Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Jan 1.
Published in final edited form as: Biochem Biophys Res Commun. 2017 Nov 14;495(1):814–820. doi: 10.1016/j.bbrc.2017.11.084

A role for Candida albicans superoxide dismutase enzymes in glucose signaling

Chynna N Broxton a,1, Bixi He a, Vincent M Bruno b, Valeria C Culotta a,*
PMCID: PMC5956524  NIHMSID: NIHMS921740  PMID: 29154829

Abstract

The Saccharomyces cerevisiae and Candida albicans yeasts have evolved to differentially use glucose for fermentation versus respiration. S. cerevisiae is Crabtree positive, where glucose represses respiration and promotes fermentation, while the opportunistic fungal pathogen C. albicans is Crabtree negative and does not repress respiration with glucose. We have previously shown that glucose control in S. cerevisiae involves the antioxidant enzyme Cu/Zn superoxide dismutase (SOD1), where H2O2 generated by SOD1 stabilizes the casein kinase YCK1 for glucose sensing. We now demonstrate that C. albicans SODs also participate in glucose regulation. C. albicans expresses two cytosolic SODs, Cu/Zn SOD1 and Mn containing SOD3, and both complemented a S. cerevisiae sod1Δ mutant in stabilizing YCK1. Moreover, in C. albicans cells, both SODs functioned to repress glucose transporter genes in response to glucose. However, the action of SODs in glucose control has diverged in the two yeasts. In S. cerevisiae, SOD1 specifically functions in the glucose sensing pathway involving YCK1 and the RGT1 repressor, but the analogous YCK/RGT1 pathway in C. albicans shows no control by SOD enzymes. Instead C. albicans SODs work in the glucose repression pathway involving the MIG1 transcriptional repressor. In C. albicans, the SODs repress glucose uptake, while in S. cerevisiae, SOD1 activates glucose uptake, in accordance with the divergent modes for glucose utilization in these two distantly related yeasts.

Keywords: Superoxide dismutase, yeast, Candida albicans, glucose

INTRODUCTION

The nutrient glucose generates metabolic energy through the processes of glycolysis, fermentation and oxidative phosphorylation. In the bakers yeast Saccharomyces cerevisiae, glucose is preferentially metabolized through fermentation, and mitochondrial respiration is repressed by glucose through a process known as the Crabtree effect [1, 2]. Such control by glucose involves two transcriptional repressor pathways: (i) the sugar receptor repressor (SRR) pathway where glucose activates a signaling cascade involving the casein kinases YCK1/YCK2 and the transcriptional repressor RGT1; and (ii) the glucose repression pathway where energy sensing kinases regulate the transcriptional repressors MIG1 and MIG2 [3–5]. Together these pathways maximize glucose assimilation and repress respiration and the usage of alternative carbon sources.

The Crabtree effect does not apply to all yeasts. For example, the opportunistic fungal pathogen Candida albicans is defined as Crabtree negative, since glucose does not repress respiration in this yeast [6–8]. Even so, C. albicans has evolved with the same catabolite repression pathways as S. cerevisiae including the MIG1 and RGT1 transcriptional repressors [7–10]. C. albicans exists in glucose poor niches of the animal host where alternative carbon sources are prevalent, and the organism can sense very low glucose and simultaneously assimilate multiple carbon sources. By comparison, the environmental yeast S. cerevisiae thrives under glucose “feast or famine” and prefers to use glucose to drive fermentation. Alternative carbon sources are only assimilated when glucose becomes scarce [3, 6–8, 11, 12].

Curiously, we found that in S. cerevisiae, catabolite repression involves the antioxidant enzyme Cu/Zn superoxide dismutase (SOD1) [13]. SOD1 catalyzes the disproportionation of the free radical superoxide to oxygen and H2O2 and is well regarded for its role in oxidative stress protection [14]. However, H2O2 can be a signaling molecule [15, 16] and we observed that SOD1 generation of H2O2 at the site of S. cerevisiae YCK1 stabilizes this casein kinase, thereby helping to activate the SRR pathway and de-repress RGT1 targets [13]. This process requires oxygen to drive formation of the superoxide substrate for SOD1 and C-terminal sequences of YCK1 that we identified as a peroxide sensitive degron [13].

It is not known whether this role of SOD1 in SRR can be extended to Crabtree negative yeasts such as C. albicans where glucose does not repress respiration. Additionally, C. albicans does not always express a Cu/Zn containing SOD1. C. albicans and closely related fungi have uniquely evolved with two SODs in the cytosol whereby Cu/Zn SOD1 is repressed under Cu starvation conditions and is replaced by an alternative SOD3 enzyme that uses a Mn co-factor [17, 18]. Mn and Cu containing SODs are unrelated polypeptides and it is not known whether a Mn SOD can function in cytosolic signaling.

Here we report the surprising finding that the Crabtree negative C. albicans does in fact exploit its SODs in glucose regulation. Both the Cu/Zn SOD1 and Mn SOD3 of C. albicans were able to complement a sod1Δ mutant of S. cerevisiae and stabilize the YCK1 kinase. Moreover, in C. albicans, the SODs contribute to repression of glucose uptake when glucose is abundant. However, unlike S. cerevisiae where SOD1 acts in the SRR pathway involving YCK1 and RGT1, C. albicans SOD1 operates in the glucose repression pathway involving MIG1. The role of SOD enzymes in glucose control has been re-wired in C. albicans to accommodate the metabolism of this opportunistic pathogen and Crabtree negative yeast.

MATERIALS AND METHODS

Yeast strains, plasmids and growth conditions

The parental S. cerevisiae strain was AR203 (MATa, met15Δ0, ura3Δ0, his3Δ1 sod1Δ::LEU2), gift of Amit Reddi. This sod1Δ strain was transformed with one of several SOD expressing plasmids: pLJ175 (CEN URA3) harboring S. cerevisiae SOD1 sequences −674 to +584, pJG102 (CEN LEU2) expressing C. albicans P144L SOD1 under the S. cerevisiae SOD1 promoter [19], and pLJ486, pJL111, pVTSOD3 or pCB002 (URA3 2 micron) expressing S. cerevisiae SOD1, the P144S derivative, C. albicans SOD3 and S. cerevisiae SOD2 respectively all under S. cerevisiae ADH1 [17, 20]. pCB002 represents S. cerevisiae SOD2 sequences +265 to +889 (no mitochondrial pre-sequence) inserted into the BamH1 site of pVTSOD3. All strains co-expressed either TEF1 driven GFP fused to full length YCK1 (pAR113) or MET25 driven GFP fused to C-terminal YCK1 residues 368–538 (pAR119) [13].

C. albicans strains used in this study include CA-IF100 (arg4Δ/arg4Δ, leu2Δ/leu2Δ::cmLEU2, his1Δ/his1Δ::cdHIS1, URA3/ura3Δ) and isogenic sod1Δ::cmLEU2/sod1Δ::cdHIS1 and sod3Δ::cmLEU2/sod3Δ::cdHIS1 strains provided by K. Kuchler [21]. SN250 (ura3Δ-iro1Δ::imm434/URA3-IRO1, his1Δ/his1Δ, arg4Δ/arg4Δ, leu2Δ::C.m.LEU2/leu2Δ::C.d.HIS1), the isogenic rgt1Δ/Δ and mig1Δ/Δ strains, DAY286 (ura3Δ::imm434/ura3Δ::imm434, his1::hisG/his1::hisG, pARG4::URA3::arg4::hisG/arg4::hisG) and the isogenic yck22Δ/Δ strain were obtained from the fungal genetics stock center. The yck2Δ/Δ strain JJH34H (yck2-Tn7::UAU1/yck2-Tn7::URA3::pHIS1 ura3Δ::imm434/ura3Δ::imm434, his1::hisG/his1::hisG, arg4::hisG/arg4::hisG) and isogenic YCK2 re-integrant strain JJH34C were provided by Hyunsook Park [22].

S. cerevisiae and C. albicans cells were cultured at 30°C in enriched YP media containing 1% yeast extract, 2% peptone and 0.2% or 2% glucose or 5% glycerol (w/v). Anaerobic cultures of S. cerevisiae (95% nitrogen, 5% hydrogen gas) were supplemented with 15 mg/L ergosterol and 0.5% Tween-80.

Biochemical analyses

To analyze S. cerevisiae GFP-YCK, 100 μg lysate protein was subjected to immunoblot analysis using 12% Tris-Glycine gels and anti-GFP and anti-PGK1 antibodies [13]. Analysis of SOD enzymatic activity used 30 μg lysate protein subjected to native gel electrophoresis and nitroblue tetrazolium staining [19].

For RNA analyses, C. albicans strains were either grown to an optical density at 600 nm (OD600) of 1.0 –2.0 in YP + 2% glucose (Figs. 2, 3A,B) or grown first under either low (.2% glucose) or no glucose (5% glycerol) conditions to OD600 1.0–3.0, followed by dilution and re-growth in 2% glucose or 5% glycerol to OD600 ≈ 2.0. RNA for both qRT-PCR and RT-PCR was isolated using RNAeasy (Qiagen). For qRT-PCR, RNA was converted to cDNA using Superscript IV reverse transcriptase; cDNA was amplified using iQ SYBR Green Supermix [18] and the following primers: TUB2, as described [18]; HGT17, TGGACTATGGGTTTCAATTC and CATGACTCCGACAAAGAAAT; HGT12, CTGTCACTGCTTCATACCAA and CTTGGAAACCCAGTATCTTG; HGT2, ACTTGACAACAAATCTGCCT and ATACATGGCAATAGCGAAAT; QDR1, CATCCAACTTGGCCGATACA and TATCACCAGCAACACCAGAAC; HGT7, CCATCCACTTCTACTACGGTTTC and CCCGTAGAGGTTGCCATTT. Values were normalized to TUB2. For RT-PCR, cDNA was amplified using Taq DNA Polymerase and primers as previously described [23].

To measure glucose consumption, C. albicans cells were seeded at OD600 ≈ 0.2 in YP+2% glucose. At designated OD600, 200 μL aliquots were centrifuged to remove cells and assayed for glucose at 520 nm using the Glucose Colorimetric Assay Kit (Cayman Chemical Company).

RESULTS

C. albicans SOD1 and SOD3 can stabilize the S. cerevisiae casein kinase, YCK1

We tested whether C. albicans SOD1 and SOD3 can complement a S. cerevisiae sod1Δ mutant and stabilize the YCK1 casein kinase of the SRR pathway. For C. albicans SOD1, we expressed a P144L derivative. Wild type C. albicans SOD1 cannot be activated by the S. cerevisiae Cu chaperone CCS1 [19], while the P144L derivative is activated independent of CCS1 and exhibits abundant activity in S. cerevisiae [19]. S. cerevisiae sod1Δ cells expressing S. cerevisiae SOD1 or C. albicans P144L SOD1 were transformed with our previously published reporter for monitoring YCK1 stability. In this reporter, YCK1 sequences are fused to the C-terminus of GFP, and GFP expression levels provide a read-out of YCK1 stability [13]. As seen in Fig. 1A, the sod1Δ defect in GFP-YCK1 stability was complemented by C. albicans SOD1, as has been reported for human and C. elegans SOD1 expressed in this heterologous system [13].

Figure 1. C. albicans Cu/Zn SOD1 and Mn SOD3 can stabilize S. cerevisiae casein kinase, YCK1.

Figure 1

Open in a new tab

The S. cerevisiae sod1Δ strain expressing GFP-YCK1 or GFP fused to YCK1 resides 367–538 (D, bottom) were transformed with SOD-expressing plasmids or empty vector (EV). Lysates were subjected to immunoblot analyses using anti-GFP or anti-PGK1 as a loading control (A, B and C top and middle panels and D) or to SOD activity analysis by native gel electrophoresis and nitroblue tetrazolium staining as described in Materials and Methods (B bottom, C bottom). Indicated on left are molecular weight markers. (A) Strains expressed S. cerevisiae SOD1 (Sc SOD1) or C. albicans P144L SOD1 (Ca SOD1) from the S. cerevisiae SOD1 promoter. (B) Strains expressed S. cerevisiae SOD1, C. albicans SOD3 (Ca SOD3) or S. cerevisiae cytosolic SOD2 (Sc SOD2) all under the ADH1 promoter. With Sc SOD2, cultures contained 0.75 mM MnCl2 as required to activate cytosolic SOD2 [13, 25]. (C) Strains were grown either in atmospheric oxygen (“+ oxygen”) or under nitrogen (“− oxygen”). SODs expressed include C. albicans SOD3 under ADH1 (Ca SOD3), S. cerevisiae SOD1 under its native promoter (Sc SOD1) and S. cerevisiae P144S SOD1 under ADH1 (Sc SOD1*). S. cerevisiae SOD1 is normally inactive without oxygen (lane 3) due to the oxygen dependence of CCS1, but P144S SOD1 is CCS1-independent and is activated without oxygen [20] (lane 4). Results are representative of 2–6 experimental trials.

Although Cu/Zn SODs can readily stabilize YCK1, this may not be the case for Mn SOD enzymes. For example, the mitochondrial Mn SOD2 of S. cerevisiae cannot stabilize YCK1 when this SOD is targeted to the cytosol [13], even when expressed under the strong ADH1 promoter (Fig. 1B top). By comparison, Mn SOD3 from C. albicans complements the sod1Δ mutation and stabilizes YCK1 (Fig. 1B top). Both Mn SODs are enzymatically active (Fig. 1B bottom) but only C. albicans SOD3 stabilizes YCK1.

Protection of YCK1 by S. cerevisiae SOD1 requires oxygen to generate the superoxide substrate for SOD and C-terminal sequences of YCK1 we identified as a peroxide-sensitive degron [13]. The same appears true for Mn SOD3. Under anaerobic conditions, SOD3 cannot stabilize GFP-YCK1 even though active SOD3 enzyme is produced without oxygen (Fig. 1C lane 5), similar to findings with enzymatically active SOD1 (Fig. 1C lane 4; [13]). Furthermore, SOD3 stabilizes a GFP fusion to the peroxide-sensitive degron of YCK1, residues 367–538 (Fig. 1D). Despite being a Mn SOD, C. albicans SOD3 can stabilize S. cerevisiae YCK1 in a manner similar to Cu/Zn SOD1.

A role for SOD1 and SOD3 in regulation of glucose transporter genes in Candida albicans

Although C. albicans SOD1 and SOD3 can affect a glucose signaling pathway in S. cerevisiae, it was not clear whether the same holds true in C. albicans. Like S. cerevisiae, glucose control in C. albicans involves transcriptional re-programming and we tested whether specific markers of glucose control were altered in sod1Δ/Δ strains. In C. albicans, glucose represses specific HGT glucose transporter genes [3, 8, 11, 12], and we find that several of these are de-repressed in sod1Δ/Δ mutants. As seen in Fig. 2, HGT17, HGT12 and HGT2 were all strongly induced in C. albicans sod1Δ/Δ mutants (Fig. 2).

Figure 2. Effect of C. albicans sod1Δ/Δ mutations on the expression of glucose transporters.

Figure 2

Open in a new tab

Shown is qRT-PCR analysis of HGT17, HGT12 and HGT2 expression in C. albicans sod1Δ/Δ mutants compared to the CA-IF100 “WT” strain grown in 2% glucose. Results are averages of biological duplicates where error bars are standard deviation and are representative of 2–4 experimental trials. Significance was assessed using paired t-test, *p<0.05.

As mentioned above, C. albicans will switch from expressing SOD1 to Mn SOD3 when cells are starved for Cu [18]. We therefore tested whether SOD3 can also repress glucose transporter genes under Cu starvation conditions. Cells can be limited for Cu by treatment with the bathocuproinedisulfonate (BCS) Cu(I) chelator that effectively induces SOD3 [18] (Fig. 3A, right). We observed that HGT17 expression in BCS treated cells was significantly increased in sod3Δ/Δ mutants compared to WT cells, similar to effects of sod1Δ/Δ mutations under Cu-replete (no BCS) conditions (Fig. 3A, left). Moreover, the induction of HGT17 in sod1Δ/Δ cells was totally reversed upon inducing SOD3 through BCS (Fig. 3A left). Thus, like SOD1, SOD3 can contribute to repression of specific glucose transporters genes. Since SOD3 is only operative under extreme cases of Cu starvation, the remainder of our studies focused on SOD1.

Figure 3. Glucose repression in C. albicans involves SOD1 and SOD3 and genes that are targets of the MIG1 repressor.

Figure 3

Open in a new tab

(A) C. albicans CA-IF100 “WT” and isogenic sod3Δ/Δ and sod1Δ/Δ mutants were grown in 2% glucose medium supplemented where indicated with 800 μM of the Cu(I) chelator BCS to induce a Cu starvation state. As designated, qRT-PCR analysis was conducted on HGT17 or SOD3 and results normalized to WT cells without BCS. Results represent the averages of three biological replicates over two experimental trials; error bars are standard deviation. Significance was assessed using paired t-test, *p<0.05, **p≤0.01. There is no statistical difference between sod3Δ/Δ + BCS and sod1Δ/Δ without BCS. (B) Extracellular glucose was measured as described in Materials and Methods in the indicated cultures as they reached OD600 of 0.2, 3.0, 10.0 and 13.0. Shown are averages of two biological replicates representative of 2 experimental trials; error bars are standard deviation. (C) The SN250 “WT” and isogenic mig1Δ/Δ and rgt1Δ/Δ mutant strains were grown in either YP+ 2% glucose (H), YP+ .2% glucose (L), or YP + 5% glycerol (G). RT-PCR analysis of the indicated genes was carried out as described in Materials and Methods. cDNA reactions with and without reverse transcriptase are indicated as +RT and −RT.

C. albicans SOD1 helps repress HGT genes targets of the MIG1 repressor

At least two explanations may account for the induction of glucose transporter genes in C. albicans sod1Δ/Δ mutants: the yeast could either be defective in glucose consumption or in glucose signaling. We find that sod1Δ/Δ mutants have no obvious defect in consumption of extracellular glucose (Fig. 3B) suggesting these mutants may be defective in glucose signaling.

As mentioned above, glucose signaling in C. albicans involves the RGT1 and MIG1 repressors, whereby MIG1 represses glucose transport genes when glucose is abundant, and RGT1 represses genes with no glucose (i.e., glycerol) [11, 12]. We observe that all three HGT genes impacted by sod1Δ/Δ mutations are normally repressed in high (“H”) glucose and de-repressed in low (“L”) glucose (Fig. 3C left panels). HGT2 is an established MIG1 target while HGT12 falls under both MIG1 and RGT1 control [12], and accordingly, both genes are de-repressed in high glucose by mig1Δ/Δ mutations and HGT12 is also de-repressed in glycerol (“G”) by rgt1Δ/Δ mutations (Fig 3C). The regulation of HGT17 was previously unknown and we find its expression mirrors that of HGT2. HGT17 repression by high glucose was reversed by mig1Δ/Δ mutations but there was no repression by glycerol and no effect of rgt1Δ/Δ mutations (Fig. 3C). Thus, HGT17 is a target of MIG1, not RGT1. All three genes affected by sod1Δ/Δ mutations are targets of the MIG1 pathway for glucose repression.

The role of C albicans SOD1 in repressing MIG1 target genes was surprising because in S. cerevisiae, SOD1 acts in the RGT1, not MIG1, pathway [13]. In S. cerevisiae, sod1Δ mutations prevent the de-repression of RGT1 targets with glucose, an example being the glucose transporter gene HXT1 [13]. An analogous glucose transport gene regulated by C. albicans RGT1 is HGT7. Like S. cerevisiae HXT1, C. albicans HGT7 is normally repressed without glucose (e.g., glycerol) and de-repressed with glucose (Fig. 4A) [11]. We observed that de-repression of C. albicans HGT7 by glucose was unaffected by sod1Δ/Δ mutations (Fig. 4A) in stark contrast to the effects of S. cerevisiae sod1Δ mutations on HXT1 de-repression [13]. We also examined the QDR1 target of RGT1, encoding a multidrug resistance transporter [10, 12]. QDR1 is strongly de-repressed by glucose, but again, there was no effect of sod1Δ/Δ mutations on this RGT1 target (Fig. 4B).

Figure 4. RGT1 target genes are not affected by sod1Δ/Δ mutations.

Figure 4

Open in a new tab

The designated strains were grown in YP +2% glucose (C) or as indicated, in YP + 5% glycerol or 2% glucose (A, B, D, E), and expression of HGT7, QDR1 and HGT17 was analyzed by qRT-PCR and normalized toTUB2. Shown are the fold changes compared to the corresponding “WT” strain grown in glucose. Results represent the averages of 4–6 biological replicates over 2–3 experimental trials and significance determined by paired t-test; ***p=0.0002; **p≤0.01; *p≤0.05. ns, not significant. The change in HGT7 expression in glycerol grown cells was significant with yck22Δ/Δ cells, p=0.01, but not with yck2Δ/Δ cells. Strains used: (A, B) CA-IF100 “WT” and the isogenic sod1Δ/Δ strain; (D) JJH34C “WT” strain and the isogenic yck2Δ/Δ strain; (E) DAY286 “WT” and the isogenic yck22Δ mutant; (E) all six aforementioned strains in groups of isogenic pairs separated by dotted lines. Each mutant was compared to its corresponding “WT” = 1.0.

As mentioned above, S. cerevisiae SOD1 acts to regulate stability of YCK1 and YCK2 casein kinases [13]. The most closely related casein kinases in C. albicans are YCK2 and YCK22 [8, 10, 22]. We observed that neither yck2Δ/Δ nor yck22Δ/Δ mutations phenocopy sod1Δ/Δ in de-repressing the MIG1 target HGT17 (Fig. 4C), indicating that these kinases may not operate in the same glucose regulatory pathway as SOD1. C. albicans YCK2 is believed to act in the RGT1, not MIG1 pathway, analogous to S. cerevisiae YCK1 [8, 10, 22]. However, single mutations in C. albicans yck2 or yck22Δ/Δ did not prevent the de-repression of RGT1 targets HGT7 or QDR1 (Fig. 4D, E). While the role of C. albicans YCK2 and YCK22 in glucose regulation is uncertain (see Discussion), the cytosolic SODs of C. albicans clearly contribute to glucose control by helping repress glucose transporter targets of MIG1.

DISCUSSION

Since their divergence 200 million years ago, C. albicans and S. cerevisiae have evolved to maximize utilization of nutrients in their disparate environments, including carbon sources such as glucose. Although many aspects of glucose regulation are similar in the two yeasts (e.g., the RGT1 and MIG1 repressors), the regulatory pathways have been fined-tuned to accommodate the lifestyles of a fermentative yeast versus an opportunistic fungal pathogen [6–8]. Here we provide another example of how glucose sensing and utilization has diverged in these two organisms. The cytosolic SODs of C. albicans have chosen to participate in repression of glucose transporter targets of the MIG1 repressor, while SOD1 of S. cerevisiae acts to control RGT1 gene targets by stabilizing the YCK1 casein kinase. This differential usage of SOD enzymes correlates well with respiratory control in the two yeasts. S. cerevisiae prefers fermentation over respiration, and with high glucose, SOD1 helps to repress respiration [13]. In C. albicans, glucose does not repress respiration that is essential for pathogenesis, and the SODs have been re-purposed to repress glucose uptake rather than respiration.

S. cerevisiae expresses just one cytosolic SOD that controls glucose signaling, while C. albicans has evolved two cytosolic SODs (SOD1 and SOD3) that can help repress glucose transporter genes. The occurrence of a Mn SOD in the cytosol is highly irregular and most eukaryotes typically restrict Mn SODs to the mitochondrial matrix. C. albicans SOD3 is very similar to mitochondrial Mn SOD2 in terms of amino acid sequence and catalytic efficiency [24], yet only SOD3, and not SOD2, can stabilize the peroxide-sensitive degron of S. cerevisiae YCK1. SOD3 must harbor unique structural or biophysical attributes that empower its activity in the cytosol, including a remarkable ability to capture Mn in this compartment [25] and an ability to act in glucose signaling. SOD3 is part of an elegant system in C. albicans for sparing intracellular Cu when extracellular Cu becomes low as is seen during fungal invasion of the kidney [18, 26]. The interchangeable roles of SOD3 and SOD1 in glucose signaling would allow for uninterrupted control of carbon source utilization regardless of environmental Cu conditions.

How do C. albicans SODs repress glucose transporter genes? The SODs are likely to affect a component(s) of the MIG1 pathway, although the precise molecular target is difficult to predict because MIG1 regulation in C. albicans is poorly understood. C. albicans MIG1 does not contain the same phosphorylation sites for regulation by the SNF1 kinase as does S. cerevisiae MIG1, and how glucose activates C. albicans MIG1 is not clear [8, 9]. Regardless of the target, C. albicans SODs most likely function in a manner analogous to S. cerevisiae SOD1, where the SOD stabilizes proteins with peroxide-sensitive degrons. We favor this model because both C. albicans SOD1 and SOD3 have the capacity to stabilize the peroxide-sensitive degron of S. cerevisiae YCK1. In C. albicans, the closely related YCK2 casein kinase is proposed to work in the RGT1 pathway [8, 10, 22]. Although we saw no effects of yck2Δ/Δ mutations on glucose induction of RGT1 targets or glucose repression of MIG1 targets (Fig. 4), it is possible that the second casein kinase YCK22 is compensating for loss of YCK2. Finally, we cannot exclude the possibility that glucose control by SOD1 and SOD3 occurs independent of stabilizing peroxide-sensitive degrons. The SODs might act directly in the nucleus to repress MIG1 target genes, as has been shown for SOD1 regulation of Cu starvation stress and DNA damage response genes in S. cerevisiae [27, 28]. In any case, it is clear that C. albicans has evolved to use its SODs to minimize glucose uptake when glucose is abundant, perfectly in line with the lifestyle of this Crabtree negative yeast.

  • Superoxide dismutase (SOD) enzymes act in glucose signaling in yeast species.

  • In Saccharomyces cerevisiae, SODs induce glucose uptake and repress respiration.

  • In the human fungal pathogen Candida albicans, SODs repress glucose uptake genes.

  • C. albicans SODs affect gene targets of the MIG1 transcriptional repressor.

  • C. albicans has re-purposed its SOD enzymes to accommodate life in an animal host.

Acknowledgments

We thank Dr. Amit Reddi for helpful discussions. This work was supported by NIH grants RO1 GM 50016 and RO1 AI 119949 (to VCC), T32 CA009110 and F31 GM1136 (to CNB) and U19AI110820 (VMB).

Abbreviations

SRR

sugar receptor repressor

SOD

superoxide dismutase

OD600

optical density at 600 nM

BCS

bathocuproinedisulfonate

qRT-PCR

quantitative real time PCR

RT-PCR

reverse transcriptase PCR

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Carlson M. Glucose repression in yeast. Curr Opin Microbiol. 1999;2:202–207. doi: 10.1016/S1369-5274(99)80035-6. [DOI] [PubMed] [Google Scholar]
  • 2.Crabtree HG. The carbohydrate metabolism of certain pathological overgrowths. Biochem J. 1928;22:1289–1298. doi: 10.1042/bj0221289. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Santangelo GM. Glucose signaling in Saccharomyces cerevisiae. Microbiol Mol Biol Rev. 2006;70:253–282. doi: 10.1128/MMBR.70.1.253-282.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Kaniak A, Xue Z, Macool D, Kim JH, Johnston M. Regulatory network connecting two glucose signal transduction pathways in Saccharomyces cerevisiae. Eukaryot Cell. 2004;3:221–231. doi: 10.1128/EC.3.1.221-231.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Moriya H, Johnston M. Glucose sensing and signaling in Saccharomyces cerevisiae through the Rgt2 glucose sensor and casein kinase I. Proc Natl Acad Sci U S A. 2004;101:1572–1577. doi: 10.1073/pnas.0305901101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Miramon P, Lorenz MC. A feast for Candida: Metabolic plasticity confers an edge for virulence. PLoS Pathog. 2017;13:e1006144. doi: 10.1371/journal.ppat.1006144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Childers DS, Raziunaite I, Mol Avelar G, Mackie J, Budge S, Stead D, Gow NA, Lenardon MD, Ballou ER, MacCallum DM, Brown AJ. The Rewiring of Ubiquitination Targets in a Pathogenic Yeast Promotes Metabolic Flexibility, Host Colonization and Virulence. PLoS Pathog. 2016;12:e1005566. doi: 10.1371/journal.ppat.1005566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Sabina J, Brown V. Glucose sensing network in Candida albicans: a sweet spot for fungal morphogenesis. Eukaryot Cell. 2009;8:1314–1320. doi: 10.1128/EC.00138-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Zaragoza O, Rodriguez C, Gancedo C. Isolation of the MIG1 gene from Candida albicans and effects of its disruption on catabolite repression. J Bacteriol. 2000;182:320–326. doi: 10.1128/jb.182.2.320-326.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Brown V, Sabina J, Johnston M. Specialized sugar sensing in diverse fungi. Curr Biol. 2009;19:436–441. doi: 10.1016/j.cub.2009.01.056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Brown V, Sexton JA, Johnston M. A glucose sensor in Candida albicans. Eukaryot Cell. 2006;5:1726–1737. doi: 10.1128/EC.00186-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Sexton JA, Brown V, Johnston M. Regulation of sugar transport and metabolism by the Candida albicans Rgt1 transcriptional repressor. Yeast. 2007;24:847–860. doi: 10.1002/yea.1514. [DOI] [PubMed] [Google Scholar]
  • 13.Reddi AR, Culotta VC. SOD1 Integrates Signals from Oxygen and Glucose to Repress Respiration. Cell. 2013;152:224–235. doi: 10.1016/j.cell.2012.11.046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Fridovich I. Superoxide radical: an endogenous toxicant. Ann Rev Pharmacol Toxicol. 1983;23:239–257. doi: 10.1146/annurev.pa.23.040183.001323. [DOI] [PubMed] [Google Scholar]
  • 15.Antunes F, Brito PM. Quantitative biology of hydrogen peroxide signaling. Redox Biol. 2017;13:1–7. doi: 10.1016/j.redox.2017.04.039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Juarez JC, Manuia M, Burnett ME, Betancourt O, Boivin B, Shaw DE, Tonks NK, Mazar AP, Donate F. Superoxide dismutase 1 (SOD1) is essential for H2O2-mediated oxidation and inactivation of phosphatases in growth factor signaling. Proc Natl Acad Sci U S A. 2008;105:7147–7152. doi: 10.1073/pnas.0709451105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lamarre C, LeMay JD, Deslauriers N, Bourbonnais Y. Candida albicans expresses an unusual cytoplasmic manganese-containing superoxide dismutase (SOD3 gene product) upon the entry and during the stationary phase. J Biol Chem. 2001;276:43784–43791. doi: 10.1074/jbc.M108095200. [DOI] [PubMed] [Google Scholar]
  • 18.Li CX, Gleason JE, Zhang SX, Bruno VM, Cormack BP, Culotta VC. Candida albicans adapts to host copper during infection by swapping metal cofactors for superoxide dismutase. Proc Natl Acad Sci U S A. 2015;112:E5336–5342. doi: 10.1073/pnas.1513447112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Gleason JE, Li CX, Odeh HM, Culotta VC. Species-specific activation of Cu/Zn SOD by its CCS copper chaperone in the pathogenic yeast Candida albicans. J Biol Inorg Chem. 2014;19:595–603. doi: 10.1007/s00775-013-1045-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Leitch JM, Li CX, Baron JA, Matthews LM, Cao X, Hart PJ, Culotta VC. Post-translational modification of Cu/Zn superoxide dismutase under anaerobic conditions. Biochemistry. 2012;51:677–685. doi: 10.1021/bi201353y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Frohner IE, Bourgeois C, Yatsyk K, Majer O, Kuchler K. Candida albicans cell surface superoxide dismutases degrade host-derived reactive oxygen species to escape innate immune surveillance. Mol Microbiol. 2009;71:240–252. doi: 10.1111/j.1365-2958.2008.06528.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Park H, Liu Y, Solis N, Spotkov J, Hamaker J, Blankenship JR, Yeaman MR, Mitchell AP, Liu H, Filler SG. Transcriptional responses of Candida albicans to epithelial and endothelial cells. Eukaryot Cell. 2009;8:1498–1510. doi: 10.1128/EC.00165-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Fan J, Chaturvedi V, Shen SH. Identification and phylogenetic analysis of a glucose transporter gene family from the human pathogenic yeast Candida albicans. J Mol Evol. 2002;55:336–346. doi: 10.1007/s00239-002-2330-4. [DOI] [PubMed] [Google Scholar]
  • 24.Sheng Y, Stich TA, Barnese K, Gralla EB, Cascio D, Britt RD, Cabelli DE, Valentine JS. Comparison of two yeast MnSODs: mitochondrial Saccharomyces cerevisiae versus cytosolic Candida albicans. J Am Chem Soc. 2011;133:20878–20889. doi: 10.1021/ja2077476. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Luk E, Yang M, Jensen LT, Bourbonnais Y, Culotta VC. Manganese activation of superoxide dismutase 2 in the mitochondria of Saccharomyces cerevisiae. J Biol Chem. 2005;280:22715–22720. doi: 10.1074/jbc.M504257200. [DOI] [PubMed] [Google Scholar]
  • 26.Broxton CN, Culotta VC. An Adaptation to Low Copper in Candida albicans Involving SOD Enzymes and the Alternative Oxidase. PLoS One. 2016;11:e0168400. doi: 10.1371/journal.pone.0168400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Wood LK, Thiele DJ. Transcriptional activation in yeast in response to copper deficiency involves copper-zinc superoxide dismutase. J Biol Chem. 2009;284:404–413. doi: 10.1074/jbc.M807027200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Tsang CK, Liu Y, Thomas J, Zhang Y, Zheng XF. Superoxide dismutase 1 acts as a nuclear transcription factor to regulate oxidative stress resistance. Nat Commun. 2014;5:3446. doi: 10.1038/ncomms4446. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES