Abstract
Kluyveromyces marxianus, a probiotic yeast, is important in industrial applications because it has a broad substrate spectrum, a rapid growth rate and high thermotolerance. To date, however, there has been little effort in its genetic engineering by the CRISPR/Cas9 system. Therefore, we aimed at establishing the CRISPR/Cas9 system in K. marxianus and creating stable haploid strains, which will make genome engineering simpler. First, we predicted the genome-wide target sites of CRISPR/Cas9 that have been conserved among the eight sequenced genomes of K. marxianus strains. Second, we established the CRISPR/Cas9 system in the K. marxianus 4G5 strain, which was selected for its high thermotolerance, rapid growth, a pH range of pH3-9, utilization of xylose, cellobiose and glycerol, and toxin tolerance, and we knocked out its MATα3 to prevent mating-type switching. Finally, we used K. marxianus MATα3 knockout diploid strains to obtain stable haploid strains with a growth rate comparable to that of the diploid 4G5 strain. In summary, we present the workflow from identifying conserved CRISPR/Cas9 targets in the genome to knock out the MATα3 genes in K. marxianus to obtain a stable haploid strain, which can facilitate genome engineering applications.
Introduction
Kluyveromyces marxianus is a yeast that can be isolated from dairy environments1,2. It is a probiotic yeast3 that is included in the list of qualified presumption of safety (QPS) biological agents by European Food Safety Authority (EFSA)4. It has many other advantages for a cell factory host, including a broad substrate spectrum5, a rapid growth rate5,6 and thermotolerance6. We have isolated a K. marxianus strain, called 4G5, from kifer that can grow at 48 °C, has a broad pH range (pH3-pH9), has a doubling time of 1.22 ± 0.4 hour at 30 °C in YPG (2% galactose), can utilize xylose, cellobiose, and glycerol, and can tolerate 2% isobutanol, 1.5% 1-butanol, and 4% ethanol (Supplementary Figs S1–S4 and Supplementary Table S1). These traits make it a good potential cell factory host.
The main aim of this study is to obtain stable haploid strains with a good fitness under common experimental conditions because a haploid strain can be genetically engineered more readily than a diploid strain. In response to harsh environmental conditions, Kluyveromyces haploids tend to become diploids and produce spores. The mating type of a cell is determined by the alleles at the MAT locus2,7. MATa and MATα haploids can switch their mating type2,7. The MATa locus includes the a1 and a2 genes, while the MATα locus includes the α1, α2 and α3 genes and α3 expresses a transposase that can fracture a MAT locus, switching MATα-type to MATa-type. The MAT locus of K. marxianus is homologous to that of K. lactis8,9, in which the stability of haploid cells depends on the activity of α3 transposase10,11. Indeed, in K. marxianus haploid cells, mating-type switch can happen readily and the haploid cells may become diploid cells during isolation. Thus, we aimed to knock out the MATα3 genes in the diploid background to avoid mating-type switch.
To knockout the α3 genes, we used the CRISPR/Cas9 system12–14. The prediction and design of guide RNAs (gRNAs) is crucial for the efficacy of CRISPR/Cas9 genome editing. There are many tools for designing gRNAs, but there are still limitations, especially for a non-model organism. First, if the genome of the strain under study is not available, as in the case of 4G5, we may need to use the available genomes of other strains to design gRNAs. However, there may be indels and nucleotide variations between the reference genome(s) and the strain under study. Second, even if one can get the same strain with the reference genome, there may be regions that are not sequenced or assembled. In either case, we propose to use the genomes of sequenced strains to identify regions conserved among the reference genomes and then to design the gRNAs in conserved regions. The designed gRNAs may also be used in future studies.
In this study, we used the above approach to obtain a stable haploid 4G5 strain, as described below. First, we assessed the evolutionary conservation of CRISPR/Cas9 targets in eight sequenced K. marxianus strains and optimized the gRNA targets on the Matα3 gene. Second, we established a Cas9-expressing system in K. marxianus 4G5 strain. Third, we integrated the gRNA cassettes of Matα3 by a modified version of PGASO (Promoter-based Gene Assembly and Simultaneous Overexpression)15,16 to knock out the Matα3 genes in the 4G5 genome, and obtained knockout diploid strains. Finally, we obtained stable haploid strains from the sporulation of knockout diploid strains and studied their growth rates under different temperatures and carbon sources. We selected the best strain and showed that it was stable.
Results
Identifying conserved regions on the K. marxianus genome for gRNA design
We first obtained the eight available K. marxianus genomes (Supplementary Table S2) and annotated their protein-coding genes (see Materials and Methods). Then we conducted the gRNA predictions and selected only gRNAs that have no computationally predicted off-targets and targeted the single-copy regions with identical sequences in these genomes. In total, we predicted 103,168 gRNAs that target the regions of 4,819 (97%) protein-coding genes that are conserved in at least two available K. marxianus genomes (Supplementary Table S3). In addition, we predicted 10,369 gRNAs that target the regions of 3,068 (62%) protein-coding genes that are conserved in all 8 available K. marxianus genomes. Based on our predicted result, we also selected gRNAs of other genes and successfully knocked out the targeted regions (data not shown) in 4G5 strain.
Assessing the expression of Cas9 protein in transformants
To do CRISPR/Cas9 genome editing, we first integrated the Cas9 gene into the 4G5 genome via transforming the linearized Cas9 vector (see Materials and Methods, Supplementary Fig. S5). We confirmed the success of Cas9 gene integration in the 4G5 genome by PCR (Fig. 1a). We used two different primer pairs to check the integration of the Cas9 gene and the zeocin gene (the selection marker) in the transformants, and the Cas9 gene was found in five transformants (L5-L9) (Fig. 1a). The saturation OD600 of transformants could reach 30 in 24 hours, similar to the wild type, although their growth rates were slower in the first 12 hours (Fig. 1b). Therefore, the expression of Cas9 apparently did not strongly affect the growth of the transformants.
Figure 1.

Insertion and expression of Cas9 in Kluyveromyces marxianus 4G5. (a) The transformation of the Cas9 gene and selection marker gene (zeocin) was validated by PCR, confirming the two fragments of different sizes. The size of Cas9 gene was 2021 bp, while the size of antibiotic gene (zeocin) was 750 bp. The five transformants L5 to L9 had the correct Cas9 plasmid sequence (shown in the red number, Supplementary Fig. S13). (b) Effect of expressing Cas9 on strain growth. The growth rates of L5 to L9s were slower than the wild type 4G5 strain t 12 hours. However, the total OD600 of all strains were only slightly lower than 4G5 at 24 hours. The results showed that cell growth was not strongly affected by the insertion of Cas9 gene.
We also investigated the Cas9 gene copy number in each of the five transformants by quantitative PCR. The lowest copy number was found in L5, while the highest number was found in L9 (Supplementary Fig. S6). We then investigated the Cas9 gene expression by quantitative RT-PCR at different time points (Fig. 2a) and found it expressed in all five transformants, reaching the highest expression level at 24 hours. Among the five transformants, L7 had the highest Cas9 gene expression at 24 hours (Fig. 2a), although L9 had the highest Cas9 gene number (Supplementary Fig. S6). We selected both L7 and L9 for Cas9 protein qualification. The western blots of L7 and L9 strains revealed that Cas9 protein was indeed expressed and accumulated between 6 and 12 hours (Fig. 2b,c). The size of Cas9 protein was ~180 kDa, which was confirmed by the LC-nESI-Q Exactive mass spectrometer (Supplementary Fig. S7). Both Cas9-carrying strains were thus suitable for gRNA mutagenesis.
Figure 2.

Cas9 gene expression at different culturing times by qRT-PCR and western blot. (a) Cas9 gene expression levels at different culturing times measured by qRT-PCR assays. The colors represent: gray for six hours; dark gray for 12 hours; and black for 24 hours. The strain with the highest Cas9 gene expression at 6 hours was L9, while the strain with the highest Cas9 gene expression at 12 hours and 24 hours was L7. (b) Expression profiles of Cas9 protein in L7 at different culturing times. The red and blue arrow indicates the Cas9 protein. (c) Expression profiles of Cas9 protein in strain L9 at different culturing times. The red (>180 kDa) and blue (<180 kDa) arrows indicate the Cas9 proteins confirmed by the LC-nESI-Q Exactive mass spectrometer (Supplementary Fig. S7).
CRISPR-Cas9 directed Matα3 gene knockout
To knock out the Matα3 gene, we constructed six gRNA expression cassettes (see Materials and Methods, Supplementary Table S4). We designed two gRNAs (gRNA1 and gRNA3) on the antisense strand and four gRNAs (gRNA2, gRNA4, gRNA5 and gRNA6) on the sense strand of the Matα3 gene (Supplementary Fig. S8b) by referring to the two most well-annotated genomes DMKU 3-1042 and NBRC 1777. The six gRNA target sites were conserved in most of the eight genomes we analyzed (Supplementary Fig. S9). The genomic target sites of gRNA2, gRNA4, gRNA5 and gRNA6 were at 493 bp, 157 bp, 44 bp and 22 bp downstream of the ATG start codon of the Matα3 gene on the sense strand, while those of gRNA1 and gRNA3 were located 291 bp and 382 bp downstream of the ATG start codon on the antisense strand (Table 1 and Supplementary Fig. S9).
Table 1.
gRNAs for Matα3 gene knockout.
| ID | Downstream of the ATG start codon | Guide sequences |
|---|---|---|
| -gRNA1 | 291 | CAGCATTGTATTTGCTAAATGGG |
| gRNA2 | 513 | ACTGGATACATCTTTGTGAGAGG |
| -gRNA3 | 328 | GATATTTTTTCATTAAGAAAGGG |
| gRNA4 | 177 | AAGAATTGGCTTTTGAAAAACGG |
| gRNA5 | 64 | GATCCTTTGAATTTGAAGAGAGG |
| gRNA6 | 42 | AAATGGATAATCCATCCAAAAGG |
*gRNAs that facilitated the cleavage are underlined. gRNAs that target the antisense strand are indicated by “−” in their ID.
The six gRNA cassettes were linearized and co-transformed into the L7 and L9 strains. After the transformants were grown on YPG-zeocin selection medium, ten colonies (K1 to K10) were picked for confirming the order of gRNA cassettes by PCR (Supplementary Table S4, S5 and Supplementary Fig. S8c). Six of the ten transformants (K1, K2, K3, K4, K5 and K9) contained all six gRNA cassettes with the correct order, while the other four transformants only contained 2 to 5 gRNAs (Supplementary Figs S10 and S11). Among the 10 transformants, K1, K2, K3, K4, K9 and K10 had large indels in their Matα3 gene, as validated by PCR and Sanger sequencing, confirming the success of CRISPR/Cas9 cleavage on the Matα3 gene (Fig. 3a,b, Supplementary Fig. S12). K2 has a deletion of 523 bp caused by gRNA2 and gRNA5 (Fig. 3b and Supplementary Fig. S12). K3 and K10 both have a deletion of 116 bp caused by gRNA4 and gRNA5. K9 has a deletion of 523 bp caused by gRNA2 and gRNA5 and an insertion of 468 bp from a non-homologous recombination with another chromosome (Fig. 3b and Supplementary Fig. S12). We failed to amplify Matα3 gene in K1 and K4 by the designed primers from the promoter sequence, and their deletions might be caused by gRNA2 and gRNA5 that deleted fragments larger than 523 bp. These results indicated that the method may be able to co-transform six different gRNAs to knock out multiple genes at once.
Figure 3.

The Matα3 gene knockout transformants and validation of mating-type. (a) The transformants of Matα3 gene knockout was confirmed by PCR. (b) The success of CRISPR/Cas9 cleavage on Matα3 gene in transformants K2, K3, K9 and K10 were validated by sequencing. K1 and K4 did not produce any PCR product. K5 to K8 had only point mutations on Matα3 (Supplementary Fig. S12). Based on the location of indels, we inferred that the gRNAs facilitated the cleavage were gRNA2, gRNA4 and gRNA5. (c) After purification of Matα3 gene knockout for five generations, we randomly selected eight colonies from transformants K1, K2, K3, K4, K9 and K10 for confirming the type of their MAT locus. White arrow refers to MATa-type and red arrow refers to MATα-type.
Sporulation and confirmation of the mating type in haploids
Before obtaining haploids, we checked the MAT type of each of the six transformants of Matα3 gene-knockout mutants (K1, K2, K3, K4, K9 and K10) by PCR, using the primers designed by Lane et al.2. According to Lane et al.2, the MATα-type strain should have a 9,691 bp fragment, whereas the a-type should have a 6,652 bp fragment (Fig. 3c). The diploid should have both MAT fragments in the genome. Therefore, we confirmed the mating type of the six transformants by amplifying their MAT loci. For each transformant, we randomly selected eight colonies to check the type of the MAT loci. We found that K1, K2, K3 and K4 were all MATa-type haploids, while K9 and K10 were likely diploids (see below) (Fig. 3c). These Matα3 knockout mutants were further streaked out for 5 generations for colony purification and then cultured in nutrient deficient medium at 25 °C for 3 days for producing spores (Fig. 4a). The sporulated mutants were then selected for checking their mating type. The results showed that K1, K3 and K4 only exhibited budding and did not produce spores, whereas K9 and K10 produced spores and were classified as diploids. Thus, K1, K3 and K4 indeed were MATa-type haploids. One of the three randomly selected colonies generated from K2 had a few spores (Fig. 4a), which might be due to mating-type switch from MATa type to MATα type exerted by Kat117,18. We isolated seven MATa-type (called Sa1 to Sa7) and seven MATα-type (Sα1 to Sα7) cells from sporulation of K9. Furthermore, we isolated one MATa-type haploid from only budding strain (called Ba1 strain) from K1, two MATa-type haploids (called Ba2 and Ba3 strains) from K2, one MATa-type haploid (called Ba4 strain) from K3 and one MATa-type haploid (called Ba5 strain) from K4 for comparison with the haploids isolated from sporulation. Then, we checked the MAT loci types and Matα3 gene deletion in these haploids by PCR (Fig. 4b,c). In total, 12 MATa-type haploid strains and 7 MATα-type strains were isolated and their growth rates in different carbon sources and at different temperatures were studied as described below.
Figure 4.
Sporulation and Matα3 gene knockout of transformants and validation of mating-type. (a) The haploids were obtained by sporulation experiments. The spore locations in the figure were indicated by red arrows. K1, K3 and K4 only showed budding, while K9 and K10 produced spores. One of the three K2 colonies produced spores, while the other two showed budding. (b) Confirmation of the MAT type of the isolated spores. In total, we isolated 12 strains of MATa-type and 7 strains of MATα-type. (c) Confirmation of the Matα3 gene deletion by PCR in these 12 haploid strains of MATa-type and 7 haploid strains of MATα-type.
Haploid growth in different carbon sources and at different temperatures
To facilitate industrial applications, a haploid strain should retain the good characteristics of K. marxianus diploids, such as thermotolerance, a wide spectrum of carbon source utilization and a rapid growth rate. Therefore, we assessed the growth of the 12 MATa-type and the 7 MATα-type haploid strains under different temperatures and carbon sources. (Among these haploids, Ba2, Sa3 and Sα2 could achieve the cell density of ~OD600 = 45 after 48 hours culturing Fig. 5a). Their growth rates were compared with those of K. lactis KB101 haploid, 4G5 diploid and L7 (Fig. 5a). The comparison was conducted at different temperatures (25 °C to 45 °C) and in different carbon sources (glucose, galactose, lactose or xylose) (Fig. 5b). There was no significant difference between haploids and diploids when they were cultured at 25 °C and 30 °C. At 37 °C, all isolates grew slower in YPG medium compared to the other carbon sources. However, the haploids had higher growth rates than the diploids when galactose was the carbon source. In other carbon sources all K. marxianus strains showed no significant difference in growth rate. At 42 °C, no significant difference in growth rate was observed when cultured in different carbon sources, except in xylose (Fig. 5b). All strains grew slower in YPX (2% xylose) medium when the temperature was at least 42 °C and almost stopped growing at 45 °C. Note that the growth rates of the K. marxianus haploids and diploids were obviously better than the K. lactis haploid when the temperature was at least 37 °C (Fig. 5b). From these comparisons, we found that the Sα2 haploid had higher thermotolerance than the other strains in YPD and YPL (2% lactose) medium.
Figure 5.
Comparison of the growth rates of haploid and diploid strains in different carbon sources and at different temperatures. (a) The growth rates of haploids and diploids at different culturing times. The stripe colors from light to dark represent the passage of time from 0 hour to 48 hours. The strains compared were sorted by the x-axis, which included 12 haploids of MATa-type (Ba1-Ba5 and Sa1-Sa7), 7 haploids of MATα-type (Sα1-Sα7), 3 diploids (4G5, L7 and L9) and K. lactis haploid KB101. Among the 21 K. marxianus haploids, the three strains Ka2, Sa3 and Sα2, which could achieve ~OD600 = 45 after 48 hours (red arrows), were selected for growth rate comparison with K. lactis haploid KB101 and the 4G5 and L7 diploids. (b) Comparison of the growth rates at different carbon sources and at different temperatures. Note that the haploids could tolerate temperature up to 45 °C.
Discussion
This study focused on developing a stable K. marxianus haploid strain for genetic engineering and industrial applications. In Kluyveromyces, the α3 gene plays an important role in mating-type switch from MATα-type to MATa-type, and the HMLα locus serves as DNA donor when there is the need to repair DNA damage on the MAT locus10. However, the α3 genes at both HMLα and MATα loci can express the α3 transposase19. As long as the α3 gene is retained in a diploid genome, mating type switch can occur. We showed that our method could indeed knockout the α3 genes to obtain a stable haploid.
For industrial applications, an engineered strain should retain rapid growth and utilization of multiple carbon sources. We assessed the growth rates of the 12 MATa-type and the 7 MATα-type haploid strains (Fig. 5a). From the experiments, the Cas9-carrying strains L7 and L9 showed no significant difference in growth than the wild type 4G5 strain. Among these haploids, Ba2, Sa3 and Sα2 could achieve the cell density of ~OD600 = 45 after 48 hours.
We compared the growth rates of haploids (Ba2, Sa3 and Sα2) with those of diploid (4G5 and L7) and haploid (K. lactis KB101) strains in different temperatures and carbon sources (Fig. 5). Our K. marxianus haploid strains could tolerate temperature up to 45 °C (Fig. 5b). The haploids exhibited a similar growth rate as the diploids in all carbon sources (Fig. 5b), except that the diploid strains grew much better than haploid strains at 45 °C when xylose was the carbon source (Fig. 5b). The Sα2 haploid showed better thermotolerance than the other strains in YPD and YPL media. Our experiments provided clues for how to select haploid strains under different temperatures and carbon sources. In addition, our experimental results can be combined with the strains with mating type information available to study the physiology in stress response and resource utilization of strains in different mating types and ploidies, which may facilitate obtaining haploid strains optimal for particular applications. This study demonstrates that the CRISPR/Cas9 system accelerates the screening of stable haploids from field-isolated yeasts.
Materials and Methods
Strains, culture media, and reagents
K. marxianus strain 4G5, which was isolated from kefir, was used as the host. Cells were maintained on YPG medium (1% BactoDifco-Yeast Extract, 1% BactoDifco-Peptone, and 2% Merck-galactose). For sample preparation, the cells were grown in 50 ml YPG, shaking at 250 rpm at 30 °C. Cas9-zeocin cassette transformation was conducted in YPG plate (YPG medium contains 1.5% Difco™-agar) with 200 μg/ml ZeocinTM (InvivoGen, Cat. #: ant-zn-5) for selection. 200 μg/ml Hygromycin B Gold (InvivoGen, Cat. #: ant-hg-1) was used for the transformation of gRNA cassettes.
E. coli DH5α (RBC, Cat. #: RH619-J80) was used as the host for propagation of recombinant plasmids. It was cultivated in Luria-Bertani (LB) complete medium plate (0.5% BactoDifco-Yeast Extract, 1% BactoDifco-Tryptone, 1% NaCl, 2.4% Difco™-agar, pH 7.0) at 37 °C, with supplementation of 100 μg/ml Ampicillin (Bio Basic Inc., Ampicillin, Sodium Salt, Cat. #: 69-52-3) for selection.
Data download
The genome sequences of eight K. marxianus strains (DMKU 3-1042, NBRC 1777, CBS4857, KCTC17555, B0399, DMB1, IIPE453 and UFS-Y2791) and their annotations (if available) were obtained from NCBI GenBank20. The details of the eight genomes are included in Supplementary Table S2.
Designing and assessing the evolutionary conservation of CRISPR gRNA targets in K. marxianus genomes
Among the eight available K. marxianus genomes, only the genomes of NBRC1777 and DMKU 3-1042 were well annotated. Therefore, we annotated the remaining six K. marxianus genomes. First, the genome of DMKU3-104221 was selected as the reference because it had the most complete genome assembly and the highest number of annotated genes. We then used the annotation to obtain the protein sequences of protein-coding genes in DMKU3-1042 to BLAST22 against the remaining seven genomes and annotated their protein-coding genes (e-value = 1e-10).
After annotating all the K. marxianus genomes under study, we predicted the gRNAs of all protein-coding genes in each of these genomes. Here we illustrate how we predicted the gRNAs in protein-coding genes in DMKU 3-1042. For each protein-coding gene, we used its sequence as the input of sgRNACas923 (version 2.0.7) to predict the gRNAs with sequences with NGG Protospacer Adjacent Motif (PAM) and without off-target. The off-target of a gRNA is defined as a genomic site with <six mismatches to the gRNA target site. The off-target possibility was assessed using the DMKU 3-1042 genome as the background. We repeated the procedure for the other seven strains.
To assess the evolutionary conservation of CRISPR gRNA targets, we cross-compared the CRISPR gRNA targets in every K. marxianus gene in the eight genomes we studied. We kept only the gRNAs targets that were found in at least two genomes. In addition, we discarded the gRNAs that target regions with overlapping genes as we prefer the gRNAs that only target one gene. The complete set of predicted gRNAs is given in Supplementary Table S3.
To design the gRNAs on Matα3, we first obtained the gene sequence of Matα3 in the DMKU 3-104221 and NBRC177724 genomes as these two genomes were better annotated than the remaining six genomes. The genomes of DMKU 3-104221 and NBRC177724 were then integrated into the standalone version of CRISPOR25, which was then used to predict the gRNA sequences with NGG PAM by using the Matα3 gene sequence as the query. As the gene sequences of Matα3 and HMLα3 are identical, we selected the gRNAs that only target the two genes and with higher on-target efficacy. The off-target possibility was assessed using the DMKU 3-1042 and NBRC1777 genomes as the background. The on-target efficacy was assessed using CRISPOR and the scoring scheme of Doench et al.26. Finally, we selected six gRNAs for the Matα3 knockout experiments.
Cas9-carrying yeast strain construction
To establish the CRISPR/Cas9 system in K. marxianus, we integrated the Cas9 gene into the K. marxianus genome. For this purpose, we conducted the following experiments. First, the Cas9 gene was synthesized by Zgenebio.inc (Taiwan) and constructed in RGN1-Cas9 plasmid27. The commercial vector pKLAC2 (K. lactis Protein Expression Kit, New England Biolabs, MA) was used as the Cas9 gene expression backbone28 with the zeocin selection marker. The Cas9 gene was constructed using NotI and XhoI to generate the pKLAC4-Cas9-Zeocin plasmid (Supplementary Fig. S13), which was driven by the galactose-inducible promoter lac4. The correctness of plasmids was confirmed by sequencing (Supplementary Fig. S13 and Supplementary Table S6). The 5 μg DNA fragment of the pKLAC4-Cas9-Zeocin plasmid was linearized by SacII and electroporated into K. marxianus 4G5 competent cells (Supplementary Fig. S5), using the protocol for K. lactis29. The transformants were selected on YPG plates containing Zeocin (200 μg/ml, InvivoGen, USA). The success of integration of Cas9 and zeocin genes in the transformants was validated by primer pairs S1274-F/ Cas9-M2R, and Zeor-F/Zeor-R (Fig. 1a and Supplementary Table S5).
Quantitative PCR analysis of Cas9 gene copy number variation and RNA expression
After obtaining the Cas9-carrying strains, we checked the copy number variation of Cas9 gene by quantitative PCR (qPCR), as explained below. Overnight yeast cultures were used to prepare the starting cultures with OD600 = 0.2 and the five Cas9-carrying strains were grown in YPG media at 30 °C with 300 rpm. Cells were harvested at 24 hours for Cas9 gene copy number variation. Each genomic DNA was extracted and purified by AccuBioMed machine (AccuBioMed Co. Ltd.; iColumn 12 system; AccuPure Yeast DNA Mini Kit, Cat. #: D21096). Real-time PCR analyses were conducted with Roche LC480-II in 10 μl reaction volumes containing 2 × Roche LC480 PCR Mix, 50 ng genomic DNA (Supplementary Table S7), 1 μl each of gene-specific forward and reverse primers (5 μM) with 45 cycles of 95 °C for 15 secs and 60 °C for 1 min. The primers were designed online (https://lifescience.roche.com/en_tw/brands/universal-probe-library.html) with default setting (Supplementary Table S8). The relative copy number of Cas9 gene was normalized to that of the Act1 gene (ΔCt) and quantified with the ΔΔCt relative quantification method (Supplementary Fig. S6). The amplification efficiency of each primer pair was tested using 2-fold serial dilutions of the templates. The theoretical efficiency of amplification is 2.0 and the empirical amplification efficiencies of different primer pairs for Cas9 and Act1 were 1.96 and 2.07, respectively.
After checking the Cas9 gene copy number, we used qPCR to check the Cas9 gene expression. This was to select better strains for applying the CRISPR/Cas9 system. The method for real-time PCR analyses was the same as we did for analyzing Cas9 gene copy number variation. Details of the gene expression for different cultured time points are described in Supplementary Text.
Western blot analysis of expressed Cas9 protein
Among the Cas9-carrying strains, we picked up the strain with the highest Cas9 gene expression and/or the strains with the highest Cas9 gene copy number. The selected strains were grown in YPG media at 30 °C with 300 rpm. At 0 hour, 6 hours, 12 hours, and 24 hours, cells were collected for protein expression analysis (Supplementary Fig. S14 and Supplementary Table S9). For each strain, we collected 1 ml cells at each time point for Western blot analysis. The collected cells were washed by ice-water to remove the residual medium and were lysed by the lysis buffer with 20 U lyticase (SIGMA, Cat. #: L2524-10XU) for 1 hour at 37 °C. An aliquot of 50 ng cell lysate was loaded to 10% SDS-PAGE. After electrophoresis, the SDS-PAGE was transferred to PFDV membrane at 120 V and 4 °C for 105 min. The membrane was blocked in PBST (Phosphate Buffered Saline with 0.1% Tween-20) with 5% skim milk for 1 hour at room temperature and, after removing the blocking buffer, washed three times with PBST for additional 10 min. The primary antibodies of Cas9 (Cell Signaling Technology, Inc., Cas9 (7A9-3A3) mouse mAb, Cat. #: 14697) were 1000-fold diluted by fresh 0.1% PBST with 5% skim milk and added to the membrane for overnight at 4 °C. After the membrane was washed in PBST for three times, the secondary antibody (Goat Anti-Mouse IgG Secondary Antibody (HRP), Cat. #: SSA007) was 5000-fold diluted by fresh 0.1% PBST and then was added to the membrane for additional 2 hours at room temperature. Blotted membranes were imaged on a BioSpectrum 810 Imaging system.
MS method for protein identification and analysis
The protein targets were dissected from staining protein gels with Coomassie Blue. The protocol used for trypsin digestion of proteins in gels was adapted from the method described by Wilm and Mann30. Details of in-gel trypsin digestion prior to LC-MS/MS analysis are described in Supplementary Text. The finally dried pellet was re-dissolved in 10–20 μl of 0.1% formic acid for LC-MS/MS analysis; For details, see Supplementary Text.
gRNA integrated in Cas9-carrying yeast strain by PGASO
The six gRNA cassettes were together integrated into the selected Cas9-carrying strains using a modified PGASO technique15,16. We retained their own SNR52 promoters and SUP4 terminators in these gRNA cassettes. Used the same with PGASO cassettes promoter linker sequence (55 bp) to integrated into the Cas9-carrying strains genomics (Supplementary Fig. S8b). Details of guide RNA cassette construction and cassette integration into Cas9-carrying yeast strains by the modified PGASO technique are described in Supplementary Text.
Haploid selection and growth rates in different carbon sources and temperatures
These Matα3 knockout mutants were further streaked out for 5 generations for colony purification and then cultured in nutrient deficient medium at 25 °C for 3 days for producing spores via sporulation; for details see Supplementary Text.
We compared the growth rates of candidate haploids in different carbon sources and at different temperatures, as described in Supplementary Text.
Electronic supplementary material
Acknowledgements
We thank Hao-Yeh Lin, Marimuthu Anandharaj and Rizwana Parveen Rani for experimental assistance. We thank Chih-Yao Chang for his valuable suggestions. Mass spectrometric protein identifications and analyses were performed by the Proteomics Core Laboratory sponsored by the Institute of Plant and Microbial Biology and the Agricultural Biotechnology Research Center, Academia Sinica. This work is supported by Academia Sinica and Ministry of Science and Technology (104-2621-B-001-003-MY3). Ming-Hsuan Lee is supported Academia Sinica and Doctoral Degree Program in Marine Biotechnology, National Sun Yat-sen University.
Author Contributions
M.-H.L. and J.-J.C. designed the study. W.-H.L., Y.-J.L. and J.-J.C. advised the study. M.-H.L. and J.-J.L. conducted bioinformatics analyses. M.-H.L. did the experiments. M.-H.L., J.-J.L., Y.-J.L., H.-M.K., W.-L.F., T.-Y.W. and J.-J.C. discussed and commented on the study. M.-H.L., J.-J.L., Y.-J.L., H.-M.K., T.-Y.W. and W.-H.L. wrote the manuscript.
Competing Interests
The authors declare no competing interests.
Footnotes
Electronic supplementary material
Supplementary information accompanies this paper at 10.1038/s41598-018-25366-z.
Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Fonseca GG, Heinzle E, Wittmann C, Gombert AK. The yeast Kluyveromyces marxianus and its biotechnological potential. Applied microbiology and biotechnology. 2008;79:339–354. doi: 10.1007/s00253-008-1458-6. [DOI] [PubMed] [Google Scholar]
- 2.Lane MM, et al. Physiological and metabolic diversity in the yeast Kluyveromyces marxianus. Antonie Van Leeuwenhoek. 2011;100:507–519. doi: 10.1007/s10482-011-9606-x. [DOI] [PubMed] [Google Scholar]
- 3.Maccaferri S, Klinder A, Brigidi P, Cavina P, Costabile A. Potential probiotic Kluyveromyces marxianus B0399 modulates the immune response in Caco-2 cells and peripheral blood mononuclear cells and impacts the human gut microbiota in an in vitro colonic model system. Applied and environmental microbiology. 2012;78:956–964. doi: 10.1128/AEM.06385-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.EPoB, H. Scientific Opinion on the maintenance of the list of QPS biological agents intentionally added to food and feed (2012 update) (2011).
- 5.Pecota DC, Rajgarhia V, Da Silva NA. Sequential gene integration for the engineering of Kluyveromyces marxianus. Journal of biotechnology. 2007;127:408–416. doi: 10.1016/j.jbiotec.2006.07.031. [DOI] [PubMed] [Google Scholar]
- 6.Banat IM, Nigam P, Marchant R. Isolation of thermotolerant, fermentative yeasts growing at 52 C and producing ethanol at 45 C and 50 C. World Journal of Microbiology and Biotechnology. 1992;8:259–263. doi: 10.1007/BF01201874. [DOI] [PubMed] [Google Scholar]
- 7.Barsoum, E. Mating type switching and transcriptional silencing in Kluyveromyces lactis, The Wenner-Gren Institute, Stockholm University (2010).
- 8.Åström SU, Rine J. Theme and variation among silencing proteins in Saccharomyces cerevisiae and Kluyveromyces lactis. Genetics. 1998;148:1021–1029. doi: 10.1093/genetics/148.3.1021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Butler G, et al. Evolution of the MAT locus and its Ho endonuclease in yeast species. Proceedings of the National Academy of Sciences of the United States of America. 2004;101:1632–1637. doi: 10.1073/pnas.0304170101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Barsoum E, Martinez P, Åström SU. α3, a transposable element that promotes host sexual reproduction. Genes & development. 2010;24:33–44. doi: 10.1101/gad.557310. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Laurenson P, Rine J. Silencers, silencing, and heritable transcriptional states. Microbiological reviews. 1992;56:543–560. doi: 10.1128/mr.56.4.543-560.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Jakočiūnas T, et al. Multiplex metabolic pathway engineering using CRISPR/Cas9 in Saccharomyces cerevisiae. Metabolic engineering. 2015;28:213–222. doi: 10.1016/j.ymben.2015.01.008. [DOI] [PubMed] [Google Scholar]
- 13.Mans R, et al. CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae. FEMS yeast research. 2015;15:fov004. doi: 10.1093/femsyr/fov004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Horwitz AA, et al. Efficient multiplexed integration of synergistic alleles and metabolic pathways in yeasts via CRISPR-Cas. Cell systems. 2015;1:88–96. doi: 10.1016/j.cels.2015.02.001. [DOI] [PubMed] [Google Scholar]
- 15.Chang J-J, et al. Assembling a cellulase cocktail and a cellodextrin transporter into a yeast host for CBP ethanol production. Biotechnology for biofuels. 2013;6:19. doi: 10.1186/1754-6834-6-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Chang J-J, et al. PGASO: A synthetic biology tool for engineering a cellulolytic yeast. Biotechnology for biofuels. 2012;5:53. doi: 10.1186/1754-6834-5-53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Rajaei N, Chiruvella KK, Lin F, Åström SU. Domesticated transposase Kat1 and its fossil imprints induce sexual differentiation in yeast. Proceedings of the National Academy of Sciences. 2014;111:15491–15496. doi: 10.1073/pnas.1406027111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Barsoum E, Rajaei N, Åström SU. RAS/cyclic AMP and transcription factor Msn2 regulate mating and mating-type switching in the yeast Kluyveromyces lactis. Eukaryotic cell. 2011;10:1545–1552. doi: 10.1128/EC.05158-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Åström SU, Kegel A, Sjöstrand JO, Rine J. Kluyveromyces lactis Sir2p regulates cation sensitivity and maintains a specialized chromatin structure at the cryptic α-locus. Genetics. 2000;156:81–91. doi: 10.1093/genetics/156.1.81. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Benson DA, et al. GenBank. Nucleic Acids Research. 2013;41:D36–42. doi: 10.1093/nar/gks1195. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Nonklang S, et al. High-temperature ethanol fermentation and transformation with linear DNA in the thermotolerant yeast Kluyveromyces marxianus DMKU3-1042. Applied and environmental microbiology. 2008;74:7514–7521. doi: 10.1128/AEM.01854-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. Journal of molecular biology. 1990;215:403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
- 23.Xie S, Shen B, Zhang C, Huang X, Zhang Y. sgRNAcas9: a software package for designing CRISPR sgRNA and evaluating potential off-target cleavage sites. PloS one. 2014;9:e100448. doi: 10.1371/journal.pone.0100448. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Inokuma K, et al. Complete genome sequence of Kluyveromyces marxianus NBRC1777, a nonconventional thermotolerant yeast. Genome announcements. 2015;3:e00389–00315. doi: 10.1128/genomeA.00389-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Haeussler M, et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome Biology. 2016;17:148. doi: 10.1186/s13059-016-1012-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Doench JG, et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature biotechnology. 2014;32:1262–1267. doi: 10.1038/nbt.3026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Mali P, et al. RNA-guided human genome engineering via Cas9. Science. 2013;339:823–826. doi: 10.1126/science.1232033. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Abdel‐Banat B, Nonklang S, Hoshida H, Akada R. Random and targeted gene integrations through the control of non‐homologous end joining in the yeast Kluyveromyces marxianus. Yeast. 2010;27:29–39. doi: 10.1002/yea.1729. [DOI] [PubMed] [Google Scholar]
- 29.Sánchez M, Iglesias FJ, Santamaría C, Domínguez A. Transformation of Kluyveromyces lactis by electroporation. Applied and environmental microbiology. 1993;59:2087–2092. doi: 10.1128/aem.59.7.2087-2092.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Shevchenko A, Wilm M, Vorm O, Mann M. Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal Chem. 1996;68:850–858. doi: 10.1021/ac950914h. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.


