposure group, an increase in cortisol was only observed at 6 h post-stress (1.99 ng/ml) (Figure 1B; orange line). In the vaccinated group, cortisol was significantly increased at 1 h post-stress (1.48 ng/ml) (25 h after vaccination) and recovered baseline values at 24 h post-stress (48 h after vaccination) (Figure 1B; blue line).

In gilthead seabream, the secretion patterns were similar but differed in magnitude. Significantly elevated plasma cortisol levels at 1 h post-stress (228.18 ng/ml) (Figure 1C; red line) were detected in the air exposure group, decreased at 6 h post-stress (96.40 ng/ml) and dropped to control levels at 24 h post-stress (25.71 ng/ml). In the vaccinated + air exposure group, the cortisol values were higher than control at 1 h (144.08 ng/ml) and 6 h (113.30 ng/ml) but not at 24 h post-stress (61.0 ng/ml) (Figure 1C; orange line). The vaccinated seabream group showed no variations (Figure 1C; blue line).

Cortisol levels in seabream skin mucus differed from those observed in trout skin mucus. High cortisol levels (1.89 ng/ml) were registered in the air exposure group at 1 h post-stress (Figure 1D; red line) and doubled at 6 h post-stress (3.91 ng/ml). In the vaccinated + air exposure group, cortisol levels augmented at 1 h (1.43 ng/ml) and 6 h post-stress (1.18 ng/ml) (Figure 1D; orange line). No significant variations were observed in the vaccinated group (Figure 1D; blue line).

The differences noted between trout and seabream skin mucus were also observed when the total amount of IgM was determined by ELISA. In trout skin mucus, the levels of IgM showed no variations after the different treatments (Figure 1E; left half). However, in seabream the levels of IgM in the air exposure group increased gradually, reaching a peak at 24 h post-stress (Abs₄₅₀ = 0.25) compared to control (Figure 1E; right half). This augment was also registered at 24 h post-stress in the vaccinated + air exposure group (Abs₄₅₀ = 0.17) (Figure 1E; right half).

Thus, our results indicate that the release of the glucocorticoid hormone in response to stressor depends on the stressor, the biological matrix (plasma or mucus), and is species dependent.

SALT Responses

mRNA expression levels were used to examine whether the air exposure as well as V. anguillarum were able to drive differences in the transcriptomic responses of stress and immune-related genes in MALTs: skin, gills, and gut. Our results show an overall significant interaction between treatment and time course at 1, 6, and 24 h post-stress in both species. In rainbow trout (Figure 2A), air exposure was able to enhance the transcription of il1β, cox2, and lysozyme in a time-dependent manner. The vaccine + air exposure treatment promoted the upregulation of genes associated with immunity and stress responses (c3, igm, hsp70, and cox2) at 1 h post-stress. The expression of pro-inflammatory transcripts (il1β) was also upregulated. The same effect was also observed at 6 h post-stress for il1β but not for cox2. No modulation was observed at 1 h post-stress in gene transcripts associated with anti-inflammatory responses (il10 and tgfβ1). However, the upregulation of tgfβ1 was only observed at 6 and 24 h post-stress in the vaccinated group, probably linked with the upregulation also observed for lysozyme, c3, cox2, and hsp70. Overall, all genes showed a marked upregulation in a treatment- and time-independent manner.

Gene expression level in skin-associated lymphoid tissue (SALT) after a biotic (*Vibrio anguillarum* bacterin), abiotic (air exposure), or the combination of both stressors (vaccine + air exposure) at 1, 6, and 24 h post-stress. Quantitative real-time PCR quantification of specific mRNA immune and stress transcripts (*lysozyme, c3, igm, hsp70, cox2, Il1β, tnfα, il6, tgfβ1*, and *il10*) in **(A)** rainbow trout and **(B)** gilthead seabream skin. **(C)** Integrative comparison of SALT transcriptomic responses. *β-Actin* and *18s* were chosen as housekeeping genes in rainbow trout and gilthead seabream, respectively. Different colors indicate different treatments: red (air exposure), orange (vaccine + air exposure), blue (vaccine), and gray (ctrl). Time zero represents the end of the acute air exposure stress (for the air exposure and the vaccine + air exposure) or 24 h after bath vaccination (for vaccine group). Data are represented as mean ± SE (n = 8 per sampling time point). Significant differences are indicated by lower case in the air exposure group, by upper case in the vaccine + air exposure group, and by numbers in the vaccine group. Asterisk (*) indicates significant difference of each treatment versus control (p < 0.05).

In gilthead seabream (Figure 2B), air exposure was found to induce pro-inflammatory cytokine transcripts (il1β and il6), cox2, and also lysozyme at 24 h post-stress. The upregulation of genes in the vaccine + air exposure group was also observed, though the magnitude and time course of this modulation was shown to be different compared to rainbow trout. A high and decreasing expression from 1 h post-stress to 24 h post-stress in hsp70 and lysozyme was reported. The same expression pattern was observed for tgfβ1. An increased gene expression at 6 h post-stress was noted for il1β, il6, tnfα, cox2, and igm. The upregulation of il10 was modulated in the same manner. An increase in a time-dependent manner was registered only for c3. Importantly, this upregulation in the vaccine + air exposure group seems to be influenced by air exposure and vaccine separately. Only in the cases of il1β and il6, the effect observed in the vaccine + air exposure group could be markedly associated with the expression registered in the air exposure group and vaccinated group, respectively. Importantly, V. anguillarum bacterin was able to induce expression of il6, tnfα, tgfβ1, hsp70, cox2, and c3 mainly at 24 h post-stress.

In summary, a lower gene expression magnitude was observed in rainbow trout than in seabream (Figure 2C). In contrast to rainbow trout response, the gene expression data suggest a higher influence of the air exposure stressor and the combination of both stimuli in gilthead seabream. The similar expression of lysozyme, hsp70, and tgfβ1 suggests that the anti-inflammatory cytokine response could modulate the expression of these immune-related genes in both species when stressed.

GIALT Responses

Gills showed a different gene expression pattern when comparing both fish species. In trout (Figure 3A), the gene transcript modulation in the air exposure group was observed at 6 h post-stress in pro- (il1β and tnfα), anti-inflammatory genes (il10 and tgfβ1), and cox2. Particularly, the downregulatory tendency was observed in the air exposure group and the vaccine + air exposure group at 1 h post-stress, suggesting that the stress by air exposure could influence the early post-stress expression of trout transcripts. In the vaccinated group, the expression of il1β and cox-2, lysozyme, and igm were observed at 1 h post-stress. At 6 h post-stress, the expression levels of il6 and hsp70 were also modulated. Importantly, il10 was also upregulated at 6 h post-stress, suggesting that its modulation could be related to the control of the pro-inflammatory gene expression profile. This suggests that air exposure and vaccine alone had a stronger effect on gene expression in trout.

Gene expression level in gill-associated lymphoid tissue (GIALT) after a biotic (*Vibrio anguillarum* bacterin), abiotic (air exposure), or the combination of both stressors (vaccine + air exposure) at 1, 6, and 24 h post-stress. Quantitative real-time PCR quantification of specific mRNA immune and stress transcripts (*lysozyme, c3, igm, hsp70, cox2, Il1β, tnfα, il6, tgfβ1*, and *il10*) in **(A)** rainbow trout and **(B)** gilthead seabream gills. **(C)** Integrative comparison of GIALT transcriptomic responses. *β-Actin* and *18s* were chosen as housekeeping genes in rainbow trout and gilthead seabream, respectively. Different colors indicate different treatments: red (air exposure), orange (vaccine + air exposure), blue (vaccine), and gray (ctrl; control). Time zero represents the end of the acute air exposure stress (for the air exposure and the vaccine + air exposure) or 24 h after bath vaccination (for vaccine group). Data are represented as mean ± SE (n = 8 per sampling time point). Significant differences are indicated by lower case in the air exposure group, by upper case in the vaccine + air exposure group, and by numbers in the vaccine group. Asterisk (*) indicates significant difference of each treatment versus control (p < 0.05).

In seabream (Figure 3B), a marked upregulation of the expression of il1β, tnfα, cox2, lysozyme, and c3 was registered both at 1 and 6 h post-stress and after vaccine + air exposure. The upregulation of cox2 (1 h post-stress) and il1β (6 h post-stress) suggests a specific gene expression effect of air exposure in seabream. The downregulation of several genes in the air exposure and vaccinated groups suggests that the stress stimuli including air exposure and V. anguillarum bacterin alone may suppress seabream immune response in gills.

Our results indicate that, aside from the increase in few genes in the gills of rainbow trout and seabream, both stressors separately induce immune suppression or a tendency to reduce immune and stress gene transcription in the gills (Figure 3C).

GALT Responses

Transcriptomic profile analysis of both species showed that air exposure modulated the immune- and stress-related gene expression transcripts in gut. In trout (Figure 4A), the upregulation of gene transcripts involved in regulatory responses (lysozyme, c3, il1β, tnfα, tgfβ1, cox2, and igm) was observed at 1 h post-stress indicating that, in gut, air exposure induces the upregulation of immune-related genes in trout earlier than in seabream. The same modulation of the pro-inflammatory genes (il1β and tnfα) was also observed in trout at 1 h post-stress in the vaccine + air exposure group, suggesting that this response could be directly influenced by the air exposure at the same time-point. il1β, tnfα, tgfβ1, c3, and lysozyme were upregulated in the vaccinated group after 6 h post-stress, cox2 after 24 h post-stress, and igm remained downregulated.

Gene expression level in gut-associated lymphoid tissue (GALT) after a biotic (*Vibrio anguillarum* bacterin), abiotic (air exposure), or the combination of both stressors (vaccine + air exposure) at 1, 6, and 24 h post-stress. Quantitative real-time PCR quantification of specific mRNA immune and stress transcripts (*lysozyme, c3, igm, hsp70, cox2, Il1β, tnfα, il6, tgfβ1*, and *il10*) in **(A)** rainbow trout and **(B)** gilthead seabream. **(C)** Integrative comparison of GALT transcriptomic responses. *β-Actin* and *18s* were chosen as housekeeping genes in rainbow trout and gilthead seabream, respectively. Different colors indicate different treatments: red (air exposure), orange (vaccine + air exposure), blue (vaccine), and gray (ctrl; control). Time zero represents the end of the acute air exposure stress (for the air exposure and the vaccine + air exposure) or 24 h after bath vaccination (for vaccine group). Data are represented as mean ± SE (n = 8 per sampling time point). Significant differences are indicated by lower case in the air exposure group, by upper case in the vaccine + air exposure group, and by numbers in the vaccine group. Asterisk (*) indicates significant difference of each treatment versus control (p < 0.05).

Interestingly, in seabream gut (Figure 4B), the larger alteration was induced mainly by air exposure. The transcriptional level of immune and stress regulators (il1β, il6, tnfα, il10, tgfβ1, cox2, hsp70, lysozyme, c3, and igm) was enhanced at 6 h post-stress, indicating a higher sensitivity of this specie to air exposure. Our results suggest that in gut the air exposure stress promotes a roughly similar immune-related gene expression modulation in both species although in a different magnitude and time-dependent manner (Figure 4C).

Taken together, the results show that both stressors modulate the SALT, GIALT, and GALT transcriptomic response, but such response depends on the nature of the stressor, time, and the species concerned.

Discussion

In this study, we aimed to evaluate the isolated and combined effects of a biotic (V. anguillarum bacterin bath) stressor and abiotic (air exposure) on SALT, GIALT, and GALT of two different species, trout and seabream. To do so, we analyzed the gene expression patterns of several relevant stress- and immune-related transcripts (lysozyme, c3, igm, hsp70, cox2, Il1β, tnfα, il6, il10, and tgfβ1) and plasmatic and mucosal (skin mucus) cortisol levels. Overall, our results indicate that short-term stressors modify plasma and skin cortisol levels and regulate the transcriptomic response of several immune mediators at mucosal surfaces in both species. The observed changes suggest that stress disturbs the mucosal tissue and mainly enhances the mucosal immune response in a pronounced species-specific manner. Contrary to the notion that stress suppresses the immune response, we clearly show that under certain conditions, particularly short-term disturbances, stress can activate mucosal immune function.