Skip to main content
Applications in Plant Sciences logoLink to Applications in Plant Sciences
. 2018 May 8;6(4):e1142. doi: 10.1002/aps3.1142

Low‐copy nuclear markers in Isoëtes (Isoëtaceae) identified with transcriptomes

Peter W Schafran 1,2,, Gabriel Johnson 2, W Carl Taylor 2, Elizabeth A Zimmer 2, Lytton J Musselman 1
PMCID: PMC5947607  PMID: 30131884

Abstract

Premise of the Study

Few genetic markers provide phylogenetic information in closely related species of Isoëtes (Isoëtaceae). We describe the development of primers for several putative low‐copy nuclear markers to resolve the phylogeny of Isoëtes, particularly in the southeastern United States.

Methods and Results

We identified regions of interest in Isoëtes transcriptomes based on low‐copy genes in other plants. Primers were designed for these regions and tested with 16 taxa of Isoëtes and one species of Lycopodium. Parts of the pgiC, gapC, and IBR3 gene regions show phylogenetic signal within the North American and Mediterranean clades of Isoëtes.

Conclusions

Transcriptome data prove useful for identification and primer design of low‐copy genes. Three new markers show potential for inferring phylogenies in regional clades of Isoëtes, and possibly across the entire genus.

Keywords: gapC, IBR3, Isoëtes, pgiC, primer design, Sanger sequencing


Isoëtes L. (Isoëtaceae, Lycopodiophyta) is a cosmopolitan genus of ca. 250 recognized species. These heterosporous lycophytes consist of a 2–3‐lobed rootstock that bears linear, quill‐like, microphyllous leaves or sporophylls. All microphylls have the potential to develop into sporophylls (Foster and Gifford, 1974). Mega‐ and microsporangia are produced at the base of sporophylls, in some species covered by a layer of tissue called a velum. Traditionally, spore ornamentation and velum coverage have been considered taxonomically important. Although species inhabit a variety of ecological niches, from obligate aquatic to ephemeral terrestrial habitats, their morphology is extremely conserved. Phylogenetic studies in closely related clades of Isoëtes have been limited by a dearth of morphological features and molecular markers. Hoot and Taylor (2001) identified the nuclear ribosomal gene internal transcribed spacer (ITS), a LEAFY homolog nuclear gene intron (LFY), and the plastid atpB‐rbcL spacer region as informative markers in Isoëtes. However, although these markers and the plastid rbcL gene show utility in large‐scale, global phylogenies, they generally lose resolution at the regional level (Rydin and Wikström, 2002; Hoot et al., 2006; Larsén and Rydin, 2016). LFY is more variable than the other three markers and is fairly informative in recently diverged species groups (Taylor et al., 2004; Hoot et al., 2004). With only a single informative nuclear marker within groups such as the eastern North American clade, it is difficult to fully test phylogenetic hypotheses of reticulate evolution and incomplete lineage sorting.

Transcriptomes provide a valuable tool for marker selection and PCR primer design in the absence of a sequenced genome, as is the case in Isoëtes. Databases such as the 1000 Plants project (http://www.onekp.com; Matasci et al., 2014) contain transcriptomes across all major lineages of land plants, allowing identification of unique marker regions for a group of interest. Here we describe use of transcriptome data to develop PCR primers for phylogenetically informative low‐copy nuclear markers in Isoëtes.

METHODS AND RESULTS

Markers of interest were selected based on a literature search of reportedly low‐copy nuclear markers in ferns and mosses (Table 1; Szövényi et al., 2006; Schuettpelz et al., 2008; Rothfels et al., 2013). Nucleotide sequences for these markers were obtained from the National Center for Biotechnology Information's (NCBI) GenBank (http://www.ncbi.nlm.nih.gov/genbank/; Clark et al., 2016) or TreeBASE (http://www.treebase.org; Sanderson et al., 1994) databases. Transcriptomes for three Isoëtes taxa were provided by other sources (I. echinospora Durieu from S. Hetherington, University of Oxford, Oxford, United Kingdom; and I. tegetiformans Rury and an unnamed Isoëtes species from the 1000 Plants project [http://www.oneKP.com]). Using the BLAST+ 2.4 software package (Camacho et al., 2009), local BLAST databases were constructed from each Isoëtes transcriptome. The sequences of selected fern (Rothfels et al., 2013) and moss (Szövényi et al., 2006) low‐copy nuclear markers were BLASTed against the transcriptome databases to identify those markers present as single‐copy in Isoëtes. These single‐copy marker regions were extracted from their respective transcriptome and aligned with marker sequences from the literature using Geneious version 7 (Kearse et al., 2012). Primer sequences from the literature were modified to match the Isoëtes transcriptome sequences.

Table 1.

Primers designed for low‐copy markers identified in Isoëtes transcriptomes

Marker ID Primer names Primer sequences (5′–3′) T a (°C)
pgiC pgiC_1156F
pgiC_1900R
F: GGTCTCCTAAGTGTCTGGAATGT 55
R: GTTCTCCAAAATCAATTTCTCC
IBR3_1 IBR3_2F
IBR3_6R
F: CTCAAATCAGCTCATGCAATTG 60
R: AGCTCCCAATCCAACACAGC
IBR3_2 IBR3_13F
IBR3_16R
F: CAATGACTGAACCGCAAGTTG 60
R: GACCCAACGAGTCTCATGCAG
Transducin_1 Transducin_1F
Transducin_1R
F: GATGTGGTTGGTGAGTCTGG 55
R: CACTTCATTGAACCTCAG
Transducin_2 Transducin_2F
Transducin_2R
F: GGAACAAAAGCAGGGACATTAG 55
R: CATCAGAAGAGATGTCCATAC
gapC_short gapC_5F
gapC_7R
F: GAATCTACTGGTGTCTTCAC 55
R: TTCTGGTTTATATTCATGCTCG
gapC_long gapC_5F
gapC_9R
F: GAATCTACTGGTGTCTTCAC 55
R: ATGGTCCATCAACAGTYTTCTG

F = forward; R = reverse; T a = annealing temperature.

Plants were collected from the field, and leaf tissue was desiccated with silica gel. Voucher specimens have been stored at the Old Dominion University herbarium (ODU) and/or the U.S. National Herbarium (US). DNA was extracted from approximately 200 mg of dried tissue with the QIAGEN DNeasy Plant Mini Kit (QIAGEN Inc., Valencia, California, USA) or AutogenPrep 965 (Autogen Inc., Holliston, Mississippi, USA) using standard protocols. Sixteen diploid taxa of Isoëtes and one species of Lycopodium L. (one individual per taxon) were selected from available DNAs to represent various levels of divergence (Appendix 1).

Markers were amplified by PCR on an ABI 2720 thermocycler (Thermo Fisher Scientific Inc., Waltham, Massachusetts, USA), with a reaction mixture of 12.5 μL of 2× GoTaq PCR master mix (Promega Corporation, Madison, Wisconsin, USA), 0.5 μL of 0.1 mg/mL bovine serum albumin, 1.0 μL each of 10 μM forward and reverse primer, 7.5 μL of sterile distilled water, and 2.5 μL of DNA template (10–60 ng). PCR reactions were carried out with an initial melting period at 94°C (5 min), followed by 35 cycles of 94°C (30 s), annealing at 55–60°C (30 s), and extension at 72°C (1 min), with a final extension at 72°C (7 min). Amplification success was confirmed by electrophoresis using a 1.5% sodium boric acid–based agarose gel.

Markers were selected for Sanger sequencing based on their producing a single band across all samples and for a maximum size of ~1000 bp. PCR products were treated with ExoSAP‐IT PCR cleanup enzyme mix (Affymetrix Inc., Santa Clara, California, USA) before cycle sequencing with BigDye Terminator v3.1 (Thermo Fisher Scientific Inc.). The labeled sequencing fragments were read on an ABI 3130xl Genetic Analyzer (Thermo Fisher Scientific Inc.), and the resulting chromatograms were edited and analyzed using Geneious (Kearse et al., 2012).

Initial screening of primers showed that all amplify in at least some of the eastern North American taxa. Gel electrophoresis revealed that IBR3_1 and Transducin_2 are too long (~2000 bp) and Transducin_1 has both short and long copies in some individuals (~500 bp and ~1000 bp), making these poor candidates for a Sanger sequencing approach without needing molecular cloning or gel extraction. Although gapC_short readily amplified, it is contained within gapC_long, making sequencing of the shorter fragment redundant. pgiC, IBR3_2 (hereafter IBR3), and gapC_long (hereafter gapC) were selected for PCR and sequencing of the full taxa list (Appendices 2, 3).

pgiC

This primer pair is rooted in exons 14 and 16, and amplifies across introns 14, 15, and exon 15 of this locus (Rothfels et al., 2013). The region amplified easily across all taxa of Isoëtes and Lycopodium clavatum L., and generated consistently high‐quality sequence data. All sequences aligned well, with a total alignment length of 466 bp and pairwise identity of 83%. Excluding L. clavatum, alignment length decreases to 357 bp and pairwise identity increases to 89%. Sequence length between these species of Isoëtes ranges from 310 to 347 bp, with a mean of 324 bp (Table 2). This is approximately half the length of the same region in ferns tested by Rothfels et al. (2013).

Table 2.

Alignment statistics for all sequences with quality scores >85%

Marker Isoëtes Lycopodium + Isoëtes
Amplicon length range, bp (Mean) Alignment length, bp Pairwise % identity No. of identical sites (%) No. of PIS (%) Amplicon length range, bp (Mean) Alignment length, bp Pairwise % identity No. of identical sites (%) No. of PIS (%)
pgiC 310–347 (324) 357 89 240 (67) 80 (22) 310–458 (331) 466 83 192 (41) 82 (18)
IBR3 587–682 (659) 700 87 415 (59) 111 (16)
gapC 443–543 (507) 561 85 304 (54) 95 (17)

PIS = parsimony informative sites.

gapC

The gapC gene encodes cytosolic glyceraldehyde‐3‐phosphate and is part of the GAPDH gene family (Strand et al., 1997; Wall, 2002; Szövényi et al., 2006). Primers designed by Szövényi et al. (2006) are rooted in exons 5 and 9 and amplify all exons and introns in between. However, given concern that the resulting marker in Isoëtes may be too long for Sanger sequencing, the primers designed for this study were rooted in exons 5 and 8, amplifying introns 5, 6, 7, and exons 6 and 7.

This marker showed the least ability to routinely generate high‐quality sequence data. Although not detected in any of the transcriptomes available, it is possible this results from off‐target amplification of other members of the GADPH gene family (i.e., gapCp or an unnamed gapC/gapCp relative) (Schuettpelz et al., 2008; Rothfels et al., 2013). The Isoëtes‐only alignment is 561 bp and has a pairwise identity of 85% (Table 2).

IBR3

Unlike pgiC and gapC, this gene does not have an extensive history of use as a phylogenetic marker. The IBR3 gene is thought to encode an indole‐3‐butyric acid–specific peroxisomal enzyme related to acyl‐CoA dehydrogenases (Zolman et al., 2007). Rothfels et al. (2013) showed it to be single‐copy throughout selected fern lineages, and this also appears to be the case in Isoëtes. Primers for the IBR3 marker amplify most species of Isoëtes easily, with the exception of two members of the Mediterranean clade (I. histrix Bory & Durieu and I. nuttallii A. Braun ex Engelm.). Alignment of Isoëtes sequences is 700 bp long with 87% pairwise identity (Table 2).

CONCLUSIONS

Transcriptome mining is shown to be a useful tool for identification of putative low‐copy markers for primer design. Despite having access to transcriptomes of just three species of Isoëtes in the North American clade, primers could be designed for regions that show phylogenetic signal across widely divergent clades in the genus, and potentially across all Lycopodiophyta. Although techniques such as target enrichment allow for generation of data sets orders of magnitude larger (Mandel et al., 2014), design of primers for Sanger sequencing is still more time‐ and cost‐efficient in taxonomic groups for which just a few markers may be needed to infer well‐resolved phylogenies.

ACKNOWLEDGMENTS

The authors wish to thank Sandy Hetherington of the University of Oxford (Oxford, United Kingdom) and the 1000 Plants project (http://www.oneKP.com) for providing Isoëtes transcriptomes used for primer design. Funding was provided by the Mary Payne Hogan endowment at Old Dominion University and the Smithsonian Institution Fellowship Program. All or portions of the laboratory and/or computer work were conducted in and with the support of the Laboratories of Analytical Biology of the National Museum of Natural History or its partner labs.

APPENDIX 1. Collection locations, vouchers, and GenBank accessions for taxa included in this study.

Taxona Phylogenetic cladeb Collection locality Voucher (Herbarium)c GenBank accession no.
pgiC IBR3 gapC
Isoëtes butleri Engelm. Clade E Texas, USA Schafran 47 (ODU) KY243331 KY270816 KY270832
I. echinospora Durieu Clade E New York, USA Schafran NY‐4 (ODU) KY243333 KY270818 KY270835
I. engelmannii A. Braun Clade E Tennessee, USA Schafran 46 (ODU) KY243334 KY270819
I. flaccida Shuttlew. var. chapmanii Engelm. Clade E( (= I. flaccida) Florida, USA Bolin JB_FL_01 (ODU) KY243332 KY270817 KY270833
I. flaccida var. flaccida Clade E Florida, USA Schafran FL‐01 (ODU) KY243335 KY270820 KY270836
I. histrix Bory & Durieu Clade E Sicily, Italy A. Troia s.n.d KY243347
I. lithophila N. Pfeiff. Clade E Texas, USA Schafran 61 (ODU) KY243336 KY270822 KY270838
I. longissima Bory Clade B )(= I. velata) Sicily, Italy A. Troia s.n.d KY243348 KY270823 KY270839
I. melanopoda J. Gay & Durieu subsp. melanopoda Clade E Mississippi, USA Taylor 6796 (US) KY243338 KY270825 KY270841
I. melanopoda subsp. silvatica D. F. Brunt. & D. M. Britton Clade E
(= I. melanopoda s.l.)
North Carolina, USA Schafran NC‐05 (ODU) KY243342 KY270828 KY270845
I. melanospora Engelm. Clade E Georgia, USA Schafran 12 (ODU) KY243339 KY270826 KY270842
I. nuttallii A. Braun ex Engelm. Clade B California, USA Taylor 6734 (US) KY243351
I. piedmontana (N. Pfeiff.) C. F. Reed Georgia, USA Schafran 18 (ODU) KY243341 KY270827 KY270844
I. storkii T. C. Palmer Clade E Costa Rica Taylor 6760 (US) KY243352 KY270829 KY270846
I. tegetiformans Rury Georgia, USA Schafran 19 (ODU) KY243343 KY270830 KY270847
I. valida (Engelm.) Clute Clade E Pennsylvania, USA Schafran 37 (ODU) KY243344 KY270831
Lycopodium clavatum L. New York, USA Schafran s.n.e MG434746

a One individual was sampled per taxon.

b Per Larsén and Rydin (2016).

c Herbaria are abbreviated according to Index Herbariorum (http://sweetgum.nybg.org/science/ih/).

d Tissue samples provided by A. Troia (Università degli Studi di Palermo, Palermo, Italy); not deposited in a recognized herbarium.

e Voucher deposited in P. Schafran's personal collection.

APPENDIX 2. Amplification and sequence quality of markers across taxa.

Taxon Amplification Sequencing
pgiC IBR3 gapC pgiC IBR3 gapC
Isoëtes butleri + + + + + +
I. echinospora + + + + + +
I. engelmannii + + + + +
I. flaccida var. chapmanii + + + + + +
I. flaccida var. flaccida + + + + + +
I. histrix + + NA NA
I. lithophila + + + + + +
I. longissima + + + + + +
I. melanopoda subsp. melanopoda + + + + + +
I. melanopoda subsp. silvatica + + + + + +
I. melanospora + + + + + +
I. nuttallii + + NA NA
I. piedmontana + + + + + +
I. storkii + + + + + +
I. tegetiformans + + + + + +
I. valida + + + + +
Lycopodium clavatum + + + NA

+ = successful amplification or sequence quality >85%; — = no amplification or sequence quality <85%; NA = sequencing not attempted.

APPENDIX 3. Pairwise number of nucleotide differences between pgiC/IBR3/gapC sequences.

I. butleri I. echinospora I. engelmannii I. flaccida var. chapmanii I. flaccida var. flaccida I. histrix I. lithophila I. longissima I. melanopoda subsp. melanopoda I. melanopoda subsp. silvatica I. melanospora I. nuttallii I. piedmontana I. storkii I. tegetiformans I. valida
I. echinospora 10/34/37
I. engelmannii 4/30/— 8/26/—
I. flaccida var. chapmanii 6/56/44 10/57/28 2/52/—
I. flaccida var. flaccida 6/56/43 10/58/28 2/53/— 0/3/10
I. histrix 73/—/— 78/—/— 72/—/— 70/—/— 70/—/—
I. lithophila 4/41/51 6/36/40 2/39/— 4/68/45 4/69/44 79/—/—
I. longissima 74/217/206 78/225/194 73/218/— 73/236/188 73/235/191 49/—/— 74/225/198
I. melanopoda subsp. melanopoda 8/33/57 10/13/47 6/28/— 6/59/53 6/60/51 72/—/— 4/38/15 74/221/208
I. melanopoda subsp. silvatica 8/35/35 11/36/26 4/28/— 6/61/31 6/62/29 74/—/— 6/40/37 74/225/198 10/38/44
I. melanospora 9/26/47 12/23/32 5/16/— 7/47/37 7/48/36 75/—/— 7/34/30 75/218/201 11/25/36 1/27/37
I. nuttallii 67/—/— 69/—/— 68/—/— 70/—/— 70/—/— 54/—/— 81/—/— 49/—/— 72/—/— 69/—/— 70/—/—
I. piedmontana 8/26/40 11/23/14 4/16/— 6/47/30 6/48/27 74/—/— 6/34/42 74/218/191 10/25/44 0/27/25 1/2/36 69/—/—
I. storkii 13/29/47 15/24/34 11/25/— 11/50/14 11/50/16 77/—/— 4/30/37 75/220/192 9/26/45 15/29/34 16/21/38 73/—/— 15/21/36
I. tegetiformans 7/31/54 10/28/40 6/21/— 8/53/40 8/54/36 72/—/— 5/40/54 74/221/197 10/30/61 10/28/38 11/19/47 67/—/— 10/19/38 14/24/42
I. valida 6/52/— 14/51/— 8/48/— 10/14/— 10/15/— 75/—/— 8/62/— 75/239/— 12/53/— 12/56/— 13/44/— 67/—/— 12/44/— 17/44/— 11/48/—
Lycopodium clavatum 227/—/— 229/—/— 226/—/— 225/—/— 225/—/— 225/—/— 248/—/— 227/—/— 223/—/— 228/—/— 229/—/— 236/—/— 228/—/— 226/—/— 229/—/— 228/—/—

Schafran, P. W. , Johnson G., Taylor W. C., Zimmer E. A., and Musselman L. J.. 2018. Low‐copy nuclear markers in Isoëtes (Isoëtaceae) identified with transcriptomes. Applications in Plant Sciences 6(4): e1142.

LITERATURE CITED

  1. Camacho, C. , Coulouris G., Avagyan V., Ma N., Papadopoulos J., Bealer K., and Madden T. L.. 2009. BLAST+: Architecture and applications. BMC Bioinformatics 10: 421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Clark, K. , Karsch‐Mizrachi I., Lipman D. J., Ostell J., and Sayers E. W.. 2016. GenBank. Nucleic Acids Research 44(D1): D67–D72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Foster, A. S. , and Gifford E. M. Jr. 1974. Comparative morphology of vascular plants. W. H. Freeman and Company, San Francisco, California, USA. [Google Scholar]
  4. Hoot, S. B. , and Taylor W. C.. 2001. The utility of nuclear ITS, a LEAFY homolog intron, and chloroplast atpBrbcL spacer region data in phylogenetic analyses and species delimitation in Isoëtes . American Fern Journal 91(3): 166–177. [Google Scholar]
  5. Hoot, S. B. , Napier N. S., and Taylor W. C.. 2004. Revealing unknown or extinct lineages within Isoëtes (Isoëtaceae) using DNA sequences from hybrids. American Journal of Botany 91(6): 899–904. [DOI] [PubMed] [Google Scholar]
  6. Hoot, S. B. , Taylor W. C., and Napier N. S.. 2006. Phylogeny and biogeography of Isoëtes (Isoëtaceae) based on nuclear and chloroplast DNA sequence data. Systematic Botany 31(3): 449–460. [Google Scholar]
  7. Kearse, M. , Moir R., Wilson A., Stones‐Havas S., Cheung M., Sturrock S., Buxton S., et al. 2012. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28(12): 1647–1649. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Larsén, E. , and Rydin C.. 2016. Disentangling the phylogeny of Isoetes (Isoetales), using nuclear and plastid data. International Journal of Plant Sciences 177(2): 157–174. [Google Scholar]
  9. Mandel, J. R. , Dikow R. B., Funk V. A., Masalia R. R., Staton S. E., Kozik A., Michelmore R. W., et al. 2014. A target enrichment method for gathering phylogenetic information from hundreds of loci: An example from the Compositae. Applications in Plant Sciences 2(2): 1300085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Matasci, N. , Hung L. H., Yan Z., Carpenter E. J., Wickett N. J., Mirarab S., Nguyen N., et al. 2014. Data access for the 1,000 Plants (1KP) project. GigaScience 3: 17 https://doi.org/10.1186/2047-217X-3-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Rothfels, C. J. , Larsson A., Li F. W., Sigel E. M., Huiet L., Burge D. O., Ruhsam M., et al. 2013. Transcriptome‐mining for single‐copy nuclear markers in ferns. PLoS One 8(10): e76957. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Rydin, C. , and Wikström N.. 2002. Phylogeny of Isoëtes (Lycopsida): Resolving basal relationships using rbcL sequences. Taxon 51(1): 83–89. [Google Scholar]
  13. Sanderson, M. J. , Donoghue M. J., Piel W. H., and Eriksson T.. 1994. TreeBASE: A prototype database of phylogenetic analyses and an interactive tool for browsing the phylogeny of life. American Journal of Botany 81(6): 183. [Google Scholar]
  14. Schuettpelz, E. , Grusz A. L., Windham M. D., and Pryer K. M.. 2008. The utility of nuclear gapCp in resolving polyploid fern origins. Systematic Botany 33(4): 621–629. [Google Scholar]
  15. Strand, A. E. , Leebans‐Mack J., and Milligan B. G.. 1997. Nuclear DNA‐based markers for plant evolutionary biology. Molecular Ecology 6: 113–118. [DOI] [PubMed] [Google Scholar]
  16. Szövényi, P. , Hock Z., Urmi E., and Schneller J.. 2006. New primers for amplifying the GapC gene in bryophytes and its utility in infraspecific phylogenies in the genus Sphagnum . Lindbergia 31: 78–84. [Google Scholar]
  17. Taylor, W. C. , Lekschas A. R., Wang Q. F., Liu X., Napier N. S., and Hoot S. B.. 2004. Phylogenetic relationships of Isoëtes (Isoëtaceae) in China as revealed by nucleotide sequences of the nuclear ribosomal ITS region and the second intron of a LEAFY homolog. American Fern Journal 94(4): 196–205. [Google Scholar]
  18. Wall, D. P. 2002. Use of the nuclear gene glyceraldehyde 3‐phosphate dehydrogenase for phylogeny reconstruction of recently diverged lineages in Mitthyridium (Musci: Calymperaceae). Molecular Phylogenetics and Evolution 25(1): 10–26. [DOI] [PubMed] [Google Scholar]
  19. Zolman, B. K. , Nyberg M., and Bartel B.. 2007. IBR3, a novel peroxisomal acyl‐CoA dehydrogenase‐like protein required for indole‐3‐butyric acid response. Plant Molecular Biology 64: 59–72. [DOI] [PubMed] [Google Scholar]

Articles from Applications in Plant Sciences are provided here courtesy of Wiley

RESOURCES