Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Jan 1.
Published in final edited form as: Clin Cancer Res. 2017 Oct 19;24(1):197–208. doi: 10.1158/1078-0432.CCR-17-1577

Epithelial-to-mesenchymal transition antagonizes response to targeted therapies in lung cancer by suppressing BIM

Kyung-A Song 1,*, Matthew J Niederst 2,3,*, Timothy L Lochmann 1, Aaron N Hata 2,3, Hidenori Kitai 4, Jungoh Ham 1, Konstantinos V Floros 1, Mark A Hicks 1, Haichuan Hu 2,3, Hillary E Mulvey 2,3, Yotam Drier 2,3, Daniel AR Heisey 1, Mark T Hughes 1, Neha U Patel 1, Elizabeth L Lockerman 2,3, Angel Garcia 2,3, Shawn Gillepsie 2,3, Hannah L Archibald 2,3, Maria Gomez-Caraballo 2,3, Tara J Nulton 1, Brad E Windle 1, Zofia Piotrowska 2,3, Sinem E Sahingur 5, Shirley M Taylor 6, Mikhail Dozmorov 7, Lecia V Sequist 2,3, Bradley Bernstein 2,3, Hiromichi Ebi 4, Jeffrey A Engelman 2,3,#, Anthony C Faber 1,#
PMCID: PMC5959009  NIHMSID: NIHMS914532  PMID: 29051323

Abstract

Purpose

Epithelial-to-mesenchymal transition (EMT) confers resistance to a number of targeted therapies and chemotherapies. However, it has been unclear why EMT promotes resistance, thereby impairing progress to overcome it.

Experimental Design

We have developed several models of EMT-mediated resistance to EGFR inhibitors (EGFRi) in EGFR mutant lung cancers to evaluate a novel mechanism of EMT-mediated resistance.

Results

We observed that mesenchymal EGFR mutant lung cancers are resistant to EGFRi-induced apoptosis via insufficient expression of BIM, preventing cell death despite potent suppression of oncogenic signaling following EGFRi treatment. Mechanistically, we observed that the EMT transcription factor ZEB1 inhibits BIM expression by binding directly to the BIM promoter and repressing transcription. De-repression of BIM expression by depletion of ZEB1 or treatment with the BH3 mimetic ABT-263 to enhance “free” cellular BIM levels both led to re-sensitization of mesenchymal EGFR mutant cancers to EGFR inhibitors. This relationship between EMT and loss of BIM is not restricted to EGFR mutant lung cancers as it was also observed in KRAS mutant lung cancers and large datasets including different cancer subtypes.

Conclusions

Altogether, these data reveal a novel mechanistic link between EMT and resistance to lung cancer targeted therapies.

Keywords: Lung cancer, Targeted therapies, EMT, EGFRi, ZEB1, BIM

Introduction

Epithelial to mesenchymal (EMT) transition, in the context of carcinogenesis, describes the process by which carcinomas lose their apical-basal polarity and intracellular junctions, the result of which is a cancer cell that is more capable of migration, invasion and intravasation into the bloodstream [1]. Molecularly, EMT is largely driven by a number of related zinc finger binding transcription factors (TFs), which act in concert to induce these phenotypes. The gene expression changes brought on by EMT include: loss of type IV collagens, inhibition of E-cadherin, and upregulation of fibronectins and Vimentin (reviewed in [2, 3]). These gene expression changes are mediated directly by the mesenchymal zinc finger binding TFs zinc-finger E-box-binding 1 (ZEB1), ZEB2, Twist and Snail. Outside of the metastatic process, EMT has also garnered significant attention for its importance in response/resistance to anti-cancer therapies.

In non-small cell lung cancer (NSCLC) patients with Epidermal Growth Factor Receptor (EGFR) mutations, large clinical trials have demonstrated that treatment with EGFR inhibitors (EGFRi) improves progression free survival (PFS) in patients compared to those treated with chemotherapy [4, 5]. Based on these data, treatment with EGFRi is currently standard-of-care first line treatment for the estimated 10–15% of NSCLC patients whose cancers harbor activating mutations in EGFR. Despite the activity of EGFRi in EGFR mutant NSCLC across clinical trials [4, 5], two critical barriers significantly limit their overall benefit to patients. First, initial responses are not uniform among EGFR mutant patients, with 30–40% of patients failing to receive a marked regression that meets RECIST level (defined as a 30% reduction in tumor volume) response [4]. Second, for the remaining patients, clinical responses are limited due to the phenomenon of “acquired resistance”, which describes the cancers’ adaptation to EGFRi therapy and subsequent regrowth. We and others have found that EGFR mutant NSCLCs that have an EMT phenotype are associated with resistance to EGFRi therapy, both in the upfront setting and in the acquired resistance setting [6–10]. These findings have spurred new efforts to uncover the molecular mechanisms underlying this type of resistance treatment in hopes of finding new therapies for these patients. Most notably, both AXL and SRC family members have been reported to contribute to EMT-mediated resistance to EGFRi by maintaining activation of key downstream signals [3, 6, 8].

Apoptosis, an extensively conserved programmed cellular death process, is vital to the efficacy of cancer therapeutics. Indeed, low apoptosis underlies upfront resistance in several other targeted therapy paradigms [11–15] and deficiencies in apoptosis contribute to resistance to EGFRi in EGFR mutant NSCLCs [16, 17]. Poor apoptotic response has been reported in a number of studies to be caused by deficient expression of the pro-apoptotic gene BIM, particularly the functional (BH3-containing) form [12, 13, 18, 19]; (reviewed in [16]). Indeed, low expression of functional BIM transcripts was shown to confer upfront resistance to EGFRi retrospectively in our previous study that examined a series of EGFR mutant patient specimens [18] and low BIM mRNA was a retrospective predictor of overall response rate (ORR), PFS and overall survival (OS) in a large patient cohort in the EURTAC trial [20, 21].

Herein, we investigate the role and mechanism of EMT-mediated depressed apoptosis following EGFRi treatment in resistance in EGFR mutant NSCLCs.

Materials and methods

Cell lines

The EGFR mutant cell lines HCC4006, NCI-H1975 and HCC827 have been extensively characterized in previous publications [18, 22]. The H1975 R2 cell line has been described [9]. All cell lines were cultured in RPMI-1640 (Lonza) with 10% fetal bovine serum (FBS) plus 1% penicillin and streptomycin (Gibco). Mycoplasma testing is routinely done on all the cell lines (Lonza), and the latest tests were performed in Aug, 2017. We performed cell line authentication testing by SNP and STR analysis. These cell lines have been acquired over the 36 months. MGH cell lines were established EGFR mutant cell lines derived from EGFR inhibitor-resistant patients as previously described [23]. The KRAS mutant cell lines used in this study were described in a previous study [24].

Drugs

Gefitinib, WZ4002, PF-299804, ABT-263 and ABT-199 were from Abmole. A-1331852 was kindly provided by AbbVie (Chicago, IL). Doxycycline Hydrochloride was from Fisher Scientific. 4-Hydroxytamoxifen was purchased from Sigma-Aldrich.

Western blotting

Western blots were performed as previously described [25] using the Invitrogen Midi-gel Tris-BIS system.

Immunoprecipitation (IP)

The indicated cells were lysed in the same buffer as used for Western blotting experiments: 25µL of protein A sepharose beads (GE Healthcare, Bio-Sciences, Pittsburgh, PA) were added to cellular lysates, followed by 0.5µg of BIM antibody (Cat# 2933, Cell Signaling Technology, Beverly, MA) or, when indicated, rabbit IgG (# sc-2027, Santa Cruz Biotechnology, Dallas, TX). Samples were incubated with motion at 4 degrees Celsius overnight. IP complexes were washed three times in the same lysis buffer, boiled, and run on a 4–12% BIS-TRIS gel (Invitrogen, Carlsbad, CA). Equal amounts of extracts (5% of immunoprecipitated protein) were prepared in parallel and run on the same gel.

ER-TWIST, pTREX BIM, shRNA and siRNA experiments

The ER-TWIST plasmid, which contains a fusion of the hormone binding domain of the estrogen receptor to TWIST and is conditionally activated by the presence of 4-Hydroxytamoxifen (4-OHT), has been previously described [26]. shRNA designed against ZEB1 in the pLKO.1 vector has previously been described [27]. siZEB1 was from Cell Signaling and Invitrogen. Scramble (Sc) control siRNA was from Qiagen. The shGFP plasmid was previously described [27]. The shSC plasmid was from Sigma-Aldrich (pLKO.1). shRNA transduction methodology has previously been described [28]. The total concentration of siRNA used in each experiment was 100nM, and the siRNA was prepared with Hiperfect (Qiagen) in Optimem (Invitrogen).

Apoptosis and cell cycle determination

Apoptosis and cell cycle determination were performed in triplicate on a Millipore Guava except for Figure 4A which was performed on a LSR II (BD Biosciences, San Jose, CA). Cells were stained with propidium iodide and Annexin conjugated to Cy5 (Biovision, Milpitas, CA). Cells stained positive for Annexin were counted as apoptotic. For cell cycle analysis, pelleted cells were gently lysed with 0.1% Triton and cells were stained with propidium iodide. DNA content was quantified by gating using the Incyte module on the Millipore Guava.

Figure 4. Pharmacological re-sensitization of EMT cells via ABT-263.

Figure 4

(A) Apoptosis measured by PI/Annexin staining and FACS following treatment with 1µM of the indicated drugs and (B) 72 hours cell viability assay with the indicated doses of WZ4002 +/− 1µM ABT-263 of H1975 R1 cells and H1975 R2 cells. (C) Western blots of BIM immunoprecipitation and whole cell lysates of H1975 R2 cells. (D) Mice harboring H1975 ER-TWIST+4-OHT tumors were treated as indicated (** P<0.01, * P<0.05 compared to WZ4002). (E) Five epithelial (left) and five mesenchymal (right) KRAS mutant NSCLC cell lines were lysed and underwent Western blotting and probed with the indicated antibodies. (F) KRAS mutant NSCLCs were transfected with either a short-interfering (si) targeting a scramble (Sc) or ZEB1 sequence, lysed and underwent Western blotting for the indicated antibodies. For (B), the indicated data points were repeated in quadruplicate and the results are representative of at two independent experiments.

qRT-PCR

ZEB1, TWIST, BCL2L11 (BIM) and β-Actin mRNA levels were determined by amplification and quantification of Sybr-Green as previously described [29]. The primer information: (1) ZEB1 (F) 5’-gcacctgaagaggaccagag-3’, (R) 5’-tgcatctggtgttccatttt-3’, (2) TWIST (F) 5’-ggagtccgcagtcttacgag-3’, (R) 5’-tctggaggacctggtagagg-3’, (3) BCL2L11 (F) 5’-atctcagtgcaatggcttcg-3’, (R) 5’-caactcttgggcgatccata-3’, (4) β-Actin (F) 5’-agagctacgagctgcctgac-3’, (R) 5’-agcactgtgttggcgtacag-3’.

ZEB1 CRISPR/Cas9

The ZEB1 guide RNAs were from the GenCRISPR construct service (Genscript). The empty lentiCRISPR V2 was a gift from Feng Zhang; Addgene plasmid #52961 [30].

Animal experiments

We injected 7×106 H1975 ER-TWIST cells that had been in culture with 4-OHT, subcutaneously into the right flanks of randomized, 6–8 week old female Nod/SCID gamma (NSG) mice. Mice began receiving treatments when tumors reached ~100–150mm3. The tumor size was subsequently measured three times per week using a digital caliper and tumors were calculated as length × width2 × 0.52. Administration of tamoxifen was by intraperitoneal injection, and the tamoxifen was dissolved in corn oil with beads (final concentration of 2.5mg/mouse/injection) and injected 5 days per week. WZ4002 was administered by oral gavage 25mg per kg of body weight in 10% 1-methyl-2-pyrrolidinone: 90% PEG-400. Navitoclax was administered by oral gavage at 80mg per kg of body weight in a mixture of 60% Phosal 50 PG, 30% PEG 400 and 10% Ethanol. All drugs were administered 5 days/week. There were 4–6 mice per cohort. The animal experiment was approved by the Virginia Commonwealth University Institutional Animal Care and Use Committee (IACUC protocol# AD10001048).

ChIP seq

ChIP-seq was performed as described previously [31]. In brief, 2×107 H1975 and H1975 R2 were fixed in 1% formaldehyde. Sonication was calibrated such that DNA was sheared to between 400 and 1,000 bp. ZEB1 was immunoprecipitated with Cell Signaling, clone number D803. ChIP DNA was used to generate sequencing libraries by end repair (End-It DNA repair kit, Epicentre), 3’ A base overhang addition via Klenow fragment (NEB), and ligation of barcoded sequencing adapters. Barcoded fragments were amplified via PCR. Libraries were sequenced as 40 bp paired end reads on an Illumina NextSeq500 instrument.

ZEB1 ChIP

ChIP was performed as previously described [29]. Briefly, cells were fixed for 15-minutes in RMPI-1640 media containing 10% FBS and 1% Formaldehyde, and fixation quenched through addition of Glycine (final concentration 0.125M). Fixed cells were lysed and chromatin sheared to a size of 100–500 bp. ChIP was performed using 5µg of an anti-ZEB1 antibody (Santa Cruz, Cat# sc-25388X). As a negative control, normal rabbit IgG (Cell Signaling Technology, Cat# 2729S) was used. Input samples were generated by taking the supernatant of the normal rabbit IgG immunoprecipitation. Input and ChIP samples were subjected to qPCR in sextuplet using primers against an E-box near the transcriptional start site of BCL2L11 (Forward: cgggaggctagggtaca, Reverse: caggctcggacaggtaaag), or against an E-box near the 5’-end of Exon 2 of BCL2L11 (Forward: ctaaccccgggaagtcagag, Reverse: agggtacccccaaacaaaat).

ChIP-seq data analysis

Short reads were aligned to the hg19 genome assembly (National Center for Biotechnology Information Build 37) with Bowtie2 v4.1.2 software for the alignment of short DNA sequences [32]. Data were analyzed and bound sites (from ChIP followed by deep sequencing) were identified with MACS v1.4.2 (Model-based Analysis for ChIP-Seq) software for peak discovery and next-generation sequencing analysis [33]. Occupied sites were identified by searching for groups of tags positioned in a sliding window of 500 bp. Experimental samples were compared against the controls using a Poisson distribution as assigned by the MACS aligner. The threshold for the number of tags that generated an interacting site was determined for a false-discovery rate of 0.001. Peaks were also required to have at least fourfold more tags (normalized versus total number) than the control samples. Visualization was performed with the IGV v2.3.81 tool.

Analysis of co-genes

Cell lines gene expression obtained from the CCLE website (“Entrez_2012_9-29”) were placed into a high BIM expressed group or a low BIM expressed group based on expression limits determined empirically. Cell lines with intermediate expression of BIM were not analyzed. The correlation between BIM expression and all other genes was determined by comparing expression of each gene between the two BIM expression groups using the t-test. The false discovery rates (FDRs) were determined based on correction for multiplicity using the Benjamini-Hochberg method.

BIM and EMT gene analyses

For the low BIM versus high BIM analysis in relation to EMT genes, the lowest 20% BIM expressing cells were considered low BIM, with the rest considered medium and high BIM. The Garnett data set was downloaded from Oncomine® premium edition which is Log2 transformed and median-centered (www.oncomine.com, Jan 2017, Thermo Fisher Scientific, Ann Arbor, MI). The Huang et al. dataset and the expO dataset were obtained from R2 genomics analysis and visualization platform.

Statistical analyses

For Fig. 1A, the false discovery rates (FDRs) were determined based on correction for multiplicity using the Benjamini-Hochberg method. For Fig. 1B–D and Sup. Fig. 1, samples were separated into two groups by the low (bottom 20%) vs. med/high (remaining 80%) BIM expression. Mann-Whitney U tests were performed to compare low BIM and high BIM groups from the datasets (P<0.05 was considered significant). For Fig. 1D, based on our hypothesis that low BIM was associated with high mesenchymal markers, we identified the difference in expression between the two sample populations using a one-tailed Mann-Whitney U test. The data presented in Sup. Fig. 8B underwent linear regression analysis (graphpad), and a p value was assigned. Student t-tests were performed in the other figures, with P<0.05 equaling significance.

Figure 1. Mesenchymal status and BIM (BCL2L11) levels are inversely correlated.

Figure 1

(A) Dot plot of the top nine genes correlated to BIM: known mesenchymal related genes (red), epithelial related genes (blue) or other genes (black) were plotted against p values. (B–C) BIM mRNA levels were separated as low BIM and medium (med)/high BIM and levels of the mesenchymal marker Vimentin were plotted (each dot represents a unique solid tumor cancer cell line). For Fig. 1B left panel (low n=171, med/high n =686) and right panel (low n=114, med/high n =459). For Fig. 1C, left panel (low n=37, med/high n =150) and right panel (low n=26, med/high n =103). For Fig. 1B, P<0.0001 in all comparisons by Mann-Whitney U test, for Fig. 1C P<0.05 in all comparisons by Mann-Whitney U test. Data were obtained from the CCLE (Fig. 1B, left panel and Fig. 1C, left panel) and Oncomine® (Fig. 1B, right panel and Fig. 1C right panel). (D) BIM mRNA levels were separated as low BIM and medium (med)/high BIM and levels of the mesenchymal marker Vimentin were plotted (each dot represents a unique lung cancer patient sample). For both Fig. 1D, left panel (low n=20, med/high n=80), and Fig. 1D, right panel (low n=24, med/high n=97), the data were downloaded from the R2: Genomic Analysis and Visualization Platform and P<0.05 by Mann-Whitney U test. Please note: low BIM was considered the bottom 20% expressing cell lines and tumors.

Results

Mesenchymal cancers have low BIM levels

Based on our previous work highlighting the critical role of BIM in targeted therapy-induced apoptosis [13, 15, 18–21], we sought to identify potential modifiers of BIM expression to inform possible future therapeutic strategies. To this end, we interrogated the cancer cell line encyclopedia (CCLE) [34], to investigate gene expression data of ~19,000 genes in 857 solid tumor cancer cell lines. With this data set, we performed an unbiased expression analysis (details in materials and methods) to determine the relationship of the expression of each gene with that of BIM. The EMT marker Vimentin is the strongest associated gene amongst ~19,000, being highly inversely correlated with BIM (BCL2L11) (p value= 8.69×10−39, Sup. Table 1). Additionally, the expression of seven of the top nine correlated genes were either epithelial or mesenchymal-related genes (Fig. 1A, Sup Fig. 1A and 1B, and Sup. Table 1). Although cancers with high BIM expression had a range of Vimentin levels, those with low BIM expression almost uniformly had high Vimentin expression (Fig. 1B, left panel).

We queried other deposited datasets in Oncomine® [35] and a similar analysis of a second solid tumor cancer cell line database confirmed the striking relationship between mesenchymal cancers and low BIM expression (Fig.1B, right panel). To determine whether mesenchymal cells had lower BIM expression specifically in lung cancers (encompassing both NSCLC and SCLC), we restricted the analysis to this cancer subtype. Again, we found low BIM to be strongly associated with mesenchymal status across both cell line datasets (Fig. 1C, left and right panels).

In order to test our hypothesis that low BIM associated with high Vimentin expression in primary tumors, we identified a series of 80 NSCLC tumor samples from four primary locations, with 20 matched normal samples from the same patients [36], and confirmed the association between high Vimentin expression and low expression of BIM (Fig. 1D, left panel). In addition, in a collection of 121 primary NSCLC tumors from the expression project for oncology (expO), we similarly found high Vimentin expression associated with low BIM expression (Fig. 1D, right panel). Altogether, these data demonstrate a strong inverse relationship between low BIM expression and high mesenchymal gene expression.

To more directly test the impact of EMT on BIM expression and EGFRi efficacy, we induced EMT by utilizing an ER-TWIST plasmid that enables conditional activation of TWIST in the presence of 4-Hydroxytamoxifen (4-OHT) [26]. Following infection with ER-TWIST-containing virus and antibiotic resistance selection, we generated two EGFR mutant NSCLC cell line derivatives that stably express the ER-TWIST construct (HCC4006 ER-TWIST and H1975 ER-TWIST). Subsequent treatment of these cells with 4-OHT induced an EMT, as evidenced by increased ZEB1 and decreased E-cadherin levels (Fig. 2A and 2B, left panel). Consistent with the correlative gene expression data in large cell line collections (Fig. 1), induction of an EMT in these cells was sufficient to promote a decrease in BIMEL expression, the most abundantly expressed BH3-containing BIM isoform [37], both at the protein (Fig. 2A) and RNA level (Fig. 2B, right panel). Other key BCL-2 family anti-apoptotic members were not markedly increased in the mesenchymal cells, with anti-apoptotic MCL-1 levels lowered in the ER-TWIST cells treated with 4-OHT, which could be a result of loss of BIM-mediated stabilization of MCL-1 [38] (Fig. 2A). Decreased BIM expression in the mesenchymal cells led to depressed apoptosis following EGFRi treatment (HCC4006; 1µM gefitinib, H1975; 1µM third generation EGFR mutant L858R/T790M inhibitor, WZ4002) (Fig. 2C). Notably, this was despite similar shutdown of EGFR and downstream signaling pathways (Fig. 2D), leading to analogous growth arrest as evidenced by similar increases in the percent of cells in the G1 phase of cell cycle (Fig. 2E). Furthermore, WZ4002 treatment led to comparable increases in BIM protein in the parental and EMT cells, which is mediated by suppression of MEK/ERK [22, 37, 39], and decreases in MCL-1, which is mediated by suppression of PI3K/TORC1 [22] (Fig. 2D). There were also increases in BIM mRNA levels in these cells, consistent with a contribution of BIM mRNA regulation by the MEK/ERK pathway [40] (Sup. Fig. 2A). Thus, depressed apoptosis was sufficient to result in the markedly poorer responses of the EMT cells to EGFRi in long-term viability assays (Fig. 2F and Sup Fig. 2B).

Figure 2. EMT results in loss of BIM, loss of an apoptotic response to EGFR inhibitor, and loss of sensitivity to EGFR inhibitor.

Figure 2

(A–C) HCC4006 and H1975 cells EGFR mutant NSCLC cell lines were transduced with ER-TWIST were either conditionally activated with 4-OHT incubation (ER-TWIST+4-OHT) or not (ER-TWIST) and (A) lysates from the cells were probed with the indicated antibodies, (B) RNA isolated and relative ZEB1 (left panel) and BIM (right panel) levels determined by qPCR (C) treated with 1µM gefitinib (HCC4006) or 1µM WZ4002 (H1975) for 72 hours and apoptosis quantified. (D and E) H1975 ER-TWIST and ER-TWIST+4-OHT cells were treated with 1µM WZ4002 for (D) 6 hours and lysates were probed with the indicated antibodies or (E) 24h and cell G1 cell cycle increase quantified by FACS. (F) HCC4006 (4006) and H1975 (1975) ER-TWIST and ER-TWIST+4-OHT cells were treated with 1µM gefitinib (4006) or 1µM WZ4002 (1975) for 5 days and cells stained with crystal violet. (G and H) H1975 ER-TWIST+4-OHT cells were further transduced with lentiviral-particles containing a doxycycline-inducible BIM expression plasmid (pTREXBIM) and treated with 1µM WZ4002 with the indicated concentrations of doxycycline and (G) lysates were probed with the indicated antibodies or (H) apoptosis analysis performed by FACS. Error bars are +S.D. for (B), (E) and (H), and +S.E.M. for (C). For (B, C and H), the indicated data points were repeated in triplicate and the results are representative of three independent experiments; for (E), the indicated data points were repeated in triplicate and the results are representative of two independent experiments.

We next determined whether restoration of BIM in the cells induced to undergo an EMT was sufficient to re-sensitize to EGFRi. Titrating increasing amounts of BIM using a doxycycline (Dox)-inducible system [18], we observed that increased BIM was sufficient to re-sensitize the EMT cancers to WZ4002 (Fig. 2G and Fig. 2H).

To further test the hypothesis that induction of EMT led to loss of BIM expression, we induced an EMT via a second approach; chronic exposure of EGFR mutant cell lines to recombinant TGF-β [3]. TGF-β-treated HCC827 cells (827T) underwent the expected characteristic changes attributed to EMT, including upregulation of ZEB1, and downregulation of E-cadherin (Sup. Fig. 2C). In addition, the 827T cells had suppressed BIM protein and mRNA levels (Sup. Fig. 2D) and were resistant to apoptosis induced by the EGFRi, gefitinib (Sup. Fig. 2E). Further, the PI3K and MEK/ERK pathways in the 827T cells remained sensitive to gefitinib and the levels of the other BCL2 family members were not markedly affected by the EMT (Sup. Fig. 2F). These findings are consistent with the ER-TWIST results (Fig. 2A and Fig. 2D) and are consistent with the hypothesis that diminished apoptosis was a result of the suppression of BIM. In a second EGFR mutant cell line, chronic treatment with TGF-β similarly led to an EMT phenotype and reduced BIM levels (H1975T, Sup. Fig. 2G–H), as well as a poorer apoptotic response to WZ4002 (Sup. Fig. 2I). In summary, we believe that these results support the model that EMT induction suppresses BIM at the RNA level and mitigates EGFRi-mediated apoptosis.

BIM is suppressed in EGFRi resistant models of EGFR mutant NSCLC that undergo EMT

We found directly inducing EMT by exogenous TWIST activation (Fig. 2) or chronic TGF-β treatment (Sup. Fig. 2) led to depressed levels of BIM resulting in suppression of EGFRi-induced apoptosis and resistance to EGFRi (WZ4002 and gefitinib). We next sought to assess whether this mechanism of depressed BIM expression was similarly active in cells with acquired resistance to EGFRi. These resistant models were established as we have previously done by exposing sensitive cells to increasing amounts of EGFRi until they obtain the ability to survive and grow in the presence of EGFRi [9]. The H1975 R1 and H1975 R2 cells [9] were developed by exposure to increasing concentrations of the pan-ErbB inhibitor, second-generation EGFR inhibitor PF-299804 (dacomitinib); these cells were cross-resistant to WZ4002 (Fig. 3A) and underwent an EMT (Fig. 3B). Consistent with the data from the induced-EMT models (Fig. 2 and Sup. Fig. 2) and the gene expression data (Fig. 1 and Sup. Fig. 1), these cells had diminished levels of BIM at both the protein and RNA level (Fig. 3B and 3C). Two additional EGFR mutant models that are sensitive to the third-generation EGFRi, WZ4002, the patient-derived treatment-naïve MGH119-1 (exon 19 del) and patient-derived erlotinib-resistant MGH164-2A (exon 19 del/T790M) cells were made resistant to WZ4002 using the same approach as in the H1975 model (Sup. Fig. 3, left panels). Multiple independent resistant lines with mesenchymal features were generated and each line had suppressed BIM levels compared to the parental cells (Sup. Fig. 3, right panels). These data indicate that in cell culture models of EMT-associated EGFRi acquired resistance BIM is likewise depressed.

Figure 3. ZEB1 directly binds and suppresses the BIM (BCL2L11) promoter to promote resistance to EGFR inhibition.

Figure 3

(A–C) Cells were treated with or without 1µM PF-299804 or 1µM WZ4002 for (A) crystal violet staining (B) Western blotting (C) RNA determination of H1975 parental cells (par), H1975 R1 cells (R1), and H1975 R2 cells (R2). The technical triplicates from duplicate qPCR run were used to determine the percent input of each amplicon. (D) ZEB1 binding profile within a 757 bp region encompassing the promoter and first exon of the BIM gene in wild type ("ZEB1 1975") and mutated ("ZEB1 1975R2") cells. Density and pileup of sequencing reads are shown. The Y-axes on both panels are equal scale. The "ZEB1 Hepg2" panel shows ZEB1 binding in Hepg2 cell line from ENCODE (separated by a dotted line to signify different source of data) (E) ChIP of ZEB1 at the BIM promoter. ChIP was performed against ZEB1 (grey bars) or a nonspecific IgG antibody (black bars). (left) Diagram of the first two exons of BCL2L11. E-Box motifs, each 250 nt upstream of their respective exons, are denoted by a black circle. Quantification of amplicons are shown for each E-Box for the (middle) residency of ZEB1 at the E-Box immediately upstream of the BCL2L11 transcriptional start site (Promoter E-Box) and (right) residency of ZEB1 at an E-Box sequence immediately upstream of Exon 2 of BCL2L11 (Intronic E-Box). (F–H) Transduction of virus containing ZEB1 CRISPR guide RNAs (CRISPR/Cas9 G1 and G2) in H1975 R2 cells followed by (F) Western blotting, (G) apoptosis induced by 1µM WZ4002 as measured by PI/Annexin staining and FACS and (H) 72 hours cell viability assay treated with the indicated doses of WZ4002. (I–K) Transduction of virus containing shSC or shZEB1 plasmids in H1975 ER-TWIST+4-OHT cells followed by (I) Western blotting, (J) apoptosis induced by 1µM WZ4002 as measured by PI/Annexin staining and FACS and (K) 72 hours cell viability assay treated with the indicated doses of WZ4002. Error bars are +S.D. for (C), (H) and (K), and +S.E.M. for (E), (G) and (J). For (C and G), the indicated data points were repeated in triplicate and the results are representative of three independent experiments. For (J), the indicated data points were repeated in triplicate and the results are representative of three independent experiments. For (H and K), the indicated data points were repeated in quadruplicate and the results are representative of at two independent experiments.

ZEB1 directly binds to the BIM promoter and suppresses transcription in mesenchymal EGFR mutant NSCLC cells

Low BIM RNA levels in mesenchymal cancers suggest that the regulation of BIM expression may be occurring at the transcriptional level (Fig. 1, Fig. 2B, Sup. Fig. 1, Sup. Fig. 2A, Sup. Fig. 2D and Sup. Fig. 2H). Therefore, we hypothesized that one of the number of well-characterized transcriptional repressors that is upregulated following EMT could be directly suppressing BIM transcription. Using the SwissRegulon portal [41] we searched for mesenchymal transcriptional regulators [6, 26] that had putative binding sites in the BIM promoter. From these analyses, we identified that the transcriptional repressor ZEB1 [2] was a candidate to bind the BIM promoter (Sup. Fig. 4). It is noteworthy that Vimentin had the highest positive gene correlation with ZEB1 among all other genes in 38 NSCLC cell lines [42] and, as would be expected, we found high ZEB1 was highly correlated with low BIM expression in the CCLE (Sup. Fig. 5A). We next queried data archived in the ENCODE project of whole genome ChIP-seq of ZEB1 in the HepG2 kidney cell line and identified ZEB1 binding in the BIM promoter (Fig. 3D). To determine the binding pattern of ZEB1 in the EGFR mutant NSCLCs that underwent an EMT, we performed whole genome ChIP-seq of ZEB1 in the mesenchymal H1975 R2 cells, as well as the epithelial H1975 parental cells for comparison. Analysis of ZEB1 enrichment profiles identified 9,744 unique peaks specific to the H1975 R2 cells that were not present in the H1975 parental cells. Evaluating a 1 KB region upstream the transcription start site (TSS), we identified several classically repressed ZEB1 genes such as MUC-1 [43] and CRB3 [44] (Sup. Table 2). In addition, BIM (BCL2L11) was also directly bound by ZEB1, consistent with the data from our database analyses and cell culture experiments (Figs. 1–3 and Sup. Figs. 1–3). Specifically, there was an enrichment peak in the H1975 R2 cells found approximately 200 bp upstream of the BCL2L11 TSS, overlapping the previously identified ZEB1 binding location from HepG2 cells. These data suggest that ZEB1 binds to the BCL2L11 promoter in H1975 R2 cells, leading to its transcriptional repression.

To validate the findings in our ChIP-seq studies, we performed follow-up ZEB1 ChIP studies in the H1975 ER-TWIST and HCC4006 ER-TWIST cell pairs. These experiments demonstrated similar binding of ZEB1 to the BIM promoter in the EMT cells as seen in the H1975 R2 cells, which was absent in the H1975 parental and the inactive ER-TWIST cells not treated with 4-OHT (Fig. 3E). These data demonstrate that ZEB1 is a novel regulator of BIM through direct binding of the BIM promoter in EMT NSCLC. In addition, this regulation occurs in EGFR mutant NSCLCs that are resistant to EGFR inhibition and underwent an EMT.

To confirm a functional role for ZEB1 in suppressing BIM levels, we genetically depleted ZEB1 by short hairpin (sh) RNA or CRISPR in the H1975 R2 model. Consistent with the ChIP-seq and ChIP findings, knockdown of ZEB1 led to an increased expression of BIM, at both the protein and RNA level (Fig. 3F, Sup. Fig. 5B, left panel and Sup. Fig. 5C, left panel). Importantly, this depletion of ZEB1 also led to re-sensitization of H1975 R2 cells to WZ4002 (Fig. 3G, 3H, Sup. Fig. 5C, middle and right panel). Similarly, in the H1975 EMT model induced by ER-TWIST, knockdown of ZEB1 led to de-repression of BIM protein and RNA (Fig. 3I and Sup. Fig. 5B, right panel) and restored EGFRi-induced apoptosis and re-sensitized these EMT cancers to WZ4002 (Fig. 3J and 3K). Furthermore, knockdown of ZEB1 with siRNA was also sufficient to de-repress BIM in H1975 R2 (Sup. Fig. 5D) and HCC4006 ER-TWIST cells (Sup. Fig. 5E). These data demonstrate that ZEB1 suppresses BIM expression in cells that have undergone EMT and depletion of ZEB1 restores BIM expression and sensitivity to EGFRi.

ABT-263 introduces an apoptotic response in mesenchymal EGFR mutant lung cancers that have acquired resistance to EGFRi treatment

ZEB1 reduction leads to de-repression of BIM in EGFR mutant NSCLCs; however, ZEB1 is not as of yet directly druggable. We therefore sought a currently available pharmacological solution to targeting EMT-mediated resistance in EGFR mutant NSCLC. BH3 mimetics are effective anti-cancer drugs that work by reducing apoptotic thresholds through liberation of BIM from complexes with the pro-survival protein like BCL-2 and BCL-xL [27, 45]. Furthermore, ABT-263 (navitoclax) is entering clinical trials with EGFRi in EGFR mutant NSCLC (clinical trial number NCT02520778). We therefore tested whether treating the low BIM expressing EGFRi-resistant mesenchymal H1975 R1 and H1975 R2 cells with ABT-263 would sufficiently increase free BIM levels to restore the apoptotic response to EGFRi. Indeed, the addition of ABT-263 to WZ4002 induced greater apoptosis in the resistance cells than that achieved by single-agent EGFRi in the parental cells (Fig. 4A). This translated to a marked sensitization to WZ4002 over 72 hours in proliferation assays (Fig. 4B). In the H1975 ER-TWIST model, the 4-OHT treated cells likewise were sensitized to EGFRi with the addition of ABT-263 (Sup. Fig. 6A). Interestingly, immunoprecipitation of BIM complexes in the H1975 R2 cells (Fig. 4C) or the H1975 ER-TWIST+4-OHT cells (Sup. Fig. 6B) demonstrated WZ4002 markedly increased the amount of BIM bound to (and therefore sequestered by) BCL-xL, but not BCL-2 or MCL-1. These data demonstrate how EGFR inhibition primes EGFR mutant EMT cells for apoptosis, by BIM upregulation and MCL-1 downregulation, but this effect is mitigated by enhanced interaction with BCL-xL, which can be abrogated by ABT-263. As MCL-1 expression is a major resistant mechanism for ABT-263, EGFRi-mediated downregulation of MCL-1 likely contributes to the potency of the combination. Moreover, BCL-2/BIM complexes were not detectable (Fig. 4C left panel and Sup. Fig. 6B left panel) despite BCL-2 expressed in the whole cell lysates (Fig. 4C right panel, and Sup. Fig. 6B right panel). Consistent with the notion this combination was effective through disruption of BCL-xL:BIM complexes, addition of the BCL-2 only inhibitor ABT-199 to WZ4002 only modestly increased apoptosis in the H1975 R2 cells, while the addition of a BCL-xL only inhibitor, A-1331852 [46], to WZ4002 led to similar levels of apoptosis as the WZ4002/ABT-263 combination (Sup. Fig. 6C). Similarly, in two mesenchymal EGFR mutant NSCLC lines that have poor apoptotic responses to WZ4002 alone (Sup. Fig. 7A) and EGFRi-resistant mesenchymal models (Sup. Fig. 7B), ABT-263 induced robust apoptosis that translated to dramatic reductions in long term viability (Sup. Fig. 7C). Finally, we tested the combination in an EMT mouse xenograft model. Mice bearing H1975 ER-TWIST tumors were treated intraperitoneally with 2.5mg tamoxifen to induce an EM (which we verified by Western blot of the tumor lysate (Sup. Fig. 8A) and cohorts of mice were treated with WZ4002 (25mg/kg), ABT-263 (80mg/kg) or the combination at the same doses. Consistent with our in vitro observations, while single-agent WZ4002 was sufficient to markedly slow the growth of the tumors, the addition of ABT-263 was necessary to shrink tumors (Fig. 4D). Therefore, re-establishing an apoptotic response in EMT-mediated EGFR mutant NSCLC resistant cells is a promising pharmaceutical strategy.

ZEB1 regulates BIM in additional oncogene-addicted NSCLCs

The incidence of EGFR activating mutations in NSCLC is usurped only by those in KRAS. To determine whether ZEB1 is also regulating BIM in KRAS mutant mesenchymal NSCLCs, we interrogated five epithelial and five mesenchymal KRAS mutant NSCLCs from a panel of KRAS mutant lung cancer cell line models for ZEB1 and BIM expression. Western blotting revealed that 4/5 lowest BIM expressers were indeed mesenchymal-like. As expected, these cancers expressed ZEB1 while the epithelial-like cancers did not (Fig. 4E). Consistently, within 39 KRAS mutant NSCLC lines in CCLE, there was an inverse relationship between ZEB1 expression and BIM (Sup. Fig. 8B). Furthermore, induction of an EMT in the H358 cells by chronic TGF-β treatment, led to repression of BIM, consistent with the effects of EMT on BIM expression in EGFR mutant NSCLCs (Sup. Fig. 8C). We knocked down ZEB1 expression in the mesenchymal SW1573, H1792 and Calu-1 cells and observed de-repression of BIM in all three lines (Fig. 4F). Altogether, these data indicate that both EGFR and KRAS mutant NSCLCs that undergo EMT suppress BIM through ZEB1-mediated transcriptional repression leading to targeted therapy resistance. The resistance in the mesenchymal cancers can be overcome by de-repression of BIM via ZEB1 targeting or BCL2 family inhibition in combination with the appropriate targeted therapy.

Discussion

It has become increasingly clear that deficient apoptosis mitigates responses within a number of targeted therapy paradigms including EGFRi in EGFR mutant NSCLC [12–14, 18, 20]. Additionally, deficient BIM expression and EMT have independently associated with resistance to targeted therapies [3, 6, 8, 11, 13, 18–21, 47]; however no link had been previously established between the two.

In this study, we analyzed potential BIM modifiers and ultimately identified a novel ZEB1-BIM interaction that mediates low BIM expression in NSCLCs that undergo EMT, thereby revealing a mechanistic link between the two modes of resistance. ChIP-seq data reveal that the depression of BIM is mediated by direct ZEB1 binding to the BIM promoter and suppressing BIM transcription. Indeed, these data may also provide critical insight into EMT-associated resistance in multiple settings as mesenchymal markers and low BIM expression are associated across multiple solid tumor types (Fig. 1A, Sup. Fig. 1B and Sup. Fig. 5A), ZEB1 binds to the BIM promoter in non-lung cancer cells (Fig. 3D), and EMT is broadly associated with resistance to a number of targeted therapies, chemotherapies and radiotherapy in various cancer types [10, 14, 48–52].

EMT has been reported previously to specifically associate with resistance to EGFRi in EGFR mutant and EGFR wild-type NSCLCs [6, 9, 26, 53–55]. Src family kinases have been identified as potential mediators of resistance in mesenchymal cancers, although early phase trials of NSCLC with the combination of gefitinib and the pan-Src inhibitor dasatinib did not support continuation of the combination. It should be noted these patients were molecularly unselected [56]. Therefore, it remains an open question as to whether EGFR mutant NSCLC patients with EMT would specifically derive benefit from this combination. EMT-mediated resistance has also been attributed to sustained activation of downstream signaling pathways by the AXL receptor tyrosine kinase [3, 6, 8]. The role for AXL in mediating resistance also remains to be fully elucidated [47]. More recently, NOTCH1 has been implicated in ZEB1-mediated EGFRi resistance in EGFR mutant lung cancers [57]. In our study, upon induction of EMT through conditional activation of TWIST or recombinant TGF-β treatment, there were no changes in either the ability of EGFR inhibitors to downregulate EGFR phosphorylation or downstream oncogenic signaling, namely the PI3K/AKT and MEK/ERK pathways. However the ability of the EGFRi to induce apoptosis was markedly diminished. These data are consistent with a recent report, in which Settleman and colleagues treated EGFR mutant HCC827 NSCLCs with recombinant TGF-β and saw marked differences in the ability of gefitinib to induce apoptosis, but not downregulate pEGFR, pAKT, or pERK [3]. It has also long been appreciated that EMT confers apoptotic resistance to a number of anti-cancer therapeutics, including compounds not related to direct suppression of RTKs and downstream signaling pathways. Please note that low BIM is likely only one of multiple mechanisms whereby mesenchymal EGFR mutant cancers are less sensitive to TKI. Our findings do support, however, that suppression of BIM is one meaningful mechanism by which the EMT program promotes targeted therapy resistance.

We recently reported that for the most prevalent resistant mechanism to EGFR inhibitors, namely acquisition of a secondary T790M mutation in EGFR, lung cancers can follow different paths to resistance: Either development from a pre-existing T790M-bearing clone or through de novo acquisition of T790M from drug-tolerant cells. Interestingly, in the drug tolerant cell populations, as well as the fully resistant T790M-positive cells that emerged directly from them, analysis of RNA-Seq data revealed an EMT signature, which was absent in both the parental cells and the resistant clones that emerged from pre-existing T790M-positive cells [17]. It is possible that the EMT cells in the population may survive the initial drug treatments due to apoptotic resistance, and, upon acquiring a means to re-activate the PI3K/MEK signaling pathways, for example via a T790M mutation, begin re-growth. This notion is further supported by our identification of patient-derived erlotinib-resistant cancer cell lines that are both mesenchymal and T790M-positive (e.g. MGH721-1A). Taken together, these data are consistent with a model in which EMT-associated changes can potentially exert multiple protective effects on the cancer cell: 1) ZEB1 suppression of BIM protects the cell from drug-induced apoptosis and is important for maintaining initial survival and drug-tolerance and 2) Reactivation of downstream signaling via mechanisms that may include AXL/Src activity and/or the eventual acquisition of genetic alterations such as T790M mutations, ultimately leading to re-entry into the cell cycle and transition to a more complete resistant phenotype. Consistent with our observations of an important role of ZEB1-mediated survival of EGFR mutant EMT cells, Larsen and colleagues have recently reported ZEB1 is the critical gene driving EMT in lung cancer [58].

Given the multiple findings that deficient functional BIM expression promotes EGFRi resistance, our findings further support implementation of therapeutic strategies that combine EGFRi with drugs that can overcome ZEB1-mediated suppression of BIM [13, 16, 18, 19]. Indeed, we observed that acute depletion of ZEB1 was sufficient to de-repress BIM and re-sensitize EMT cells to WZ4002 (Fig. 3F–3K and Sup. Fig. 5C). While ZEB1 cannot be directly targeted at this time, this newly described mechanistic link between EMT and loss of BIM expression could be leveraged to identify therapeutic approaches to overcome EMT-induced resistance. For example, we observed that the reduced levels of BIM can potentially be overcome with direct targeting of BCL-xL as has been reported by others [13]. The pharmaceutical approach of combining ABT-263 and an EGFRi could be successful in both EGFR mutant lung cancers with EMT-mediated acquired resistance, as well as mesenchymal cancers in the upfront setting. In addition, our data suggests EMT marker expression could be used as a biomarker to direct patients that may benefit significantly from apoptotic de-repression mediated by the combination of EGFRi and BH3 mimetics, which are entering the clinic for EGFR mutant NSCLCs (i.e. clinical trial NCT01009073). We have previously demonstrated that a combination of the 3rd generation EGFRi with ABT-263 can increase the amount of apoptosis [17] and importantly, in a previous small trial of 11 patients with different solid tumor malignancies, combining erlotinib and ABT-263 did not demonstrate new toxicities or significantly exacerbate single-drug toxicities, and, overall demonstrated tolerance [59]. Lastly, different targeted therapy paradigms, such as BRAF mutant melanomas [15, 60] and KRAS mutant cancers [27] that also have a clear rationale for use of targeted therapies in combination with ABT-263, EMT status may serve more broadly as a biomarker for these and other studies.

Overall, this study uncovers a molecular mechanism, ZEB1 suppression of BIM, which expands our understanding of the role of apoptosis and EMT in TKI resistance in EGFR mutant NSCLCs. These findings should help inform future efforts to combat EMT-associated resistance in EGFR mutant NSCLCs, and may have more general implications for guiding therapeutic strategies in other EMT-associated resistant cancer paradigms.

Supplementary Material

1
2
3

Statement of Translational Relevance.

We have discovered a novel EMT axis whereby the mesenchymal transcriptional factor ZEB1 binds to the promoter and inhibits the expression of pro-apoptotic BIM. The resulting low levels of BIM expression lead to decreased sensitivity of mesenchymal cancers to targeted therapies in lung cancer. These findings may have implications beyond lung cancer as we uncovered a striking inverse relationship between EMT and BIM expression across different cancer subsets as well.

Acknowledgments

All grant-based funding for this work

This work was supported by an American Lung Association Lung Cancer Discovery Award (A.C. Faber), a National Cancer Institute K22-CA175276 Career Development Award (A.C. Faber), Uniting Against Lung Cancer (M.J. Niederst), the Lung Cancer Research Foundation (M.J. Niederst), a Department of Defense grant (J.A. Engelman and L.V. Sequist), an American Cancer Society Institutional Grant (A.C. Faber), a Grant-in-Aid from the Japan Agency for Medical Research and Development (Project for Cancer Research and Therapeutics Evolution) (16cm0106513h0001), a Grant-in-Aid for Scientific Research (KAKENHI 16K07164) to H. Ebi, and a National Institute of Dental and Craniofacial Research grant (DE025037) to S.E. Sahingur. A.C. Faber is supported by the George and Lavinia Blick Research Fund and is a Harrison Endowed Scholar in Cancer Research.

Z. Piotrowska is a consultant/advisory board member of AstraZeneca, Boehringer Ingelheim, ARIAD Pharmaceuticals and Medtronic. She has received research funds from Guardant Health (Inst). L.V. Sequist is a consultant/advisory board member of AstraZeneca, Boehringer Ingelheim, Novartis, Merrimack, BMS, Genentech/Roche and Pfizer. She has also received research funds from Boehringer Ingelheim (Inst), Clovis Oncology (Inst), Genentech (Inst), Merrimack (Inst), Novartis (Inst), AstraZeneca (Inst), Johnson & Johnson (Inst), Merck (Inst), Taiho Pharmaceutical (Inst) and Pfizer (Inst). A.N. Hata has received research funds from Novartis, Amgen and Relay Therapeutics. J.A. Engelman is an employee of Novartis and has equity in Novartis. M.J. Niederst is an employee of Novartis.

Abbreviations

EMT

Epithelial to mesenchymal

TFs

Transcription factors

ZEB1

Zinc finger binding TFs zinc-finger E-box-binding 1

NSCLC

Non-small cell lung cancer

EGFR

Epidermal Growth Factor Receptor

EGFRi

EGFR inhibitors

PFS

Free survival

ORR

Overall response rate

OS

Overall survival

IP

Immunoprecipitation

4-OHT

4-Hydroxytamoxifen

Sc

Scramble

sh

Short hairpin

NSG

Nod/SCID gamma

FDRs

False discovery rates

CCLE

Cancer cell line encyclopedia

expO

Expression project for oncology

Dox

Doxycycline

TSS

Transcription start site

Footnotes

Conflict of Interest Statement

No potential conflicts of interest were disclosed by the other authors.

References

  • 1.Tsai JH, Yang J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes Dev. 2013;27(20):2192–206. doi: 10.1101/gad.225334.113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Wang Y, Zhou BP. Epithelial-mesenchymal Transition---A Hallmark of Breast Cancer Metastasis. Cancer Hallm. 2013;1(1):38–49. doi: 10.1166/ch.2013.1004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Wilson C, et al. Overcoming EMT-associated resistance to anti-cancer drugs via Src/FAK pathway inhibition. Oncotarget. 2014 doi: 10.18632/oncotarget.2397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sequist LV, et al. First-line gefitinib in patients with advanced non-small-cell lung cancer harboring somatic EGFR mutations. J Clin Oncol. 2008;26(15):2442–9. doi: 10.1200/JCO.2007.14.8494. [DOI] [PubMed] [Google Scholar]
  • 5.Rosell R, et al. Erlotinib versus standard chemotherapy as first-line treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): a multicentre, open-label, randomised phase 3 trial. Lancet Oncol. 2012;13(3):239–46. doi: 10.1016/S1470-2045(11)70393-X. [DOI] [PubMed] [Google Scholar]
  • 6.Byers LA, et al. An epithelial-mesenchymal transition gene signature predicts resistance to EGFR and PI3K inhibitors and identifies Axl as a therapeutic target for overcoming EGFR inhibitor resistance. Clin Cancer Res. 2013;19(1):279–90. doi: 10.1158/1078-0432.CCR-12-1558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Suda K, et al. Epithelial to mesenchymal transition in an epidermal growth factor receptor-mutant lung cancer cell line with acquired resistance to erlotinib. J Thorac Oncol. 2011;6(7):1152–61. doi: 10.1097/JTO.0b013e318216ee52. [DOI] [PubMed] [Google Scholar]
  • 8.Zhang Z, et al. Activation of the AXL kinase causes resistance to EGFR-targeted therapy in lung cancer. Nat Genet. 2012;44(8):852–860. doi: 10.1038/ng.2330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Sequist LV, et al. Genotypic and histological evolution of lung cancers acquiring resistance to EGFR inhibitors. Sci Transl Med. 2011;3(75):75ra26. doi: 10.1126/scitranslmed.3002003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Chung JH, et al. Clinical and molecular evidences of epithelial to mesenchymal transition in acquired resistance to EGFR-TKIs. Lung Cancer. 2011;73(2):176–82. doi: 10.1016/j.lungcan.2010.11.011. [DOI] [PubMed] [Google Scholar]
  • 11.Hata AN, et al. Failure to induce apoptosis via BCL-2 family proteins underlies lack of efficacy of combined MEK and PI3K inhibitors for KRAS mutant lung cancers. Cancer Res. 2014 doi: 10.1158/0008-5472.CAN-13-3728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Bean GR, et al. PUMA and BIM are required for oncogene inactivation-induced apoptosis. Sci Signal. 2013;6(268):ra20. doi: 10.1126/scisignal.2003483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ng KP, et al. A common BIM deletion polymorphism mediates intrinsic resistance and inferior responses to tyrosine kinase inhibitors in cancer. Nat Med. 2012;18(4):521–8. doi: 10.1038/nm.2713. [DOI] [PubMed] [Google Scholar]
  • 14.Montero J, et al. Drug-induced death signaling strategy rapidly predicts cancer response to chemotherapy. Cell. 2015;160(5):977–89. doi: 10.1016/j.cell.2015.01.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Paraiso KH, et al. PTEN loss confers BRAF inhibitor resistance to melanoma cells through the suppression of BIM expression. Cancer Res. 2011;71(7):2750–60. doi: 10.1158/0008-5472.CAN-10-2954. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hata AN, Engelman JA, Faber AC. The BCL2 Family: Key Mediators of the Apoptotic Response to Targeted Anticancer Therapeutics. Cancer Discov. 2015;5(5):475–487. doi: 10.1158/2159-8290.CD-15-0011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Hata AN, et al. Tumor cells can follow distinct evolutionary paths to become resistant to epidermal growth factor receptor inhibition. Nat Med. 2016 doi: 10.1038/nm.4040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Faber AC, et al. BIM expression in treatment-naive cancers predicts responsiveness to kinase inhibitors. Cancer Discov. 2011;1(4):352–65. doi: 10.1158/2159-8290.CD-11-0106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Nakagawa T, et al. EGFR-TKI resistance due to BIM polymorphism can be circumvented in combination with HDAC inhibition. Cancer Res. 2013;73(8):2428–34. doi: 10.1158/0008-5472.CAN-12-3479. [DOI] [PubMed] [Google Scholar]
  • 20.Costa C, et al. The impact of EGFR T790M mutations and BIM mRNA expression on outcome in patients with EGFR-mutant NSCLC treated with erlotinib or chemotherapy in the randomized phase III EURTAC trial. Clin Cancer Res. 2014;20(7):2001–10. doi: 10.1158/1078-0432.CCR-13-2233. [DOI] [PubMed] [Google Scholar]
  • 21.Karachaliou N, et al. BIM and mTOR expression levels predict outcome to erlotinib in EGFR-mutant non-small-cell lung cancer. Sci Rep. 2015;5:17499. doi: 10.1038/srep17499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Faber AC, et al. Differential induction of apoptosis in HER2 and EGFR addicted cancers following PI3K inhibition. Proc Natl Acad Sci U S A. 2009;106(46):19503–8. doi: 10.1073/pnas.0905056106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Crystal AS, et al. Patient-derived models of acquired resistance can identify effective drug combinations for cancer. Science. 2014;346(6216):1480–6. doi: 10.1126/science.1254721. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kitai H, et al. Epithelial-to-Mesenchymal Transition Defines Feedback Activation of Receptor Tyrosine Kinase Signaling Induced by MEK Inhibition in KRAS-Mutant Lung Cancer. Cancer Discov. 2016;6(7):754–69. doi: 10.1158/2159-8290.CD-15-1377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Faber AC, et al. Assessment of ABT-263 activity across a cancer cell line collection leads to a potent combination therapy for small-cell lung cancer. Proc Natl Acad Sci U S A. 2015 doi: 10.1073/pnas.1411848112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Salt MB, Bandyopadhyay S, McCormick F. Epithelial-to-mesenchymal transition rewires the molecular path to PI3K-dependent proliferation. Cancer Discov. 2014;4(2):186–99. doi: 10.1158/2159-8290.CD-13-0520. [DOI] [PubMed] [Google Scholar]
  • 27.Corcoran RB, et al. Synthetic lethal interaction of combined BCL-XL and MEK inhibition promotes tumor regressions in KRAS mutant cancer models. Cancer Cell. 2013;23(1):121–8. doi: 10.1016/j.ccr.2012.11.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ebi H, et al. Receptor tyrosine kinases exert dominant control over PI3K signaling in human KRAS mutant colorectal cancers. J Clin Invest. 2011;121(11):4311–21. doi: 10.1172/JCI57909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ham J, et al. Exploitation of the Apoptosis-Primed State of MYCN-Amplified Neuroblastoma to Develop a Potent and Specific Targeted Therapy Combination. Cancer Cell. 2016;29(2):159–72. doi: 10.1016/j.ccell.2016.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Sanjana NE, Shalem O, Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014;11(8):783–4. doi: 10.1038/nmeth.3047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Ryan RJ, et al. Detection of Enhancer-Associated Rearrangements Reveals Mechanisms of Oncogene Dysregulation in B-cell Lymphoma. Cancer Discov. 2015;5(10):1058–71. doi: 10.1158/2159-8290.CD-15-0370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Langmead B, et al. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009;10(3):R25. doi: 10.1186/gb-2009-10-3-r25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Zhang Y, et al. Model-based analysis of ChIP-Seq (MACS) Genome Biol. 2008;9(9):R137. doi: 10.1186/gb-2008-9-9-r137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Barretina J, et al. The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity. Nature. 2012;483(7391):603–7. doi: 10.1038/nature11003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Rhodes DR, et al. ONCOMINE: a cancer microarray database and integrated data-mining platform. Neoplasia. 2004;6(1):1–6. doi: 10.1016/s1476-5586(04)80047-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Huang S, et al. Analytical Performance of a 15-Gene Prognostic Assay for Early-Stage Non-Small-Cell Lung Carcinoma Using RNA-Stabilized Tissue. J Mol Diagn. 2015;17(4):438–45. doi: 10.1016/j.jmoldx.2015.03.005. [DOI] [PubMed] [Google Scholar]
  • 37.Ewings KE, et al. ERK1/2-dependent phosphorylation of BimEL promotes its rapid dissociation from Mcl-1 and Bcl-xL. EMBO J. 2007;26(12):2856–67. doi: 10.1038/sj.emboj.7601723. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Czabotar PE, et al. Structural insights into the degradation of Mcl-1 induced by BH3 domains. Proc Natl Acad Sci U S A. 2007;104(15):6217–22. doi: 10.1073/pnas.0701297104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Deng J, et al. Proapoptotic BH3-only BCL-2 family protein BIM connects death signaling from epidermal growth factor receptor inhibition to the mitochondrion. Cancer Res. 2007;67(24):11867–75. doi: 10.1158/0008-5472.CAN-07-1961. [DOI] [PubMed] [Google Scholar]
  • 40.Meng J, et al. Apoptosis induction by MEK inhibition in human lung cancer cells is mediated by Bim. PLoS One. 2010;5(9):e13026. doi: 10.1371/journal.pone.0013026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Members, S.I.B.S.I.o.B. The SIB Swiss Institute of Bioinformatics' resources: focus on curated databases. Nucleic Acids Res. 2016;44(D1):D27–37. doi: 10.1093/nar/gkv1310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Gemmill RM, et al. ZEB1-responsive genes in non-small cell lung cancer. Cancer Lett. 2011;300(1):66–78. doi: 10.1016/j.canlet.2010.09.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Guaita S, et al. Snail induction of epithelial to mesenchymal transition in tumor cells is accompanied by MUC1 repression and ZEB1 expression. J Biol Chem. 2002;277(42):39209–16. doi: 10.1074/jbc.M206400200. [DOI] [PubMed] [Google Scholar]
  • 44.Aigner K, et al. The transcription factor ZEB1 (deltaEF1) promotes tumour cell dedifferentiation by repressing master regulators of epithelial polarity. Oncogene. 2007;26(49):6979–88. doi: 10.1038/sj.onc.1210508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Faber AC, et al. mTOR Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-XL inhibition by Suppressing MCL-1. Cancer Discov. 2013 doi: 10.1158/2159-8290.CD-13-0315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Leverson JD, et al. Exploiting selective BCL-2 family inhibitors to dissect cell survival dependencies and define improved strategies for cancer therapy. Sci Transl Med. 2015;7(279):279ra40. doi: 10.1126/scitranslmed.aaa4642. [DOI] [PubMed] [Google Scholar]
  • 47.Wilson C, et al. AXL inhibition sensitizes mesenchymal cancer cells to antimitotic drugs. Cancer Res. 2014;74(20):5878–90. doi: 10.1158/0008-5472.CAN-14-1009. [DOI] [PubMed] [Google Scholar]
  • 48.Zhang P, et al. ATM-mediated stabilization of ZEB1 promotes DNA damage response and radioresistance through CHK1. Nat Cell Biol. 2014;16(9):864–75. doi: 10.1038/ncb3013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Arumugam T, et al. Epithelial to mesenchymal transition contributes to drug resistance in pancreatic cancer. Cancer Res. 2009;69(14):5820–8. doi: 10.1158/0008-5472.CAN-08-2819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Singh A, Settleman J. EMT, cancer stem cells and drug resistance: an emerging axis of evil in the war on cancer. Oncogene. 2010;29(34):4741–51. doi: 10.1038/onc.2010.215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Siebzehnrubl FA, et al. The ZEB1 pathway links glioblastoma initiation, invasion and chemoresistance. EMBO Mol Med. 2013;5(8):1196–212. doi: 10.1002/emmm.201302827. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Kim HR, et al. Epithelial-mesenchymal transition leads to crizotinib resistance in H2228 lung cancer cells with EML4-ALK translocation. Mol Oncol. 2013;7(6):1093–102. doi: 10.1016/j.molonc.2013.08.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Witta SE, et al. Restoring E-cadherin expression increases sensitivity to epidermal growth factor receptor inhibitors in lung cancer cell lines. Cancer Res. 2006;66(2):944–50. doi: 10.1158/0008-5472.CAN-05-1988. [DOI] [PubMed] [Google Scholar]
  • 54.Xie M, et al. Notch-1 contributes to epidermal growth factor receptor tyrosine kinase inhibitor acquired resistance in non-small cell lung cancer in vitro and in vivo. Eur J Cancer. 2013;49(16):3559–72. doi: 10.1016/j.ejca.2013.07.007. [DOI] [PubMed] [Google Scholar]
  • 55.Thomson S, et al. Kinase switching in mesenchymal-like non-small cell lung cancer lines contributes to EGFR inhibitor resistance through pathway redundancy. Clin Exp Metastasis. 2008;25(8):843–54. doi: 10.1007/s10585-008-9200-4. [DOI] [PubMed] [Google Scholar]
  • 56.Gold KA, et al. A phase I/II study combining erlotinib and dasatinib for non-small cell lung cancer. Oncologist. 2014;19(10):1040–1. doi: 10.1634/theoncologist.2014-0228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Zhang T, et al. A genetic cell context-dependent role for ZEB1 in lung cancer. Nat Commun. 2016;7:12231. doi: 10.1038/ncomms12231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Larsen JE, et al. ZEB1 drives epithelial-to-mesenchymal transition in lung cancer. J Clin Invest. 2016;126(9):3219–35. doi: 10.1172/JCI76725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Tolcher AW, et al. Safety, efficacy, and pharmacokinetics of navitoclax (ABT-263) in combination with erlotinib in patients with advanced solid tumors. Cancer Chemother Pharmacol. 2015;76(5):1025–32. doi: 10.1007/s00280-015-2883-8. [DOI] [PubMed] [Google Scholar]
  • 60.Frederick DT, et al. Clinical profiling of BCL-2 family members in the setting of BRAF inhibition offers a rationale for targeting de novo resistance using BH3 mimetics. PLoS One. 2014;9(7):e101286. doi: 10.1371/journal.pone.0101286. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
2
3

RESOURCES