Skip to main content
PLOS One logoLink to PLOS One
. 2018 May 16;13(5):e0196736. doi: 10.1371/journal.pone.0196736

Sarcopoterium spinosum extract improved insulin sensitivity in mice models of glucose intolerance and diabetes

Konstantin Rozenberg 1, Tovit Rosenzweig 1,*
Editor: Claudia Miele2
PMCID: PMC5955592  PMID: 29768504

Abstract

Background

The glucose lowering properties of Sarcopoterium spinosum, a traditional medicinal plant, were previously validated by us using KK-Ay mice as a genetic model for type 2 diabetes (T2D).

Objective

To clarify the effects of Sarcopoterium spinosum extract (SSE) on diet-induced glucose intolerance and to investigate SSE effects on carbohydrate and lipid metabolism in target tissues of both high-fat-diet (HFD)-fed and KK-Ay mice.

Results

Mice were given SSE (70 mg/day) for 6 weeks. SSE improved glucose tolerance and insulin sensitivity in HFD-fed mice as was demonstrated previously in KK-Ay mice. Higher insulin sensitivity was validated by lower serum insulin and activation of the insulin signaling cascade in skeletal muscle and liver of SSE-treated mice in both models. H&E staining of the livers demonstrated lower severity of steatosis in SSE-treated mice. Several model-specific effects of SSE were observed–mRNA expression of proinflammatory genes and CD36 was reduced in SSE-treated KK-Ay mice. Hepatic mRNA expression of PEPCK was also reduced in SSE-treated KK-Ay mice, while other genes involved in carbohydrates and lipid metabolism were not affected. HFD-fed mice treated by SSE had elevated hepatic glycogen stores. Gluconeogenic gene expression was not affected, while GCK expression was increased. HFD-induced hepatic steatosis was not affected by SSE. However, while genes involved in lipid metabolism were downregulated by HFD, this was not found in HFD-fed mice given SSE, demonstrating an expression profile which is similar to that of standard diet-fed mice.

Conclusion

Our study supports the insulin sensitizing activity of SSE and suggests that this extract might improve other manifestations of the metabolic syndrome.

Introduction

Diabetes mellitus (DM) has reached epidemic proportions, affecting more than 170 million individuals worldwide and the number of affected subjects is expected to further increase in the coming years [1]. The most common form of DM is type 2 diabetes (T2D), accounting for more than 90% of diabetes cases. T2D is considered to be one of the major causes for premature illness and death in the western world [2,3]. The increased morbidity and mortality associated with T2DM is a result of chronic hyperglycemia, dyslipidemia, low-grade chronic inflammation, and other metabolic disturbances accompanying the disease.

Several drugs, acting via various mechanisms, are approved for treatment of diabetes. However, despite the availability of these medications acting on different targets, around 50% of patients failed to maintain glycemic control according to the treatment's goals as recommended by international diabetic associations [4,5]. These data further illustrate the continual need for additional research and development of alternative drugs with novel mechanisms to slow disease progression and its related complications.

In recent years, considerable attention has been directed to identify plants with anti-diabetic activity. Such plants may be consumed as medicinal herbs to improve glycemic control or its active constituents isolated and identified in order to develop a chemical drug. Even with the presence of ethno-pharmacological evidence for the use of certain herbs for medicinal purposes, most regulatory agencies demand both preclinical and clinical efficacy data to approve herbs for human consumption [6]. Accordingly, there is a need for intense, thorough, and wide research on candidate plants with putative antidiabetic activity. Approximately 1000 plants are reported to have been used to treat diabetes, based on ethnobotanical information [7]. Experimental validation of anti-diabetic action has been performed on around 400 medicinal plants. However, extensive research, including in-vivo experiments, using appropriate models of T2D and exploration of the mechanism of action, is available for the minority of these herbs [8–10]. Moreover, results of well-designed clinical trials are available only for a very limited number of these traditionally used medicinal herbs, with major variability in results. As a result, the number of anti-diabetic plants with a strong scientific basis supporting their safety and efficacy is extremely limited.

The antidiabetic activity of Sarcopoterium spinosum root extract (SSE) was reported by several ethnobotanical surveys [11–14] and was already demonstrated by us using in-vitro models [15,16]. Antidiabetic properties were also found in extracts of aerial parts of S. spinosum [17]; however, root extract, which is the organ recommended for use by traditional medicine, exerts the most potent effects. In addition, improved glucose tolerance and insulin sensitivity were found in a genetic mice model of type 2 diabetes treated by this extract [15,16]. As T2D is a disease developed in genetic-susceptible subjects as a result of exposure to a diabetogenic environment, it is important to clarify the potential effects of SSE on diet-induced glucose intolerance. In this study, the effect of SSE on glucose tolerance in diet-induced insulin-resistant mice is investigated for the first time. In addition, the effect of SSE on metabolic pathways involved in carbohydrates and lipids metabolism in skeletal muscle and liver of two mice models of insulin resistance, both genetic and diet-induced, is analyzed.

Materials and methods

Chemicals reagents and antibodies

D-Glucose and insulin were purchased from Sigma. Protease inhibitors were purchased from Merck. The following antibodies was purchased from Cell Signaling Technologies: Monoclonal rabbit anti-phospho-insulin receptor β (Tyr1150/1151, #3024), monoclonal rabbit anti-insulin receptor β (#3025, dilution used 1:1000), polyclonal rabbit anti-phospho-PKB (Ser473, #9271), monoclonal rabbit anti-PKB (pan, #4685), monoclonal rabbit anti-phospho-GSK3β (Ser9) (#5538), monoclonal mouse anti-GSK3β (#9832), and monoclonal mouse anti-phospho-PRAS40 (Thr246 (#13175S), all diluted at 1:1000. A monoclonal mouse anti-Actin was obtained from MP Biomedicals (#69100) and used in 1:10000 dilution. Secondary antibodies were purchased from Jackson Immuno Research, Peroxidase conjugated affiniPure goat anti mouse (#115-035-003) and Peroxidase conjugated affiniPure goat anti rabbit (#111-035-003) both were used in 1:1000 dilution.

Methods

S. spinosum extract preparation

Sarcopoterium spinosum (L.) Spach. [Thorny burnet, local name: Natesh, Billan (Arabic), Sira Kotzanit (Hebrew), the plant name has been checked with http://www.theplantlist.org.] was collected from the wild in the area around Ariel University, in accord with the laws of Israel' authorities for biodiversity. The plants were identified by Dr. Dvir Taler, an agronomics and botanist consultor, based on morphological and binocular analyses. A voucher specimen of the plant was deposited in the Israel National Herbarium at the Hebrew University of Jerusalem (No. HUJ 102531). S. spinosum aqueous root extract was prepared, as described previously [15,16], by boiling 100 g roots/L. The extract was lyophilized and kept at -20°C, giving a yield of 0.7% dry material. To ensure the uniformity of the extract, the herbs used for the study were of the same ecotype throughout the study and were uprooted during the same season. The uniformity of the extracts was maintained by performing a set of measurements, including several bioassays that were developed based on the biological activity of the extract and RPLC analysis, as described previously [17]. Catechin level was quantified based on calibration curve, and found to be at a concentration of 7μg/mg dry extract.

Experimental protocol

The protocol of the study was approved by the Committee on the Ethics of Animal Experiments of the University of Ariel (Permit Number: IL-73-09-15). The Animal House in Ariel University operates in compliance with the rules and guidelines of the Israel Council for Research on Animals, based on the US NIH Guide for the Care and Use of Laboratory Animals. The mice were housed in an animal laboratory with a controlled environment of 20–24°C, 45–65% humidity, and a 12 h light/dark cycle. Animals had been anesthetized by ketamine + xylazine as required, and all efforts were made to minimize suffering.

The study was performed on KK-Ay mice, a genetic model of T2D and on a model of diet-induced glucose intolerance, using high fat diet-fed C57bl/6 mice (HFD, 60% of total calories derived from fatty acids, 18.4% from proteins, and 21.3% from carbohydrates, Envigo, Teklad TD.06414). For these experiments, 6 week old male mice were separated into treatment groups, 8–10 mice each. KK-Ay male mice were separated into 2 groups as follows: control-untreated mice and SSE-treated mice. The mice were fed with standard (STD) diet (18% of total calories derived from fat, 24% from proteins, and 58% from carbohydrates. Harlan, Teklad TD.2018). C57Bl/6J mice were purchased from Envigo (Israel). C57bl/6 male mice were separated into 3 treatment groups, 8–10 mice each, as follows: control mice fed with STD or HFD, and HFD-fed mice supplemented with S. spinosum extract. SSE (35 mg/day or 100 mg/day dry material in C57BL6/J and KK-Ay mice, respectively) was administered daily in the drinking water starting at age 6 weeks. Body weight was measured once a week. At age of 12 or 17 weeks in the KK-Ay or C57Bl/6J, respectively, mice were anesthetized using ketamine + xylazine and euthanized by terminal bleeding followed by cervical dislocation. Blood was collected from the heart and serum was prepared. Serum insulin was measured by immunoassay, using a commercial ELISA kit (Mercodia, Sweden). Livers were perfused and both liver and soleus muscle were isolated. In order to follow insulin-induced protein phosphorylation in liver and skeletal muscle, in some of the mice (n = 5), insulin was injected (0.75 mU /g body weight) 15 min before killing the animal. Liver and muscle were snap frozen in liquid nitrogen, and preserved in -80°C for later protein and RNA extraction. Part of the livers were saved in 4% paraformaldehyde for histological analyses.

Glucose tolerance test (GTT)

Intraperitoneal glucose tolerance test (GTT) was performed on C57bl/6 mice at age 15 weeks. Mice were injected with 1.5 mg glucose/g body weight after 6-h fast. Blood glucose was determined from tail blood using the ACCU-CHEK Go glucometer (Roche, Germany).

Western blot analysis

Protein lysates were prepared using RIPA buffer supplemented with protease and phosphatase inhibitors. The samples were homogenized and centrifuged at 14,000 rpm for 20 min. The supernatant was collected and protein concentration was measured using the Bradford method. 20 μg protein per lane was separated by SDS-polyacrylamide gel electrophoresis. Proteins were electrophoretically transferred onto nitrocellulose membranes. The membranes were blocked in 5% dry milk, incubated with the appropriate antibodies solutions (5% BSA in 0.01% TBST) and proteins were immunodetected using the enhanced chemiluminescence method.

Analysis of mRNA expression by real-time PCR

Total RNA was extracted from the liver using TRI reagent (Molecular Research Center, Inc. Cincinnati, OH) according to manufacturer instructions. Of total RNA, 3 μg were reverse transcribed by oligo-dT priming (Stratascript 5.0 multi-temperature reverse transcriptase, Stratagene) according to manufacturer instructions. Real-time PCR amplification reactions were performed using SYBR Fast Universal Ready-mix Kit (Kappa Biosystems), by the MxPro QPCR instrument (Stratagene). Primers for real time PCR reactions were synthesized by Sigma, Israel. Primer sequences are listed in Table 1.

Table 1. Primers list.
Gene Forward Reverse
PPARα ATGCCAGTACTGCCGTTTTC CCGAATCTTTCAGGTCGTGT
PPARγ CAGGCCTCATGAAGAACCTT ACCCTTGCATCCTTCACAAG
SREBP2 AGAGGCGGACAACACACAAT ACGCCAGACTTGTGCATCTT
SREBP1c AAGAGCCCTGCACTTCTTGA CCACAAAGAAACGGTGACCT
HSL TGCTCTTCTTCGAGGGTGAT TCTCGTTGCGTTTGTAGTGC
ACC1 CATGAACACCCAGAGCATTG ATTTGTCGTAGTGGCCGTTC
FAS TTGCTGGCACTACAGAATGC AACAGCCTCAGAGCGACAAT
AdipoR1 TCGTGTATAAGGTCTGGGAG GCAGATGTGTCCAGATGTTG
AdipoR2 CCCAGGAAGATGAAGGGTTT TTAAGCCAATCCGGTAGCAC
CD36 AGCAGCTGCACCACATATCTAC GGAACCAAACTGAGGAATGG
GCK GCAGAAGGGAACAACATCGT TGGCGGTCTTCATAGTAGCA
PEPCK AGCCTTTGGTCAACAACTGG GTTATGCCCAGGATCAGCAT
G6Pase GATTCCGGTGTTTGAACGTC GTAGAATCCAAGCGCGAAAC
GLUT-2 TGGGCTAATTTCAGGACTGG TGCCCAGAATAAAGCTGAGG
CPT-1 GATGTGGACCTGCATTCCTT TCCTTGTAATGTGCGAGCTG
HMGCR CGTAACCCAAAGGGTCAAGA GACAGCCAAAAGGAAGGCTA
AdipoR1 TCGTGTATAAGGTCTGGGAG GCAGATGTGTCCAGATGTTG
AdipoR2 CCCAGGAAGATGAAGGGTTT TTAAGCCAATCCGGTAGCAC
PAI-1 GGGCAAACAGTTGCGTAAAG TGTTGATCGGGTCTTCTTCC
MCP-1 CACTCACCTGCTGCTACTCATT TCTGGACCCATTCCTTCTTG
CRP AGATCCCAGCAGCATCCATA TCTGCTTCCAGAGACACATAGG
IKK CACGTTGGACATGGATCTTG TTCCTCAGCTGGAAGAAGGA
HPRT TGTTGTTGGATATGCCCTTG TTGCGCTCATCTTAGGCTTT

Hepatic triglyceride (TG) content

One hundred milligrams of liver were homogenized in 1 ml water solution containing 5% NP-40. The samples were twice heated to 80–100°C for 5 min and cooled to room temperature. The sample was centrifuged for 2 min and the supernatant was used for TG analysis using a Triglyceride quantification kit (Abcam, Cambridge, UK) according to manufacturer instructions.

Hepatic total cholesterol levels

Ten milligrams of liver were homogenized in a solution of Chloroform: Isopropanol: NP-40 (7:11:0.1). The organic phase was collected and vacuum dried for about 2 h, resuspended in a cholesterol assay buffer supplied by Abcam and used in a Cholesterol/Cholesteryl Ester quantitation kit (Abcam, Cambridge, UK) according to manufacturer instructions.

Hepatic glycogen content

Ten milligrams of liver were homogenized in a glycogen hydrolysis buffer supplied by Abcam. The sample was centrifuged for 5 min and the supernatant was used for glycogen analysis using the Glycogen Assay Kit II (Abcam, Cambridge, UK) according to manufacturer instructions.

Histochemistry

Livers were perfused, isolated, fixed in 4% paraformaldehyde and embedded in paraffin. Consecutive 4 μm sections were cut and stained with hematoxylin and eosin (H&E). A steatosis score was attained through blinded evaluation by a pathologist. Scoring of liver sections was carried out according to Modified Brunt criteria of staging and grading of non-alcoholic fatty liver disease (NAFLD) [18].

Statistical analysis

Values are presented as mean± SEM. Statistical differences between the treatments and controls were tested by unpaired two-tailed Student's t-test or one-way analysis of variance (ANOVA), followed by Bonferroni's post-hoc testing when appropriate. Analysis was performed using the GraphPad Prism 5.0 software. A difference of p<0.05 or less in the mean values was considered statistically significant.

Results

Sarcopoterium spinosum improved glucose tolerance in HFD-fed mice

HFD consumption is known to induce alteration in insulin sensitivity leading to glucose intolerance and a state of prediabetes [19]. HFD-fed mice were given SSE for 10 weeks and the effects on body weight and glucose homeostasis were followed. Food consumption and drinking habits were measured demonstrating lower food consumption in HFD-fed groups and no difference between all 3 groups in drinking habits (data not shown). Body weight was higher in HFD-fed mice, with no effect of S. spinosum on the rate of body weight accumulation (Fig 1A). Fasting blood glucose and glucose disposal rate following intraperitoneal glucose load was altered in HFD-fed mice. SSE did not affect fasting glucose levels but improved glucose tolerance of the HFD-fed mice (Fig 1B), an effect that was accompanied by reduced fasting serum insulin levels (Fig 1C). These results indicate a positive effect of SSE on the pre-diabetic hyper-insulinemic HFD- fed mice.

Fig 1. S. spinosum improved glucose tolerance in HFD-fed mice.

Fig 1

C57BL/J mice were fed STD or HFD with or without SSE given in their drinking water as described in Methods. (A) Body weight was measured every week. (B) GTT was performed at age 15 weeks as described in Materials and Methods. (C) Fasting serum insulin levels were measured at age 17 weeks. The result are presented as mean±SE, *p<0.05, **p< 0.005, ***p< 0.0005 by Student's t-test, compared to HFD-fed mice.

S. spinosum improved insulin signaling in soleus muscle and liver of HFD- fed mice

In order to determine whether the improvement in glucose tolerance in HFD- fed mice supplemented by SSE is mediated by elevated activation of the insulin signaling cascade, the phosphorylation of key proteins mediating insulin signal transduction was followed in the soleus muscle and liver. HFD abolished insulin-induced phosphorylation of IR and PRAS40 in soleus muscle, while a residual phosphorylation of PKB remains (Fig 2). A significant increase in insulin-induced phosphorylation of IR, PKB and PRAS40 was demonstrated in SSE-treated mice compared to their HFD-fed littermates (Fig 2). Interestingly, basal IR phosphorylation was increased by SSE as well. On the other hand, HFD feeding increased basal phosphorylation of IR and GSK in the liver. SSE increased further basal phosphorylation of GSK3β (Fig 3), as well as insulin-induced phosphorylation of IR and PRAS40, while PKB was almost not affected either by HFD or by SSE. These findings revealed that SSE increased the activation of insulin signaling cascade in the muscle and the liver, in a tissue-specific manner.

Fig 2. S. spinosum enhances insulin signaling in muscle of HFD-fed mice.

Fig 2

C57BL/J mice model were fed STD, HFD or HFD+ S. spinosum. Soleus muscle was removed at the age of 17 weeks as described in Methods. (A) Western blot analysis was performed on protein lysates of muscle using specific antibodies. (B) The bar graphs are the results of optical density measurements of western blots. Each bar represents the mean±SE of data obtained from 4 mice. *p<0.05 **p< 0.005 and ***p< 0.0005 compared to basal state in STD-fed mice or as indicated in graph, in One-way Anova followed by Bonferroni's post-test.

Fig 3. S. spinosum enhances insulin signaling in liver of HFD-fed mice.

Fig 3

C57BL/J mice model were fed STD, HFD or HFD+ S. spinosum. Liver was removed at the age of 17 weeks as described in Methods. (A) Western blot analysis was performed on protein lysates of liver using specific antibodies. (B) The bar graphs are the results of optical density measurements of western blots. Each bar represents the mean±SE of data obtained from 4 mice. *p<0.05, **p< 0.005 and ***p< 0.0005 compared to basal state in STD-fed mice or as indicated in graph, in One-way Anova followed by Bonferroni's post-test.

Effect of SSE on hepatic glycogen and lipid storage

Glycogen levels in liver were higher in HFD-fed mice supplemented by SSE (Fig 4A). This increase in carbohydrate stores is in accord with the high phosphorylation level of GSK3β demonstrated in these mice (Fig 3).

Fig 4. The effect of SSE on hepatic glycogen and lipid content in HFD-fed mice.

Fig 4

C57BL/6J mice were fed STD, or HFD with or without SSE given in their drinking water as described in Methods. Mice were sacrificed at age 17 weeks and hepatic glycogen (A), triglycerides (B), and total cholesterol (C) levels were measured as described in Materials and Methods. The results are presented as mean±SE (n≥5 mice). *p<0.05, **p<0.005 by Student's t-test, compared to HFD-fed mice. (D) A representative H&E staining of livers.

On the other hand, triglyceride and cholesterol levels were not affected by S. spinosum treatment; both control and S. spinosum groups of HFD-fed mice had elevated lipid levels in the liver (Fig 4B and 4C). However, H&E staining of the livers shows that steatosis is mainly localized to the periacinar area in S. spinosum-treated mice, compared to HFD-fed littermates, presenting steatosis extending into midzonal areas (Fig 4D).

Effect of SSE on gene expression in livers of HFD-fed mice

In order to support the results suggesting beneficial effects of the extract on liver, we measured the mRNA expression of several genes involved in glucose and lipid metabolism (Fig 5). While mRNA expression of gluconeogenic genes (G6Pase and PEPCK) was not affected either by diet or by S. spinosum treatment, the expression of GCK, encoding for the key enzyme of glycolysis, was increased in HFD-fed mice supplemented by SSE. Glut2 mRNA expression was not significantly affected by the diet or the extract.

Fig 5. Effects of SSE on mRNA expression of hepatic genes.

Fig 5

C57BL/J mice model were fed STD, HFD or HFD+ S. spinosum. Liver was removed at age 17 weeks as described in Methods. mRNA expression of selected genes was measured. Results were normalized to the expression of the housekeeping gene, HPRT. ***P<0.0005 by Student's t-test.

Regarding the expression of genes regulating lipid metabolism, while some genes were neither affected by the diet nor the extract (PPARγ, HMGCR, SREBP-1C), several other genes were downregulated by HFD, including lipogenic genes (ACC1, FAS and SREBP2) as well as gene involved in lipolysis (HSL). The expression of PPARα, a key master regulator in lipid metabolism and oxidation was also reduced in HFD-fed mice. The expression of all these genes was increased by S. spinosum to the same expression level presented in STD-fed mice.

CD36, which is associated with atherogenic processes and other features of the metabolic syndrome, was elevated in HFD-fed mice, with no effect of S. spinosum on its expression. On the other hand, mRNA expression of AdipoR2, the adiponectin receptor predominantly expressed in the liver, was increased in HFD-fed mice treated by S. spinosum. No difference was found in the expression of pro-inflammatory genes (MCP-1, CRP, PAI-1 and IKK) between STD and HFD-fed groups (data not shown).

Effects of SSE on target tissues of insulin in KK-Ay mice

The anti-diabetic properties of SSE were previously validated by us using the KK-Ay mice, a spontaneously (genetic) developing diabetes model. An improved glucose tolerance, accompanied by reduced serum insulin was found in S. spinosum treated mice [16], indicating that the extract affects the target tissues of insulin either by alleviating insulin resistance or by mimicking its action. In order to further support these findings, in the following experiments we investigated the effects of SSE on insulin signaling in target tissues of the hormone; the liver and skeletal muscle.

In the soleus muscle, insulin-induced phosphorylation of IR, PKB, and GSK3β was enhanced in S. spinosum-treated mice (Fig 6A). In the liver (Fig 6B), phosphorylation of the insulin receptor was elevated in S. spinosum treated mice in both basal and insulin-induced states. Insulin failed to induce PKB phosphorylation in control-untreated mice, while S. spinosum restores insulin-dependent PKB phosphorylation. GSK3β phosphorylation in the liver was not affected significantly by S. spinosum in this model.

Fig 6. S. spinosum enhances insulin signaling in muscle and liver of KK-Ay mice.

Fig 6

KK-Ay mice were given SSE for 6 weeks, soleus muscle and livers were removed at the age of 12 weeks as described in methods. Western blot analysis was performed on protein lysates of muscle (A) and liver (B) using specific antibodies. These are representative results of 3 independent experiments. The bar graph are the results of optical density measurements of western blots. Each bar represents the mean±SE of data obtained from 4 mice. *p<0.05 and **p< 0.005 in One-way Anova, followed by Bonferroni's post-test.

Hepatic glycogen and lipid accumulation

Hepatic glycogen and triglycerides levels were measured (Fig 7). No difference was found in glycogen levels between groups, in accord with the results of GSK3β phosphorylation. Some reduction in hepatic triglyceride level was demonstrated in S. spinosum treated mice, which lacks statistical significance. H&E staining of the liver demonstrated that S. spinosum reduced the severity of steatosis. Extensive vacuolation of periacinar hepatocytes was demonstrated in untreated KK-Ay mice, while livers of SSE-treated mice were characterized by a diffuse periacinar, feathery vacuolation, mostly microsteatosis.

Fig 7. The effect of SSE on hepatic glycogen and lipid content in KK-Ay mice.

Fig 7

KK-Ay mice were given SSE for 6 weeks as described in methods. Mice were sacrificed at age of 12 weeks and hepatic glycogen (A), triglycerides (B) and total cholesterol (C) levels were measured as described in Materials and Methods. The results are presented as mean±SE (n≥5 mice). *p<0.05, **p<0.005 by Student's t-test, compared to HFD-fed mice. (D) A representative H&E staining of livers.

Hepatic gene expression

In addition, mRNA expression of genes involved in carbohydrates, lipid metabolism, and inflammation was measured (Fig 8). The expression of PEPCK was reduced in livers of S. spinosum treated mice. Both genes encoding for proteins facilitating hepatic glucose transport, Glut2 and GCK, were not affected. Similarly, genes involved in the regulation of lipid metabolism (PPARα, ACC-1, FAS, HSL, HMGCR, SREBP-1C, and SREBP2) were not affected by S. spinosum treatment in this model (data not shown). CD36 (fatty acid translocase), which is implicated in lipid metabolism, inflammation, and atherogenesis was significantly reduced in S. spinosum-treated mice. Similarly, mRNA expression of MCP-1 and IKK pro-inflammatory genes were reduced as well, while CRP expression was reduced in a non-significant manner (p = 0.06) and PAI expression was not affected.

Fig 8. SSE reduced mRNA expression of atherogenic and pro-inflammatory genes.

Fig 8

KK-Ay mice were given S. spinosum extract for 6 weeks as described in methods. Liver was removed at the age of 12 weeks as described in methods. mRNA expression of the indicated genes was measured by real-time PCR. Results were normalized to the expression of housekeeping gene, HPRT. ***P<0.0005 by Student's t-test.

Discussion

Insulin resistance of target tissues plays a central role in the pathogenic processes leading to T2D. Initially, the reduced sensitivity to the hormone is compensated by elevated plasma insulin concentration; however, inadequate compensation response, resulting from a progressive worsening of the insulin resistance, or relative failure of insulin-secreting pancreatic-beta cells, causes the disease outbreak [20].

Genetic variation is a significant risk factor for the development of T2D and over 70 genetic loci have been identified so far as associated with the etiology of the disease [21,22]. However, genetic factors by their own cannot explain the sharp climb in the prevalence of T2D over the last decades, suggesting that the radical changes in life habits and other environmental factors are the reason for the outburst of this epidemic [23]. Obesogenic environments include various factors that promote obesity, such as western diet, sedentary lifestyle, exposure to endocrine disruptors, and more [24–28]. While most subjects exposed to an obesogenic environment will experience elevated BMI [29], those carrying the genetic predisposition for diabetes will develop either prediabetes or an overt disease [30].

Obesity is intimately associated with insulin resistance [31]. According to the latest data of the American Centers for Disease Control and Prevention (CDC), from 1988 to 2012 prevalence of diabetes increased significantly over time in all sections of the population and is highly associated with trends of obesity prevalence. In the U.S, over 85% of people with T2DM are overweight or obese [32]. The metabolic overload, which is a characterizing feature of obesity, is recognized as inducing insulin resistance via several mechanisms, such as the promotion of low-grade chronic inflammation, alteration in adipose tissue function, oxidative stress, and mitochondrial dysfunction [33,34]. These pathological mechanisms are not necessarily identical to ones associated with genetic aberration, leading to insulin resistance. Thus, as obesogenic environment and genetic predisposition activate various mechanisms to induce the pathology of T2DM, antidiabetic treatment should be evaluated according to its efficacy to improve glucose tolerance that develops through both etiologies. Thus, in addition to our previous studies demonstrating the glucose-lowering properties of S. spinosum extract in a genetic mice model of the disease [15,16], it is important to validate effectiveness of this extract in mice developing glucose intolerance due to environmental-related etiology.

In this study, we show that SSE exerts glucose lowering effects on HFD-fed C57bl/6 mice, a model of diet-induced glucose intolerance with the absence of a significant genetic predisposition to the disease. We also further investigated the effects of SSE on insulin sensitivity in KK-Ay mice, developing T2D on a genetic background. Improved glucose tolerance and reduced insulin resistance were demonstrated in HFD-fed mice given S. spinosum, as we also previously found in the genetic model of T2D, with the KK-Ay mice [15,16]. The improved sensitivity to the hormone was validated by lower fasting serum insulin and higher activation of the insulin signaling cascade in skeletal muscle and liver of treated mice in both models.

Skeletal muscle and liver play a central role in maintaining whole body glucose homeostasis. The first is considered to be responsible for >75% of insulin-induced glucose disposal from blood under either euglycemia or hyperglycemia [35], while the second is the organ enabling de-novo glucose production. Under physiological conditions, insulin activates signaling pathways leading to increased glucose uptake to target tissues, activation of anabolic pathways enabling glycogen synthesis in liver and muscles, and inhibition of hepatic gluconeogenesis. Thus, hyperglycemia associated with disturbances in insulin action results from both low glucose disposal and unrepressed glucose production. Our results, demonstrating that SSE increased the phosphorylation of key signaling proteins in skeletal muscle and liver, suggest that both functions–glucose uptake and glucose production–are better regulated in S. spinosum treated mice.

Insulin failed to phosphorylate IR, PKB, and GSK3β in KK-Ay, reflecting the severe insulin resistance of these mice. SSE reduced this resistance, enabling the phosphorylation of these proteins in skeletal muscle. In the liver, S. spinosum increased both basal and insulin-induced IR phosphorylation, increased insulin-induced PKB phosphorylation, while GSK3β was not affected in this tissue. These results suggest that although S. spinosum beneficially affects both tissues, there are some tissue specific effects of the extract.

Fatty liver is associated with T2D, considered to be the hepatic manifestation of the metabolic syndrome [36]. Lower severity of steatosis was found in S. spinosum-treated KK-Ay mice, accompanied with lower mRNA expression of CD36, a biomarker of atherogenesis and metabolic dysfunction as well as some others pro-inflammatory genes. This suggests that in addition to its effect on glucose tolerance, SSE might be beneficial to improve additional manifestations of the metabolic syndrome, such as atherosclerosis, dyslipidemia, and inflammation. These potential effects are currently under investigation using appropriate models for these diseases.

The severity of insulin resistance is lower in HFD-fed mice compared to KK-Ay mice. The fasting level of serum insulin is high, indicating that insulin sensitivity is defective. However, glucose tolerance tests resemble the state of prediabetes, in which fasting glucose level is only moderately increased, while the glucose disposal rate is slower than normal. Transmission of insulin signaling is aberrant in HFD-fed mice, especially in the muscle, supporting the development of insulin resistance, although the severity of the resistance is lower than is found in KK-Ay mice. Our results demonstrated that SSE increased insulin-induced phosphorylation of IR, PKB and PRAS40. This signaling cascade is involved in the induction of glucose transport, and might mediate the improved glucose tolerance of SSE-treated mice [37]. Surprisingly, insulin-induced phosphorylation of GSK3β was not detected in muscle of either STD or HFD-fed mice, this might be because this downstream event requires longer time of insulin stimulation than done in this set of experiments.

Interestingly, basal phosphorylation of IR and GSK is elevated in the liver of HFD-fed mice. It can thus be suggested that hypersecretion of insulin partially compensates for the developing hepatic insulin resistance. However, as these HFD-fed mice experienced oversupply of nutrients, there is a requirement for higher activation of an anabolic cascade in order to overcome the overload of energy and successfully store the excess nutrients. It was previously reported that energy excess accompanying HFD induces an increase in hepatic glycogen, however, there is an upper limit to this energy store, and upon reaching it, energy storage is shifted from glycogen to lipid, leading to hepatic steatosis [38]. In line with these observations, we found that SSE extract increased hepatic glycogen storage capacity and reduced steatosis in HFD-fed mice. Elevation in mRNA expression of GCK, a gene encoding for an enzyme that facilitates hepatic glucose transport, also supports the hypothesis that S. spinosum increased glucose disposal from blood to be stored as glycogen in the liver. It should also be noted that while hepatic CD36 gene expression was not affected by S. spinosum extract, AdipoR2 mRNA expression was increased. Adiponectin is known to decrease hepatic insulin resistance and to attenuate liver inflammation and fibrosis through binding to AdipoR1 and AdipoR2, the latter is preferentially expressed in rodents livers [39,40]. The increase in the expression of this receptor supports the insulin sensitizing effects of SSE.

Hyperinsulinemia is considered to be not only a consequence of insulin resistance, but also a contributing factor for this disturbance, especially in the presence of high free fatty acids [41]. This vicious cycle is suggested to be the result of a negative feedback loop, activated as a result of high serum insulin [42]. In addition to worsening the pathology of insulin resistance, hyperinsulinemia has negative effects on pancreatic β cells by enhancing oxidative stress and cell damage [43]. Thus, correction of hyperinsulinemia is an important target of insulin sensitizer agents. Our results, demonstrating a significant reduction in blood insulin in S. spinosum treated HFD-fed mice and also in KK-Ay mice [15], support the beneficial antidiabetic potential of this herbal preparation.

HFD-fed mice develop hepatic steatosis. This pathology is of lower severity on the spectrum of NAFLD, and is characterized by the accumulation of lipids in the liver, but the absence of hepatic inflammation, fibrosis, and failure. Although found to enhance the activation of insulin signaling in the liver, S. spinosum did not reduce hepatic lipid accumulation in this model. Interestingly, while genes involved in lipid metabolism were downregulated by HFD, as was also previously reported [44,45], this was not seen in HFD-fed mice administrated with SSE, demonstrating a gene expression profile which is similar to that of STD-fed mice. The metabolic outcomes of this observation are unclear, and it should be further clarified whether the normalization of the gene expression profile has positive or negative effects on whole-body lipid homeostasis and specifically on hepatic function. The effects of SSE on blood lipids and the development of atherosclerosis are currently under investigation using appropriate models, such as the ApoE KO mice. In addition, a mice model of steatohepatitis is utilized in order to further clarify the effects of the extract on NAFLD.

Various disturbances (e.g. inflammation, endothelial dysfunction, and dyslipidemia) accompanying the metabolic syndrome share a common pathology of insulin resistance [46]. Our study, demonstrating that S. spinosum improved insulin sensitivity in two models of insulin resistance, supports the need to perform additional research in order to clarify the effects of this extract on other manifestations of the metabolic syndrome.

Supporting information

S1 Fig. Original blots presented in Fig 2.

A. Original blots presented in Fig 2A. When a significant different in the molecular weight of protein of interest exists, some of the membranes were re-blotted with additional primary antibodies, thus the "non-specific bands" are the bands developed as a result of the previous primary antibody still exists, as is seen in the blot of pPKB and pIR.

(DOCX)

S2 Fig. Original blots presented in Fig 3.

A. original blots presented in Fig 3A. When a significant different in the molecular weight of protein of interest exists, some of the membranes were re-blotted with additional primary antibodies, thus the "non-specific bands" are the bands developed as a result of the previous primary antibody still exists, as is seen in the blot of pPKB.

(DOCX)

S3 Fig. Original blots presented in Fig 6.

A. Original blots presented in Fig 6A. B. Original blots presented in Fig 6B. In this set of blots, the order of loading was as followed: S. spinosum treated without insulin stimulation (3 mice), S. spinosum treated with insulin stimulation (3 mice), control mice without insulin stimulation (4 mice), control mice with insulin stimulation (4 mice). In order to present the results in more logical way, in Fig 5A and 5B the control bands were separated from S. spinosum bands and are presented at the left of the panel, without any manipulation of the results.

(DOCX)

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This work was supported by the Israeli Ministry of Agriculture and Rural Development and Diabest botanical Drug Ltd. which provided research materials in addition to financial support. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Lam DW, LeRoith D (2012) The worldwide diabetes epidemic. Curr Opin Endocrinol Diabetes Obes 19: 93–96. doi: 10.1097/MED.0b013e328350583a [DOI] [PubMed] [Google Scholar]
  • 2.Chaturvedi N (2007) The burden of diabetes and its complications: trends and implications for intervention. Diabetes Res Clin Pract 76 Suppl 1: S3–12. [DOI] [PubMed] [Google Scholar]
  • 3.Danaei G, Finucane MM, Lu Y, Singh GM, Cowan MJ, Paciorek CJ, et al. (2011) National, regional, and global trends in fasting plasma glucose and diabetes prevalence since 1980: systematic analysis of health examination surveys and epidemiological studies with 370 country-years and 2.7 million participants. Lancet 378: 31–40. doi: 10.1016/S0140-6736(11)60679-X [DOI] [PubMed] [Google Scholar]
  • 4.Kahn SE, Haffner SM, Heise MA, Herman WH, Holman RR, Jones NP, et al. (2006) Glycemic durability of rosiglitazone, metformin, or glyburide monotherapy. N Engl J Med 355: 2427–2443. doi: 10.1056/NEJMoa066224 [DOI] [PubMed] [Google Scholar]
  • 5.Khunti K, Davies M (2010) Glycaemic goals in patients with type 2 diabetes: current status, challenges and recent advances. Diabetes Obes Metab 12: 474–484. doi: 10.1111/j.1463-1326.2009.01186.x [DOI] [PubMed] [Google Scholar]
  • 6.Claeson P (2014) Requirements on efficacy of herbal medicinal products. Journal of Ethnopharmacology 158: 463–466. doi: 10.1016/j.jep.2014.07.017 [DOI] [PubMed] [Google Scholar]
  • 7.Marles RJ, Farnsworth NR (1995) Antidiabetic plants and their active constituents. Phytomedicine 2: 137–189. doi: 10.1016/S0944-7113(11)80059-0 [DOI] [PubMed] [Google Scholar]
  • 8.Hung HY, Qian K, Morris-Natschke SL, Hsu CS, Lee KH (2012) Recent discovery of plant-derived anti-diabetic natural products. Nat Prod Rep 29: 580–606. doi: 10.1039/c2np00074a [DOI] [PubMed] [Google Scholar]
  • 9.Prabhakar PK, Doble M (2008) A target based therapeutic approach towards diabetes mellitus using medicinal plants. Curr Diabetes Rev 4: 291–308. [DOI] [PubMed] [Google Scholar]
  • 10.Samad A, Shams MS, Ullah Z, Wais M, Nazish I, Sultana Y, et al. (2009) Status of herbal medicines in the treatment of diabetes: a review. Curr Diabetes Rev 5: 102–111. [DOI] [PubMed] [Google Scholar]
  • 11.Ali-Shtayeh MS, Yaniv Z, Mahajna J (2000) Ethnobotanical survey in the Palestinian area: a classification of the healing potential of medicinal plants. J Ethnopharmacol 73: 221–232. [DOI] [PubMed] [Google Scholar]
  • 12.Al-Qura'n S (2009) Ethnopharmacological survey of wild medicinal plants in Showbak, Jordan. J Ethnopharmacol 123: 45–50. doi: 10.1016/j.jep.2009.02.031 [DOI] [PubMed] [Google Scholar]
  • 13.Bachrach ZY (2007) Ethnobotanical studies of Sarcopoterium spinosum in Israel. Israel Journal of Plant Sciences 55: 111–114. [Google Scholar]
  • 14.Dafni A, Yaniv Z, Palevitch D (1984) Ethnobotanical survey of medicinal plants in northern Israel. J Ethnopharmacol 10: 295–310. [DOI] [PubMed] [Google Scholar]
  • 15.Rozenberg K, Smirin P, Sampson SR, Rosenzweig T (2014) Insulin-sensitizing and insulin-mimetic activities of Sarcopoterium spinosum extract. J Ethnopharmacol. [DOI] [PubMed] [Google Scholar]
  • 16.Smirin P, Taler D, Abitbol G, Brutman-Barazani T, Kerem Z, Sampson SR, et al. (2010) Sarcopoterium spinosum extract as an antidiabetic agent: in vitro and in vivo study. J Ethnopharmacol 129: 10–17. doi: 10.1016/j.jep.2010.02.021 [DOI] [PubMed] [Google Scholar]
  • 17.Elyasiyan U, Nudel A, Skalka N, Rozenberg K, Drori E, Oppenheimer R, et al. (2017) Anti-diabetic activity of aerial parts of Sarcopoterium spinosum. BMC Complement Altern Med 17: 356 doi: 10.1186/s12906-017-1860-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Huang MA, Greenson JK, Chao C, Anderson L, Peterman D, Jacobson J, et al. (2005) One-year intense nutritional counseling results in histological improvement in patients with non-alcoholic steatohepatitis: a pilot study. Am J Gastroenterol 100: 1072–1081. doi: 10.1111/j.1572-0241.2005.41334.x [DOI] [PubMed] [Google Scholar]
  • 19.Montgomery MK, Hallahan NL, Brown SH, Liu M, Mitchell TW, Cooney GJ, et al. (2013) Mouse strain-dependent variation in obesity and glucose homeostasis in response to high-fat feeding. Diabetologia 56: 1129–1139. doi: 10.1007/s00125-013-2846-8 [DOI] [PubMed] [Google Scholar]
  • 20.Muoio DM, Newgard CB (2008) Molecular and metabolic mechanisms of insulin resistance and [beta]-cell failure in type 2 diabetes. Nat Rev Mol Cell Biol 9: 193–205. doi: 10.1038/nrm2327 [DOI] [PubMed] [Google Scholar]
  • 21.Replication DIG, Meta-analysis C, Asian Genetic Epidemiology Network Type 2 Diabetes C, South Asian Type 2 Diabetes C, Mexican American Type 2 Diabetes C, et al. (2014) Genome-wide trans-ancestry meta-analysis provides insight into the genetic architecture of type 2 diabetes susceptibility. Nat Genet 46: 234–244. doi: 10.1038/ng.2897 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Mohlke KL, Boehnke M (2015) Recent advances in understanding the genetic architecture of type 2 diabetes. Hum Mol Genet 24: R85–92. doi: 10.1093/hmg/ddv264 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Franks PW, McCarthy MI (2016) Exposing the exposures responsible for type 2 diabetes and obesity. Science 354: 69–73. doi: 10.1126/science.aaf5094 [DOI] [PubMed] [Google Scholar]
  • 24.Lake A, Townshend T (2006) Obesogenic environments: exploring the built and food environments. J R Soc Promot Health 126: 262–267. [DOI] [PubMed] [Google Scholar]
  • 25.Sonntag D, Schneider S, Mdege N, Ali S, Schmidt B (2015) Beyond Food Promotion: A Systematic Review on the Influence of the Food Industry on Obesity-Related Dietary Behaviour among Children. Nutrients 7: 8565–8576. doi: 10.3390/nu7105414 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Osei-Assibey G, Dick S, Macdiarmid J, Semple S, Reilly JJ, Ellaway A, et al. (2012) The influence of the food environment on overweight and obesity in young children: a systematic review. BMJ Open 2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Chamorro-Garcia R, Blumberg B (2014) Transgenerational effects of obesogens and the obesity epidemic. Curr Opin Pharmacol 19: 153–158. doi: 10.1016/j.coph.2014.10.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Labaronne E, Pinteur C, Vega N, Pesenti S, Julien B, Meugnier-Fouilloux E, et al. (2017) Low-dose pollutant mixture triggers metabolic disturbances in female mice leading to common and specific features as compared to a high-fat diet. J Nutr Biochem 45: 83–93. doi: 10.1016/j.jnutbio.2017.04.001 [DOI] [PubMed] [Google Scholar]
  • 29.Ravussin E, Bouchard C (2000) Human genomics and obesity: finding appropriate drug targets. European Journal of Pharmacology 410: 131–145. [DOI] [PubMed] [Google Scholar]
  • 30.Qi L (2012) Gene-Diet Interactions in Complex Disease: Current Findings and Relevance for Public Health. Curr Nutr Rep 1: 222–227. doi: 10.1007/s13668-012-0029-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Bhupathiraju SN, Hu FB (2016) Epidemiology of Obesity and Diabetes and Their Cardiovascular Complications. Circ Res 118: 1723–1735. doi: 10.1161/CIRCRESAHA.115.306825 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Centers for Disease C, Prevention (2004) Prevalence of overweight and obesity among adults with diagnosed diabetes—United States, 1988–1994 and 1999–2002. MMWR Morb Mortal Wkly Rep 53: 1066–1068. [PubMed] [Google Scholar]
  • 33.Tumova J, Andel M, Trnka J (2016) Excess of free fatty acids as a cause of metabolic dysfunction in skeletal muscle. Physiol Res 65: 193–207. [DOI] [PubMed] [Google Scholar]
  • 34.Ye J (2013) Mechanisms of insulin resistance in obesity. Frontiers of medicine 7: 14–24. doi: 10.1007/s11684-013-0262-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Baron A, Brechtel G, Wallace P, Edelman S (1988) Rates and tissue sites of non-insulin-and insulin-mediated glucose uptake in humans. American Journal of Physiology-Endocrinology And Metabolism 255: E769–E774. [DOI] [PubMed] [Google Scholar]
  • 36.Mishra A, Younossi ZM (2012) Epidemiology and Natural History of Non-alcoholic Fatty Liver Disease. J Clin Exp Hepatol 2: 135–144. doi: 10.1016/S0973-6883(12)60102-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Nascimento EB, Fodor M, van der Zon GC, Jazet IM, Meinders AE, Voshol PJ, et al. (2006) Insulin-mediated phosphorylation of the proline-rich Akt substrate PRAS40 is impaired in insulin target tissues of high-fat diet-fed rats. Diabetes 55: 3221–3228. doi: 10.2337/db05-1390 [DOI] [PubMed] [Google Scholar]
  • 38.Lu B, Bridges D, Yang Y, Fisher K, Cheng A, Chang L, et al. (2014) Metabolic crosstalk: molecular links between glycogen and lipid metabolism in obesity. Diabetes 63: 2935–2948. doi: 10.2337/db13-1531 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Kaser S, Moschen A, Cayon A, Kaser A, Crespo J, Pons-Romero F, et al. (2005) Adiponectin and its receptors in non-alcoholic steatohepatitis. Gut 54: 117–121. doi: 10.1136/gut.2003.037010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Buechler C, Wanninger J, Neumeier M (2011) Adiponectin, a key adipokine in obesity related liver diseases. World Journal of Gastroenterology: WJG 17: 2801–2811. doi: 10.3748/wjg.v17.i23.2801 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Ye J (2007) Role of insulin in the pathogenesis of free fatty acid-induced insulin resistance in skeletal muscle. Endocr Metab Immune Disord Drug Targets 7: 65–74. [DOI] [PubMed] [Google Scholar]
  • 42.Shanik MH, Xu Y, Skrha J, Dankner R, Zick Y, Roth J (2008) Insulin resistance and hyperinsulinemia: is hyperinsulinemia the cart or the horse? Diabetes Care 31 Suppl 2: S262–268. [DOI] [PubMed] [Google Scholar]
  • 43.Sampson SR, Bucris E, Horovitz-Fried M, Parnas A, Kahana S, Abitbol G, et al. (2010) Insulin increases H2O2-induced pancreatic beta cell death. Apoptosis 15: 1165–1176. doi: 10.1007/s10495-010-0517-5 [DOI] [PubMed] [Google Scholar]
  • 44.Vida M, Gavito AL, Pavón FJ, Bautista D, Serrano A, Suarez J, et al. (2015) Chronic administration of recombinant IL-6 upregulates lipogenic enzyme expression and aggravates high-fat-diet-induced steatosis in IL-6-deficient mice. Disease Models & Mechanisms 8: 721–731. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Heo HS, Kim E, Jeon SM, Kwon EY, Shin SK, Paik H, et al. (2013) A nutrigenomic framework to identify time-resolving responses of hepatic genes in diet-induced obese mice. Mol Cells 36: 25–38. doi: 10.1007/s10059-013-2336-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Guo S (2014) Insulin signaling, resistance, and the metabolic syndrome: insights from mouse models into disease mechanisms. J Endocrinol 220: T1–T23. doi: 10.1530/JOE-13-0327 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Original blots presented in Fig 2.

A. Original blots presented in Fig 2A. When a significant different in the molecular weight of protein of interest exists, some of the membranes were re-blotted with additional primary antibodies, thus the "non-specific bands" are the bands developed as a result of the previous primary antibody still exists, as is seen in the blot of pPKB and pIR.

(DOCX)

S2 Fig. Original blots presented in Fig 3.

A. original blots presented in Fig 3A. When a significant different in the molecular weight of protein of interest exists, some of the membranes were re-blotted with additional primary antibodies, thus the "non-specific bands" are the bands developed as a result of the previous primary antibody still exists, as is seen in the blot of pPKB.

(DOCX)

S3 Fig. Original blots presented in Fig 6.

A. Original blots presented in Fig 6A. B. Original blots presented in Fig 6B. In this set of blots, the order of loading was as followed: S. spinosum treated without insulin stimulation (3 mice), S. spinosum treated with insulin stimulation (3 mice), control mice without insulin stimulation (4 mice), control mice with insulin stimulation (4 mice). In order to present the results in more logical way, in Fig 5A and 5B the control bands were separated from S. spinosum bands and are presented at the left of the panel, without any manipulation of the results.

(DOCX)

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES