Abstract
Sus Scrofa microRNA-146b-5p (ssc-miR-146b) was found to be one of differentially expressional microRNAs (miRNA) in our previous study. Not only it is highly expressed but also it maintains the largest up-regulated differences on the expressional level at different time points in the small intestinal mucosa of weaned piglets. To further explore the regulation mechanism of microRNA-146b-5p (miR-146b) during the stressful progress in weaned piglets, the present study predicted the functions of the ssc-miR-146b upstream promoter region using biological analysis. The analytical results showed that ssc-miR-146b is an intergenic miRNA. The length of the promoter region of ssc-miR-146b was predicted to be 2,249 bp using the Ensemble database. The length of the CpG island in the ssc-miR-146b promoter region was found to be 167 bp and it was located from 464 to 630 bp. Twenty six binding sites of 9 transcription factors in the upstream promoter region, including the sites of genes such as Sp1, AP-1, MyoD, GATA etc, were discovered using different kinds of analytical software. The predictions of the CpG island and transcription factor binding sites provided significant information for further studying the transcriptional regulation mechanism of ssc-miR-146b on the small intestinal injury due to weaning stress.
Keywords: microRNA-146b-5p, Bioinformatic analysis, Promoter, Swine, Intestine
1. Introduction
Weaning is one of the most stressful events in a pig's life. Several studies have shown weaning stress mainly targets the small intestine of piglets. Intestinal mucosa injury and inflammatory response induced by weaning stress is one of the most reasons of diarrhea (Campbell et al., 2013, Smith et al., 2010, McLamb et al., 2013). Stress signaling pathways that activated by weaning mediate the process of intestinal mucosal barrier impairment and result in harmful inflammation (Lambert, 2009, Moeser et al., 2007). MicroRNAs (miRNA) have been proved to play an important role in regulating stress signaling pathways. They control intestinal epithelial differentiation, architecture, barrier function, and to some extent, determine the fate of intestinal epithelial cells (Mendell and Olson, 2012, Dalmasso et al., 2010, Mckenna et al., 2010). To date some special miRNA have been found to differentially express during the intestinal physiology and pathology such as pathogen infection (Al-Quraishy et al., 2011), stress-induced injury (Yu et al., 2011), intestinal mucosa immunity (Goto and Kiyono, 2011), intestinal homeostasis (Singh et al., 2012), colorectal cancer (Schetter et al., 2012), and inflammatory disease (Coskun et al., 2012) etc.
Studies confirmed the influences of weaning stress on intestinal injury mainly occur within the first week after weaning (Campbell et al., 2013). Using Solexa high-throughput sequencing technology, our previous research found a large number of differentially expressional miRNA in the small intestinal mucosa of piglets at different time points in the first week after weaning. One of the miRNA is microRNA-146b-5p (miR-146b). It was highly expressed, and it maintained continual and largest differences (Tao and Xu, 2013). These results suggested Sus Scrofa microRNA-146b-5p (ssc-miR-146b) probably plays a vital role in regulating intestinal injury due to weaning stress. The microRNA-146 (miR-146) family includes two members: one is miR-146b located on chromosome 14, and the other is microRNA-146a-5p (miR-146a) located on chromosome 16. They have similar target genes with only two different bases (Kozomara and Griffiths-Jones, 2014). There are more reports related to the regulation functions of miR-146 in human. Especially in recent years, studies have revealed that miR-146 regulates the inflammatory response of human cells, including retinal pigment epithelial cells, adipocytes, and monocytes etc (Curtale et al., 2013, Kutty et al., 2013, Shi et al., 2014). However, the role of miR-146b in the intestinal epithelial cells of piglets has been unclear. Therefore, we expect to obtain the information of methylation and transcription factor binding sites by predicting the ssc-miR-146b promoter using biological analysis. The present study provided a fundamental basis for further illuminating the function of miR-146b in the small intestinal injury of weaning piglets.
2. Materials and methods
2.1. The sequence of ssc-miR-146b
MicroRNA-146b-5p is an intergenic miRNA located on porcine chromosome 14 ranging from 123,301,752 to 123,301,850 bp. The precursor sequence is 5′-GAACUUUGGCCACCUGGCUC UGAGAACUGAAUUCCAUAGGCUGUGAGCUCUAGCAAAUGCCCUAGGAACUCAGUU CUGGUGCCCGGCUGUGCUAUAGUC-3′, and the mature sequence from the 5′ arm of the precursor is 5′-UGAGAACUGAAUUCCAUAGGC-3′ (Reddy et al., 2009).
2.2. The methods of biological analysis
The promoter region of miR-146b was obtained using the Ensemble database. Then methylation analysis was done using the MethPrimer software, and potential transcription factor binding sites were predicted using several kinds of software of promoter analysis for promoter region.
2.3. Programs and databases
The databases and programs included miRBase (http://www.mirbase.org/), Ensemble (http://asia.ensembl.org/index.html), TRANSFAC (a database on transcription factors and their DNA binding sites, http://www.biobase-international.com/product/transcription-factor-binding-sites), MethPrimer (http://www.urogene.org/methprimer/index.html), Promoter 2.0 (http://www.cbs.dtu.dk/services/Promoter/), Neural Network Promoter Prediction (http://fruitfly.org:9005/seq_tools/promoter.html) and Promoter SCAN (http://www-bimas.cit.nih. gov/molbio/proscan/).
3. The results of biological analysis
3.1. The ssc-miR-146b promoter region
The precursor sequence of the ssc-miR-146b, ranging from 1 to 99 bp, was obtained using the Ensemble database, but the predicted information of the ssc-miR-146b promoter region was not obtained. Therefore, according to the methods of Zhou and Wu (Zhou et al., 2007, Wu, 2011), we predicted the length of promoter region is 2,249 bp (from 2, 000 bp upstream to 150 bp downstream of the precursor).
3.2. The analysis of the CpG island in the ssc-miR-146b promoter region
The position of one CpG island was predicted using the online program, MethPrimer with default parameters (Criteria used: Island sized > 100 bp, GC% > 50.0%, Obs/Exp > 0.6). As shown in Fig. 1, the full length of the promoter was 2,249 bp; the length of the CpG island, located from 464 to 630 bp, was 167 bp. The predictions suggested the presence of this CpG island can inhibit the ssc-miR-146b promoter transcription.
Fig. 1.
The methylation predication of ssc-miR-146b promoter region. ssc-miR-146b = Sus Scrofa microRNA-146b-5p; PCR = polymerase chain reaction; MSP = methylated-specific PCR; F = forward; R = reverse; bp = base pair.
3.3. The predicted results of the ssc-miR-146b promoter region
The two critical promoter regions of the ssc-miR-146b were predicted using the online program of Neural Network Promoter Prediction with cutoff score 0.80. Their positions of transcription sites are listed in Table 1.
Table 1.
Promoter predictions of the ssc-miR-146b sequence using cutoff score 0.80.1
| Start | End | Score | Promoter region |
|---|---|---|---|
| 22 | 72 | 0.99 | TGCCAGCCCTCTATAGATGTGGCCATTCTTCCCCTCCCCCAGCTCCCATC |
| 1,335 | 1,385 | 0.95 | GTGGGGGCCCTATTTAAGAAGCACTCTCTGGGAGCATCTCTGCAGATCCA |
ssc-miR-146b = Sus Scrofa microRNA-146b-5p.
Cutoff score 0.80 was a condition selected using on line Neural Network Promoter Prediction (http://fruitfly.org:9005/seq_tools/promoter.html).
The TATA box of the ssc-miR-146b was found to be missing using the software of Promoter 2.0 with cutoff score 2.0. Therefore, by determining the locations and distances of the GC box, CCAAT box and the cap site using the Neural Network method, we found that the two transcriptional start sites were located on 200 bp and 1,500 bp upstream, respectively, as shown in Table 2.
Table 2.
Promoter predictions of the ssc-miR-146b sequence using the cutoff score 2.0.1
| Position | Score | Likelihood |
|---|---|---|
| 200 | 0.586 | Marginal prediction |
| 1,500 | 0.638 | Marginal prediction |
ssc-miR-146b = Sus Scrofa microRNA-146b-5p.
Cutoff score 2.0 was a condition selected using the software Promoter 2.0 (http://www.cbs.dtu.dk/services/Promoter/).
The ssc-miR-146b promoter was analyzed using the software of Promoter SCAN 1.7 with cutoff score 1.0. The results showed that the position on the forward strand was from 1,075 to 1,325 bp and the predicted score was 58.57 with the cutoff value of promoter 53.00. The location of transcription factor binding sites was from 1,131 to 1,317 bp, and these transcription factors mainly included genes such as Sp1, AP-2 and KROX24 etc, as shown in Table 3. Similarly, the position on the reverse strand was from 1,310 to 1,560 bp and the predicted score was 61.24. The location of transcription factor binding sites was from 1,131 to 1,317 bp, and these transcription factors mainly included genes such as Sp1, AP-2 etc, as shown in Table 4.
Table 3.
Promoter predictions of the ssc-miR-146b sequence with cutoff score 1.0 on the forward strand.1
| Gene names and TFD No. | Strand | Location | Weight |
|---|---|---|---|
| JCV_repeated_sequenc | |||
| S01193 | + | 1,131 | 1.427 |
| PuF | |||
| S02016 | + | 1,131 | 1.082 |
| AP-2 | |||
| S01936 | – | 1,137 | 1.091 |
| NF-κβ | |||
| S01498 | + | 1,199 | 1.080 |
| UCE.2 | |||
| S00437 | – | 1,267 | 1.216 |
| T-Ag | |||
| S00974 | + | 1,305 | 1.086 |
| Sp1 | |||
| S00979 | + | 1,305 | 6.023 |
| S00326 | + | 1,305 | 3.129 |
| S00978 | + | 1,306 | 3.013 |
| JCV_repeated_sequenc | |||
| S01193 | + | 1,306 | 1.427 |
| Sp1 | |||
| S00781 | + | 1,307 | 3.191 |
| EGR-1 | |||
| S01623 | + | 1,308 | 2.151 |
| Sp1 | |||
| S00857 | + | 1,310 | 4.589 |
| S00802 | – | 1,311 | 3.061 |
| S00801 | – | 1,312 | 3.119 |
| AP-2 | |||
| S01936 | – | 1,313 | 1.091 |
| Sp1 | |||
| S01187 | – | 1,313 | 6.819 |
| S00956 | – | 1,314 | 3.129 |
| EGR-1 | |||
| S01956 | – | 1,316 | 2.294 |
| S01624 | – | 1,316 | 1.912 |
| AP-2 | |||
| S00346 | – | 1,317 | 1.672 |
| EGR-2 | |||
| S01957 | – | 1,317 | 3.442 |
TFD = transcription factors database.
Cutoff score 1.0 was a condition selected using the software Promoter SCAN 1.7 (http://www-bimas.cit.nih.gov/molbio/proscan/).
Table 4.
Promoter predictions of the ssc-miR-146b sequence with cutoff score 1.0 on the reverse strand.1
| Gene names and TFD No. | Strand | Location | Weight |
|---|---|---|---|
| AP-2 | |||
| S01936 | – | 1,454 | 1.108 |
| PuF | |||
| S02016 | + | 1,447 | 1.391 |
| JCV_repeated_sequenc | |||
| S01193 | + | 1,447 | 1.658 |
| T-Ag | |||
| S00974 | – | 1,428 | 1.086 |
| UCE.2 | |||
| S00437 | – | 1,426 | 1.278 |
| GCF | |||
| S01964 | + | 1,421 | 2.284 |
| AP-2 | |||
| S00346 | – | 1,341 | 1.355 |
| S01936 | – | 1,340 | 1.108 |
| Sp1 | |||
| S01187 | – | 1,335 | 8.117 |
| S00801 | – | 1,334 | 2.755 |
| PuF | |||
| S00802 | + | 1,333 | 1.391 |
| JCV_repeated_sequenc | |||
| S01193 | + | 1,333 | 1.658 |
| Sp1 | |||
| S02016 | – | 1,333 | 3.292 |
| S00781 | + | 1,329 | 2.772 |
| S00978 | + | 1,328 | 3.361 |
| S01542 | + | 1,327 | 3.608 |
| S00979 | + | 1,327 | 5.934 |
| S00327 | + | 1,327 | 17.211 |
| S00064 | + | 1,327 | 6.023 |
| EGR-2 | |||
| S01957 | – | 1,317 | 10.327 |
| EGR-1 | |||
| S01624 | – | 1,316 | 9.559 |
| S01956 | – | 1,316 | 5.736 |
| Sp1 | |||
| S00956 | – | 1,314 | 9.386 |
| S00857 | + | 1,310 | 4.876 |
ssc-miR-146b = Sus Scrofa microRNA-146b-5p; TFD = transcription factors database.
Cutoff score 1.0 was a condition selected using the software Promoter SCAN 1.7 (http://www-bimas.cit.nih.gov/molbio/proscan/).
A lot of software can predict promoter region, but each has different algorithms. Therefore, the prediction results of the same gene promoter are different using different software. In the present study, because we predicted the information of the ssc-miR-146b promoter region using three software programs simultaneously, the prediction accuracy of the results could be effectively improved.
3.4. The predictions of transcription factor binding sites
We successfully predicted that the position of the highly reliable ssc-miR-146b promoter region was 22 to 1,560 bp, and it was located on chromosome 14 ranging from 123,299,774 to 123,301,312 bp according to the predicted results using three software programs. The predictions of the promoter region showed 323 binding sites of 138 transcription factors on the basis of the transcription factor binding matrix provided by TRANSFAC. Finally, only 26 binding sites of 9 transcription factors were preserved by screening the pig genome, as shown in Table 5.
Table 5.
Predictions of transcription factor binding sites of the ssc-miR-146b promoter.
| Gene names and sequences | Position | Strand | Score | P-value |
|---|---|---|---|---|
| MyoD | ||||
| CCTCAGCTGATG | 946 | + | 8.49 | 0.000575 |
| GATCCGGTGTTG | 563 | + | 8.14 | 0.000750 |
| Sp1 | ||||
| TAGGCATAAA | 1,043 | + | 7.29 | 0.000350 |
| TGGGCAGGGT | 1,228 | + | 7.18 | 0.000475 |
| AGGGCAGAGT | 1,488 | – | 6.96 | 0.000775 |
| GAGGCTGACT | 177 | + | 6.77 | 0.000825 |
| AAGGCTCGGA | 602 | + | 6.65 | 0.000975 |
| CREB | ||||
| TGACCTCA | 1,208 | – | 9.79 | 0.000325 |
| NF-1 | ||||
| CTCCTGTGGAATATGGAGATTCCCAGGCT | 669 | – | 6.42 | 0.000675 |
| CREB | ||||
| ATGAAGCCTCTTCTC | 1,376 | – | 8.09 | 0.000325 |
| ATGACTCTTCTCTCC | 79 | + | 7.21 | 0.000725 |
| AP-1 | ||||
| AGTGACTTTCT | 1,525 | – | 8.88 | 0.000775 |
| AATGACACACA | 428 | + | 8.41 | 0.000975 |
| MyoD | ||||
| TGCAGCTGAT | 927 | + | 10.42 | 0.000275 |
| CCCAGCTGGC | 1,089 | + | 8.14 | 0.000700 |
| NF-1 | ||||
| AAATGGCAAAAAGACAAA | 707 | + | 12.20 | 0.000050 |
| TCCTGGCCCAAGACCCTT | 147 | + | 8.33 | 0.000750 |
| Sp1 | ||||
| TGTAGGTGGAATT | 833 | – | 8.34 | 0.000300 |
| AAAGGGCCTATTT | 1,050 | + | 7.44 | 0.000850 |
| GATA | ||||
| GATACCTCCT | 891 | + | 11.79 | 0.000525 |
| GACAAGGCTC | 599 | + | 11.02 | 0.000925 |
| HNF-1 | ||||
| AGGGGAAGAATGGCCAC | 18 | – | 7.90 | 0.000975 |
| p53 | ||||
| AGGCAAGCC | 1,455 | – | 10.92 | 0.000575 |
| HOXA9 | ||||
| TGAGAGTTAAACTG | 1,511 | – | 6.75 | 0.000800 |
| TGACACACAAACGG | 430 | + | 8.50 | 0.000575 |
| TGAGAGTTAAACTG | 1,511 | – | 7.46 | 0.000925 |
ssc-miR-146b = Sus Scrofa microRNA-146b-5p.
4. Discussion
The miR-146 family has been much prospectively, widely and deeply studied. Studies on human subjects found that it is involved in some physiological and pathological processes, such as immunity, tumor and inflammation etc (Hulsmans et al., 2012, Monteys et al., 2010, Chassin et al., 2010). Therefore, the change of the ssc-miR-146b transcriptional level is probably related to the functions of the body. Currently, it has been proved that all intergenic miRNA and partial intragenic miRNA have independent transcription elements, and the accurate transcription of these miRNA requires complicated regulatory system (Chou et al., 2013). The factors influencing the transcription of miRNA mainly include methylation, demethylation, inhibited or activated regulatory factors. It suggested that the ssc-miR-146b expression must be regulated by the above factors since it is an intergenic miRNA.
The present study found one CpG island by analyzing the ssc-miR-146b promoter region. This CpG island can probably affect the normal transcription of the promoter. Studies found that the occurrence of tumor is closely related to the DNA methylation. To some extent, the abnormal transcription of oncogenes and cancer suppressor genes involved the DNA methylation (Hoque et al., 2005). Moreover, the development of tumor is usually associated with inflammation. It was shown that the miR-146b inhibited the inflammation in normal breast cells by forming a feedback loop (Xiang et al., 2014), but its expression was under-regulated in tumor cells due to the methylation of promoter, and this further activated inflammatory reaction (Yang and Yu, 2013). It indicated the over-expression of miR-146b in the small intestine of weaned piglets was possibly an inhibitor mechanism of inflammation for self-protection. However, more experiments should be done to confirm whether this mechanism is associated with the CpG island that was predicted in the present study.
Transcription factors are some DNA-binding proteins that could have special interaction with transcription factor binding sites in the promoter region, and they can activate or inhibit genetic transcription. Various stimuli from external environment and signals of developmental stages can activate the binding of transcription factors and transcription regulatory elements. This activation further affects the transcription of miRNA (Kuang et al., 2014). Studies on the miR-146a promoter in humans showed that the binding sites of NF-κB and PLZF significantly affected the miR-146a expression (Pauley and Chan, 2008, Taganov et al., 2006). Similarly, studies on the miR-146b promoter found the transcriptional activity of the 950 bp site and confirmed the activity of the STAT and NF-κB binding sites (Curtale et al., 2013, Kutty et al., 2013, Shi et al., 2014). The present study found that the ssc-miR-146b expression may be regulated by some transcription factors, such as genes Sp1, AP-1, MyoD and GATA etc. Among them, the Sp1 and AP-1 have been widely studied and they are not only closely related to cell proliferation, differentiation and apoptosis but also involved in the body's inflammation and immune response. This suggested that they probably affect the expression of target genes by regulating the miR-146b expression in the small intestine, and finally participate in the stressful progress of weaned piglets. Certainly this deduction should be further confirmed by performing some molecular experiments. Moreover, the predictions of transcription factor binding sites only included what was known. Those that are new and unknown could not be predicted by existing programs, so it may omit some more important biological information. This depends on improving the data of bioinformatics.
5. Conclusion
This study predicted the CpG island and transcription factor binding sites in the ssc-miR-146b promoter region using the biological analysis. The predictions provided significant information and scientific basis for further studying the transcriptional regulation mechanism of ssc-miR-146b on the small intestinal injury due to weaning stress. However, the above predicted information must be confirmed by the methods of corresponding molecular experiments in view of limitations of bioinformatics.
Acknowledgments
This work was supported by grants from the Zhejiang Provincial Natural Science Foundation (LY15C170004), the National Natural Science Foundation of China (31101725), the Science Technology Department of Zhejiang Province (2012C12906-4), the Modern Agro-industry Technology Research System of China (CARS-36), National Key Technology R & D Program (2012BAD39B03-04), and Agro-scientific Research in the Public Interest (201403047). The funders had no role in study collection, data collection and analysis, decision to publish, or preparation of the manuscript.
Footnotes
Peer review under responsibility of Chinese Association of Animal Science and Veterinary Medicine.
References
- Al-Quraishy S., Delic D., Sies H., Wunderlich F., Abdel-Baki A.A., Dkhil M.A. Differential miRNA expression in the mouse jejunum during garlic treatment of Eimeria papillata infections. Parasitolo Res. 2011;109:387–394. doi: 10.1007/s00436-011-2266-y. [DOI] [PubMed] [Google Scholar]
- Campbell J.M., Crenshaw J.D., Polo J. The biological stress of early weaned piglets. J Anim Sci Biotechnol. 2013;4:19. doi: 10.1186/2049-1891-4-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chassin C., Kocur M., Pott J., Duerr C.U., Gütle D., Lotz M. miR-146a mediates protective innate immune tolerance in the neonate intestine. Cell Host Microbe. 2010;8:358–368. doi: 10.1016/j.chom.2010.09.005. [DOI] [PubMed] [Google Scholar]
- Chou C.K., Yang K.D., Chou F.F., Huang C.C., Lan Y.W., Lee Y.F. Prognostic implications of miR-146b expression and its functional role in papillary thyroid carcinoma. J Clin Endocrinol Metab. 2013;98:E196–E205. doi: 10.1210/jc.2012-2666. [DOI] [PubMed] [Google Scholar]
- Coskun M., Bjerrum J.T., Seidelin J.B., Nielsen O.H. MicroRNAs in inflammatory bowel disease – pathogenesis, diagnostics and therapeutics. World J Gastroenterol. 2012;18:4629–4634. doi: 10.3748/wjg.v18.i34.4629. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Curtale G., Mirolo M., Renzi T.A., Rossato M., Bazzoni F., Locati M. Negative regulation of Toll-like receptor 4 signaling by IL-10-dependent microRNA-146b. Proc Natl Acad Sci USA. 2013;110:11499–11504. doi: 10.1073/pnas.1219852110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dalmasso G., Nguyen H.T.T., Yan Y., Laroui H., Srinivasan S., Sitaraman S.V. MicroRNAs determine human intestinal epithelial cell fate. Differentiation. 2010;80:147–154. doi: 10.1016/j.diff.2010.06.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Goto Y., Kiyono H. Epithelial cell microRNAs in gut immunity. Nat Immunol. 2011;12:195–197. doi: 10.1038/ni0311-195. [DOI] [PubMed] [Google Scholar]
- Hoque M.O., Rosenbaum E., Westra W.H., Xing M., Ladenson P., Zeiger M.A. Quantitative assessment of promoter methylation profiles in thyroid neoplasms. J Clin Endocr Metab. 2005;90:4011–4018. doi: 10.1210/jc.2005-0313. [DOI] [PubMed] [Google Scholar]
- Hulsmans M., Van Dooren E., Mathieu C., Holvoet P. Decrease of miR-146b-5p in monocytes during obesity is associated with loss of the anti-inflammatory but not insulin signaling action of adiponectin. PLoS One. 2012;7:e32794. doi: 10.1371/journal.pone.0032794. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kozomara A., Griffiths-Jones S. miRBase: annotating high confidence microRNAs using deep sequencing data. NAR. 2014;42:D68–D73. doi: 10.1093/nar/gkt1181. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kuang Q., Li J.Y., Ji C.B., Guo X., Ni Y., Xu M. Bioinformatic analysis of the hsa-miR-1908 upstream promoter region. J Clin Pediatr. 2014;32:379–383. [Google Scholar]
- Kutty R.K., Nagineni C.N., Samuel W., Vijayasarathy C., Jaworski C., Duncan T. Differential regulation of microRNA-146a and microRNA-146b-5p in human retinal pigment epithelial cells by interleukin-1β, tumor necrosis factor-α, and interferon-γ. Mol Vis. 2013;19:737–750. [PMC free article] [PubMed] [Google Scholar]
- Lambert G.P. Stress-induced gastrointestinal barrier dysfunction and its inflammatory effects. J Anim Sci. 2009;87(14 Suppl):E101–E108. doi: 10.2527/jas.2008-1339. [DOI] [PubMed] [Google Scholar]
- Mckenna L.B., Schug J., Vourekas A., McKenna J.B., Bramswig N.C., Friedman J.R. MicroRNAs control intestinal epithelial differentiation, architecture, and barrier function. Gastroenterology. 2010;139:1654–1664. doi: 10.1053/j.gastro.2010.07.040. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McLamb B.L., Gibson A.J., Overman E.L., Stahl C., Moeser A. Early weaning stress in pigs impairs innate mucosal immune responses to enterotoxigenic E. coli challenge and exacerbates intestinal injury and clinical disease. PLoS One. 2013;8:e59838. doi: 10.1371/journal.pone.0059838. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mendell J.T., Olson E.N. MicroRNAs in stress signaling and human disease. Cell. 2012;148:1172–1187. doi: 10.1016/j.cell.2012.02.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moeser A.J., Ryan K.A., Nighot P.K., Blikslager A.T. Gastrointestinal dysfunction induced by early weaning is attenuated by delayed weaning and mast cell blockade in pigs. Am J Physiol Gastrointest Liver Physiol. 2007;293:G413–G421. doi: 10.1152/ajpgi.00304.2006. [DOI] [PubMed] [Google Scholar]
- Monteys A.M., Spengler R.M., Wan J., Tecedor L., Lennox K.A., Xing Y. Structure and activity of putative intronic miRNA promoters. RNA. 2010;16:495–505. doi: 10.1261/rna.1731910. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pauley K.M., Chan E.K. MicroRNAs and their emerging roles in immunology. Ann NY Acad Sci. 2008;11:226–239. doi: 10.1196/annals.1443.009. [DOI] [PubMed] [Google Scholar]
- Reddy A.M., Zheng Y., Jagadeeswaran G., Macmil S.L., Graham W.B., Roe B.A. Cloning, characterization and expression analysis of porcine microRNAs. BMC Genomics. 2009;10:65. doi: 10.1186/1471-2164-10-65. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schetter A.J., Okayama H., Harris C.C. The role of microRNAs in colorectal cancer. Cancer J. 2012;18:244–252. doi: 10.1097/PPO.0b013e318258b78f. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shi C., Zhu L., Chen X., Gu N., Chen L., Zhu L. IL-6 and TNF-α induced obesity-related inflammatory response through transcriptional regulation of miR-146b. J Interferon Cytokine Res. 2014;34:342–348. doi: 10.1089/jir.2013.0078. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Singh N., Shirdel E.A., Waldron L., Zhang R.H., Jurisica I., Comelli E.M. The murine caecal microRNA signature depends on the presence of the endogenous microbiota. Int J Biol Sci. 2012;8:173–186. doi: 10.7150/ijbs.8.171. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Smith F., Clark J.E., Overman B.L., Tozel C.C., Huang J.H., Rivier J.E. Early weaning stress impairs development of mucosal barrier function in the porcine intestine. Am J Physiol Gastrointest Liver Physiol. 2010;298:G352–G363. doi: 10.1152/ajpgi.00081.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Taganov K.D., Boldin M.P., Chang K.J., Baltimore D. NF-κB dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proc Natl Acad Sci USA. 2006;33:1248–1252. doi: 10.1073/pnas.0605298103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tao X., Xu Z. MicroRNA transcriptome in swine small intestine during weaning stress. PLoS One. 2013;8:e79343. doi: 10.1371/journal.pone.0079343. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wu A.M. Springer; USA: 2011. The molecular immunology of complex carbohydrates-3; p. 133. [Google Scholar]
- Xiang M., Birkbak N.J., Vafaizadeh V., Walker S.R., Yeh J.E., Liu S. STAT3 induction of miR-146b forms a feedback loop to inhibit the NF-κB to IL-6 signaling axis and STAT3-driven cancer phenotypes. Sci Signal. 2014;7 doi: 10.1126/scisignal.2004497. ra11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang M., Yu C.X. Expression of the thyroid adenoma miR-146b and BRAFmutation. Chin J Clin. 2013;7:5827–5830. [Google Scholar]
- Yu J., Liu F.L., Yin P., Cheng G., Wang N., Lu A. Integrating miRNA and mRNA expression profiles in response to heat stress-induced injury in rat small intestine. Funct Integr Genomics. 2011;11:203–213. doi: 10.1007/s10142-010-0198-8. [DOI] [PubMed] [Google Scholar]
- Zhou X., Ruan J., Wang G., Zhang W. Characterization and identification of microRNA core promoters in four model species. PLoS Comput Biol. 2007;3:e37. doi: 10.1371/journal.pcbi.0030037. [DOI] [PMC free article] [PubMed] [Google Scholar]