Skip to main content
eLife logoLink to eLife
. 2018 May 22;7:e32451. doi: 10.7554/eLife.32451

A homozygous loss-of-function CAMK2A mutation causes growth delay, frequent seizures and severe intellectual disability

Poh Hui Chia 1,†,✉, Franklin Lei Zhong 1,2,†,✉, Shinsuke Niwa 3,4,†, Carine Bonnard 1, Kagistia Hana Utami 5, Ruizhu Zeng 5, Hane Lee 6,7, Ascia Eskin 6,7, Stanley F Nelson 6,7, William H Xie 1, Samah Al-Tawalbeh 8, Mohammad El-Khateeb 9, Mohammad Shboul 10, Mahmoud A Pouladi 5,11, Mohammed Al-Raqad 8, Bruno Reversade 1,2,12,13,✉
Editor: Partha Majumder14
PMCID: PMC5963920  PMID: 29784083

Abstract

Calcium/calmodulin-dependent protein kinase II (CAMK2) plays fundamental roles in synaptic plasticity that underlies learning and memory. Here, we describe a new recessive neurodevelopmental syndrome with global developmental delay, seizures and intellectual disability. Using linkage analysis and exome sequencing, we found that this disease maps to chromosome 5q31.1-q34 and is caused by a biallelic germline mutation in CAMK2A. The missense mutation, p.His477Tyr is located in the CAMK2A association domain that is critical for its function and localization. Biochemically, the p.His477Tyr mutant is defective in self-oligomerization and unable to assemble into the multimeric holoenzyme.In vivo, CAMK2AH477Y failed to rescue neuronal defects in C. elegans lacking unc-43, the ortholog of human CAMK2A. In vitro, neurons derived from patient iPSCs displayed profound synaptic defects. Together, our data demonstrate that a recessive germline mutation in CAMK2A leads to neurodevelopmental defects in humans and suggest that dysfunctional CAMK2 paralogs may contribute to other neurological disorders.

Research organism: C. elegans, Human

eLife digest

Each year, some children are born with developmental disorders and intellectual disabilities. These conditions are often caused by mutations in specific genes. Sometimes both copies of a gene – one inherited from each parent – need to be mutated for the symptoms to develop. These mutations are known as recessive mutations.

Here, Chia, Zhong, Niwa et al. diagnosed two siblings in their clinical care with a new form of neurological disease that affects the development of the brain and leads to frequent seizures. To test whether the young patients shared a genetic mutation that could explain their condition, the researchers analyzed the DNA of the children and compared the results with the DNA from their parents and healthy siblings. The results showed that the two children with the condition had inherited a recessive mutation in a gene called CAMK2A. The protein this gene encodes helps nerve cells to form connections and communicate with each other, and it has been shown to be essential for learning and memory.

The CAMK2A enzyme is made up of several identical subunits that form a complex. Chia et al. discovered that the mutation prevented these subunits from joining together properly, resulting in a faulty protein. CAMK2A and other related proteins are crucial for the health of the brain in a wide range of animals. Indeed, experiments in Caenorhabditis elegans, a roundworm commonly used to study neurons, confirmed that the mutation inherited by the children indeed caused similar neurological defects in the worms. Taken together, these experiments suggest that the children’s condition is caused by the mutation in both copies of the CAMK2A gene.

For patients born with inherited diseases, it is often difficult to pinpoint exactly which mutation is responsible for the specific disorder. These findings could therefore help pediatric geneticists recognize this newly defined syndrome and reach the correct diagnoses. These results could also be the starting point for studies that look into restoring the activity of the defective CAMK2A protein.More broadly, identifying genes that are critical for the healthy development of the brain could shed light on common neurological conditions, such as epilepsy and autism.

Introduction

Calcium/calmodulin-dependent protein kinase II (CAMK2) is a calcium-activated serine/threonine kinase that is extremely abundant in the brain, comprising as much as 0.3% of the total brain protein content (Bennett et al., 1983). CAMK2 is highly enriched at the synapses and is necessary for the process of long-term potentiation (LTP), the activity-dependent strengthening and modulation of synaptic activity that is thought to be the molecular basis of some forms of learning and memory (Kandel et al., 2014; Lisman et al., 2002). In humans, there are four genes encoding distinct CAMK2 iso-enzymes. CAMK2A and CAMK2B are the predominant isoforms in the nervous system, with CAMK2A being expressed 3–4 times higher than CAMK2B (Hanson and Schulman, 1992). Each enzyme comprises a kinase domain, a regulatory domain and an association domain. Structurally CAMK2 holoenzymes are homo- or hetero-oligomers, consisting of 12 or 14 CAMK2 subunits (Hudmon and Schulman, 2002b). The holoenzyme assembly requires the carboxy-terminal association domain, which forms stacked pairs of hexameric or heptameric rings with the regulatory and kinase domain projecting radially to interact with other essential proteins for CAMK2 function and localization (Bhattacharyya et al., 2016). In the absence of calcium signalling, CAMK2 is inactive, as the regulatory domain inhibits kinase function (Yang and Schulman, 1999). This auto-inhibition is relieved when calcium-loaded calmodulin binds to the regulatory domain, thereby exposing the kinase domain and allowing it to phosphorylate target substrates (Meador et al., 1993). Ca2+-Calmodulin binding also exposes Thr286 on the regulatory domain of CAMK2A, which becomes phosphorylated in trans by adjacent subunits. Once this residue is phosphorylated, the enzyme is persistently active, even in the absence of continual Ca2+-Calmodulin signaling (Rich and Schulman, 1998; Stratton et al., 2013). This switch from auto-inhibition to autonomous, persistent activity is thought to constitute a biochemical form of memory, which marks the neuron for having experienced a previous calcium influx (Bhattacharyya et al., 2016; Stratton et al., 2014; Stratton et al., 2013).

Mice that are homozygous null for CAMK2A are viable and display impaired spatial memory and reduced LTP in the hippocampus (Silva et al., 1992a, 1992b). The heterozygous mutant (Camk2a+/-) show a significant deficit in spatial working memory and contextual fear memory (Frankland et al., 2001; Matsuo et al., 2009). More recently, it was demonstrated that mice with neuron-specific conditional knock-out of CAMK2A similarly displayed learning deficits and defects in LTP that were comparable to the complete knockout mice (Achterberg et al., 2014). These findings suggest that neuron-intrinsic CAMK2A function is indispensable during the period of learning for memory formation. CAMK2 is conserved in invertebrates, such as D. melanogaster and C. elegans, where the kinase also plays critical roles in behavioral and cognitive traits (Cho et al., 1991; Hudmon and Schulman, 2002a; Reiner et al., 1999; Rongo and Kaplan, 1999). In C. elegans, the only CAMK2 is encoded by the unc-43 gene, which is essential for synaptic function (Rongo and Kaplan, 1999). Loss of unc-43 causes worms to have flaccid muscle tone, locomotion defects and spontaneous body contractions that resemble seizures (Reiner et al., 1999).

In pediatric care, global developmental delay in infants is defined as a significant functional delay in two or more developmental domains including gross and fine motor function, speech and language, cognition, social development and personal skills (Quality Standards Subcommittee of the American Academy of Neurology et al., 2003). These defects are detected at an early age in children age five years or under, and can persist throughout life (Shevell, 2008). About 25–50% of identified case are caused by germline genetic changes, including chromosomal abnormalities, copy number variants and monogenic mutations (Srour and Shevell, 2014; van Bokhoven, 2011). For many patients with global neuro-developmental delay, the genetic etiology remains unknown.

Results

Here, we report the identification of a consanguineous family from Jordan with two affected children manifesting global neuro-developmental delay with frequent seizures and convulsions. The two affected siblings had no dysmorphic features but failed to develop the ability to walk or speak (Figure 1A,B, Figure 1—figure supplement 1A). They displayed progressive psychomotor retardation with hypotonic muscles (Supplemental Material, Videos 1 and 2). Electroencephalogram (EEG) analysis revealed abnormal epileptiform transients (Figure 1C, Figure 1—figure supplement 1B), consistent with frequent myoclonic seizures. Magnetic resonance imaging (MRI) scan showed no major structural defects in the brain of proband II:4 (Figure 1—figure supplement 1C). Serum metabolite levels were normal, ruling out potential lysosomal storage disorders.

Figure 1. A new syndrome of global neuro-developmental delay with seizures caused by a biallelic mutation in CAMK2A.

(A) Pedigree of a consanguineous Jordanian family with two affected siblings with germline homozygous mutations in CAMK2A. The genotypes of all individuals were verified by Sanger sequencing. (B) Photographs of the two affected siblings with normal head circumferences. (C) EEG graph of patient II.I showing abnormal epileptiform transients (red boxes) (D) Homozygosity mapping delineates one candidate locus on chromosome 5. (E) CAMK2A exonic structure and CAMK2A protein domains. Patients II:1 and II:4 carry biallelic missense mutation p. H477Y located in CAMK2A association domain (AD). Nucleotide change c.1429 C > T refers to position on CAMK2A cDNA.

Figure 1.

Figure 1—figure supplement 1. Genetic and clinical findings from the two patients with global developmental delay.

Figure 1—figure supplement 1.

(A) Clinical table detailing the growth parameters and learning deficits of the two affected children. (B) EEG of patient II.4 showing abnormal waveforms (red box). (C) MRI images of patient II.4 showing no gross structural abnormalities in the brain. (D) Graphs showing homozygous regions identified through IBD mapping for each family member prior to filtering (E) Table of 4 homozygous genes that lie within the Chr. 5 IBD region.

Video 1. Video of patient II.1.

Download video file (19.1MB, mp4)
DOI: 10.7554/eLife.32451.005

Video 2. Video of patient II.4.

Download video file (23.3MB, mp4)
DOI: 10.7554/eLife.32451.006

Assuming autosomal recessive inheritance, we performed identity-by-descent (IBD) homozygosity mapping using genomic DNA from both parents, two affected probands and three healthy siblings. Only one candidate locus greater than 5 cM on chromosome 5 spanning 28 Mb was delineated (Figure 1D, Figure 1—figure supplement 1D). Whole-exome sequencing was subsequently performed on index case II:1. After filtering for variants with low quality and low sequencing coverage, 72 homozygous variants were identified, out of which four lie within the Chr. 5 IBD region (Table 1). Three of the homozygous variants had been previously annotated as known polymorphisms with minor allele frequencies > 0.0001. In addition, healthy individuals who are homozygous for the minor alleles had been identified in genomic sequencing databases such as dbSNP and gnomAD (Figure 1—figure supplement 1E). We therefore filtered out these variants as non-pathogenic. The fourth homozygous variant within the IBD region mapped to the CAMK2A gene (MIM: 114078), resulting in a missense mutation p.His477Tyr that has never been observed in previous large-scale sequencing databases and our in-house ethnically-matched cohort (Figure 1E, Figure 1—figure supplement 1E). Using Sanger sequencing, this private mutation was confirmed to segregate with the disease in all seven family members (Figure 1A,D).

Table 1. List of homozygous variants identified by Whole Exome Sequencing.

Chr Position Gene cDNA variant Protein variant
1 33,476,435 AK2 c.*45–1G > T
1 36,752,343 THRAP3 c.512C > T p.Ser171Phe
1 36,932,102 CSF3R c.2273C > T p.Thr758Ile
1 39,758,439 MACF1 c.1931G > T p.Gly644Val
1 145,365,316 NBPF10 c.9941G > A p.Gly3314Glu
2 11,758,842 GREB1 c.3841G > A p.Ala1281Thr
2 29,404,617 CLIP4 c.1976G > A p.Arg659Gln
2 64,779,195 AFTPH c.587G > A p.Gly196Glu
2 238,277,211 COL6A3 c.4895G > A p.Arg1632Gln
2 241,987,827 SNED1 c.1369G > A p.Glu457Lys
3 38,348,802 SLC22A14 c.574G > A p.Ala192Thr
3 44,672,687 ZNF197 c.524C > T p.Ala175Val
3 47,452,772 PTPN23 c.3484C > T p.Arg1162Trp
3 52,556,184 STAB1 c.6403C > G p.Pro2135Ala
3 67,426,232 SUCLG2 c.1235T > C p.Ile412Thr
3 197,422,844 KIAA0226 c.1366C > T p.Arg456Trp
4 9,174,981 FAM90A26P c.83T > G p.Val28Gly
4 9,175,603 FAM90A26P c.211C > G p.Pro71Ala
4 10,089,539 WDR1 c.743A > G p.His248Arg
4 15,529,151 CC2D2A c.1231T > G p.Ser411Ala
5 74,021,852 GFM2 c.1820_1825delTTGAGT p.Glu608_Phe609del
5 78,610,479 JMY c.2464C > A p.Pro822Thr
5 149,602,589 CAMK2A c.1429C > T p.His477Tyr
5 154,199,950 C5orf4 c.928G > A p.Glu310Lys
5 156,456,715 HAVCR1 c.1090G > A p.Ala364Thr
5 156,479,452 HAVCR1 c.590_592delCAA p.Thr198del
6 26,509,392 BTN1A1 c.1571G > A p.Gly524Glu
6 27,215,709 PRSS16 c.119G > A p.Ser40Asn
6 32,806,007 TAP2 c.4C > T p.Arg2Trp
6 33,260,924 RGL2 c.1876G > A p.Gly626Arg
6 38,704,952 DNAH8 c.221C > A p.Ala74Asp
6 43,412,643 ABCC10 c.2807C > T p.Pro936Leu
6 129,932,746 ARHGAP18 c.1054C > T p.Arg352Ter
6 131,946,054 MED23 c.235C > T p.Leu79Phe
6 151,674,121 AKAP12 c.4595_4596insGGC p.Asp1532delinsGluAla
6 168,479,677 FRMD1 c.98A > C p.Glu33Ala
7 5,352,665 TNRC18 c.7851_7856dupCTCCTC p.Ser2618_Ser2619dup
7 45,123,857 NACAD c.1922T > C p.Val641Ala
7 143,884,437 ARHGEF35 c.1040C > T p.Thr347Ile
7 149,422,981 KRBA1 c.1304C > T p.Ala435Val
7 151,680,130 GALNTL5 c.428A > G p.Tyr143Cys
8 12,285,064 FAM86B1|FAM86B2 c.310T > C p.Ser104Pro
8 12,285,250 FAM86B2 c.808C > T p.Arg270Trp
8 86,574,132 REXO1L1 c.1595A > C p.Asp532Ala
9 12,775,863 LURAP1L c.149_150insTGGCGG p.Gly49_Gly50dup
9 40,706,047 FAM75A3 c.3704A > G p.His1235Arg
9 41,323,425 FAM75A4 c.1908C > T p.Arg637Trp
9 41,323,469 FAM75A4 c.1864G > A p.Gly622Asp
9 43,822,668 CNTNAP3B c.1222C > T p.Leu408Phe
10 51,748,684 AGAP6 c.209G > A p.Arg70Gln
10 81,471,741 FAM22B c.2137T > C p.Trp713Arg
11 1,651,198 KRTAP5-5 c.129_137delAGGCTGTGG p.Gly44_Gly46del
11 12,316,388 MICALCL c.1408_1410dupCCT p.Pro470dup
12 7,045,917 ATN1 c.1488_1508delGCAGCAGCAGCAGCAGCAGCA p.Gln496_Gln502del
12 7,045,920 ATN1 c.1491_1508delGCAGCAGCAGCAGCAGCA p.Gln497_Gln502del
13 99,461,564 DOCK9 c.1271_1272insA p.Leu425LeufsTer?
13 114,503,875 FAM70B c.500_509 + 72delCCTGCGGGAGG
TGAGGGGCACCGGGGACCCCCATATC
TACACCTGCGGGAGGTGAGGGGC
GCTGGGGACCCCCGTATCTACA
14 105,411,514 AHNAK2 c.10274C > T p.Ala3425Val
14 106,994,118 IGHV3-48 c.47G > A p.Gly16Asp
16 29,496,359 c.916T > C p.Ser306Pro
16 30,772,988 C16orf93 c.82G > A p.Ala28Thr
16 70,215,817 CLEC18C c.521C > T p.Ala174Val
17 39,211,189 KRTAP2-2 c.275G > C p.Cys92Ser
19 1,026,716 CNN2 c.56A > C p.Lys19Thr
19 10,084,460 COL5A3 c.3584T > C p.Val1195Ala
19 14,517,213 CD97 c.1892G > A p.Ser631Asn
21 36,042,462 CLIC6 c.776_805delGCGTAGAAGCGGGGGTCCCGGCGGGGGACA p.Val260_Ser269del
22 18,834,773 c.329C > T p.Thr110Ile
X 48,920,059 CCDC120 c.110A > G p.Asp37Gly
X 55,116,478 PAGE2 c.25T > A p.Ser9Thr
X 150,832,702 PASD1 c.954_971delCCCAATGGACCAGCAGGA p.Pro319_Asp324del
X 153,050,158 SRPK3 c.1_5delGACAG p.Thr2LeufsTer57
X 154,010,046 MPP1 c.978A > C p.Glu326Asp

CAMK2A is a neuron-specific, highly abundant serine/threonine kinase that plays critical roles in synaptic plasticity. To understand how neuronal function is affected due to the mutation in CAMK2A, we reprogrammed primary dermal fibroblasts from patient II.4 into iPSCs, differentiated them into neurons and measured population-level neuronal activity using a multi-electrode array (MEA) system (Figure 2A). Compared to H1 embryonic stem cell derived neurons and an unrelated CAMK2A wild-type iPSC control, the patient’s iPSCs were equally efficient in differentiating into mature neurons expressing neuronal markers TUJ1 and MAP2 after 21 days of in vitro differentiation (Figure 2B). When these differentiated neurons were plated on MEA plates to measure spontaneous action potentials, we observed a significant reduction in both the total number of spontaneous spikes (Figure 2C, left) and the mean firing rate (Figure 2C, right) in the patient-derived neurons harboring the p.H477Y mutation compared to the wild-type controls, suggesting that CAMK2AH477Y causes a profound functional defect in cultured neurons.

Figure 2. CAMK2A mutant iPSC-derived neurons are functionally less active.

Figure 2.

(A) Schematic of the hPSC-derived neuronal activity assay with representative image of iPSC-derived neurons plated on a multi-electrode array (B) Representative confocal images of immunofluorescence staining of neuronal lineage markers TUJ1 (green) and MAP2 (red) show efficient differentiation of iPSCs into neurons. Scale bar represents 20 µm. (C) Graphs showing the number of neuron-evoked spikes and mean firing rate detected by multi-electrode arrays. (n = 7 per line per time-point; Values shown as mean ±SEM; Two-way ANOVA with Tukey post-hoc test; *p<0.05 and ***p<0.001).

The CAMK2A enzyme consists of an N-terminal catalytic kinase domain, a Ca2+-calmodulin-binding regulatory domain and a C-terminal association domain (AD) that is necessary for the assembly of the 12- or 14-subunit holoenzyme. The identified mutation, p.H477Y is located in the association domain (Figure 1E) and affects a histidine residue that is invariant across all vertebrate and invertebrate CAMK2A homologues. It is also conserved in other human CAMK2 paralogs with a similar association domain such as CAMK2B, CAMK2D and CAMK2G (Figure 3A, Figure 3—figure supplement 1A). In addition, this mutation is predicted to be deleterious by both SIFT, PolyPhen and MCAP algorithms. Structurally, His477 is located at the dimeric interface that forms part of the extensive interaction surface at the ‘equatorial’ plane of the CAMK2A holoenzyme (Figure 3B). Based on prior findings that CAMK2A oligomerization through its association domain is indispensable for substrate phosphorylation and synaptic localization (Bhattacharyya et al., 2016), we hypothesize that the p.H477Y allele is hypomorphic and that biallelic loss-of-function in CAMK2A is the direct cause for the neurodevelopmental phenotypes in the two probands.

Figure 3. p.H477Y affects CAMK2A oligomerization and protein stability.

(A) Sequence conservation of CAMK2A homologs. Histidine 477 (H477) is highlighted in red. (B) X-ray crystal structure of human CAMK2A AD tetradecamer (PDB: 5IG3). H477 (red) is located at the equatorial dimer interface. (C) Defective oligomerization of the p.H477Y mutant. 293 T cells were transiently transfected with FLAG tagged wild-type CAMK2A and CAMK2AH477Y. A third mutant, CAMK2AH477X which lacks part of the AD (a.a. 478–489) was used as positive control. (D) Defective self-association of the p.H477Y mutant. The indicated FLAG- and HA-tagged CAMK2A wild-type and mutant proteins were synthesized in vitro using rabbit reticulocyte lysate. FLAG-GFP was used a negative control. FLAG-tagged proteins were immunoprecipitated using anti-FLAG M2 agarose resin in the presence of 1% NP40. Co-immunoprecipitated proteins were analyzed by SDS-PAGE. *, IgG light chain. ^, IgG heavy chain. (E) p.H477Y mutation lowers expression of CAMK2A in cells. 293 T cells were transfected with reporter plasmids encoding GFP-tagged wild-type CAMK2A, CAMK2AH477Y and CAMK2AH477X mutants, followed by T2A peptide and mCherry. Representative confocal images show lower expression of mutant GFP- CAMK2AH477Y compared to wild-type. Scale bar represents 100 µm. (F). p.H477Y decreases CAMK2A stability via proteasomal degradation. 293 T cells were transfected as in (E) and treated with 10 µM MG132 or DMSO for 16 hr. 10 µg total cell lysate was used for SDS-PAGE and Western blot.

Figure 3.

Figure 3—figure supplement 1. Decreased stability and defective cytoplasmic localization of the CAMK2AH477Y mutant.

Figure 3—figure supplement 1.

(A) Sequence conservation of CAMK2 paralogs. His477 (red) is invariant in all human CAMK2 paralogues with an association domain. (B) p.H477Y mutant is subject to proteasomal degradation. 293 T cells were transfected with plasmids encoding GFP-tagged wild-type CAMK2A, p.H477Y and p.H477X mutants. Cells were incubated with DMSO or 2.5 μM MG132 for 16 hr 1 day post transfection. GFP intensity in the cells is increased in the CAMK2A p.H477Y and p.H477X mutants after MG132 treatment. Scale bar represents 100 µm.

To measure the oligomerization potential of the CAMK2AH477Y mutant in cells, we transiently expressed FLAG-tagged wild-type CAMK2A and CAMK2AH477Y mutant in 293 T cells, which do not express endogenous CAMK2A. A third mutant CAMK2AH477X, which lacks amino acids 477–489 and thus encodes a truncated association domain, was used as an additional control. Using native lysis conditions that preserve non-covalent macromolecular interactions, we found that wild-type CAMK2A forms a prominent complex with an apparent molecular weight ~1 MDa (Figure 3C, Native-PAGE, lane 2), which is consistent with the 12- or 14- subunit CAMK2A holoenzyme (Bhattacharyya et al., 2016). As compared to wild-type CAMK2A, the ~1 MDa, putatively oligomeric species was drastically reduced for the p.H477Y mutant and was undetectable for the p.H477X mutant (Figure 3C, Native-PAGE, lane 3 and 4 vs. lane 2). Next, we examined the ability of in vitro translated CAMK2A to self-oligomerize in a cell-free system. In contrast to the negative control protein GFP, wild-type FLAG-CAMK2A efficiently co-immunoprecipitated with HA-CAMK2A (Figure 3D, Lane 10 vs 11). This self-association was preserved between CAMK2AWT and CAMK2AH477Y (Figure 3D, lanes 12 and 15), but was completely lost between wild-type CAMK2A and the p.H477X mutant (Figure 3D, lane 13). In contrast, we could not detect any self-association between FLAG- CAMK2AH477Y and HA- CAMK2AH477Y (Figure 3D, Lane 16). Taken together, these results suggest that the missense p.H477Y partially disrupts the self-association between identical CAMK2A molecules, which had been shown to be required for holoenzyme assembly. The partial loss of function of the p.H477Y mutant, as compared to a more severe mutation p.H477X, is consistent with the observed autosomal recessive inheritance of the disease in the family, where the heterozygous carriers do not display apparent neuro-developmental symptoms.

During the course of this analysis, we noticed that both p.H477Y and p.H477X mutants had reduced protein abundance. This effect on the p.H477Y mutant was, however, subtle and could not readily explain the difference in the CAMK2A oligomer observed in the native gel (Figure 3C, SDS-PAGE). As it is known that in general fully assembled oligomeric complexes have enhanced stability in vivo compared to partially assembled complexes with disrupted folding like CAMK2AH477Y (Lord, 1996; Oromendia et al., 2012), we hypothesized that the p.H477Y mutant may exhibit reduced stability and undergo proteasomal degradation. To test this, 293T cells were transfected with reporter constructs that encode GFP tagged wild-type and mutant CAMK2A followed by a self-cleaving peptide T2A and mCherry (Figure 3E). The intensity of GFP fluorescence was used as a direct quantitative measure of CAMK2A stability with the mCherry as an internal control for transfection and translational efficiency. We observed a significant reduction in GFP intensity in cells expressing CAMK2AH477Y and CAMK2AH477X as compared to wild-type CAMK2A or GFP alone (Figure 3E) despite comparable mCherry fluorescence levels. This reduction was rescued when we treated the cells with MG132, which blocked proteasomal degradation. MG132 treamentled to enhanced accumulation of the p.H477Y and p.H477X mutant, with a greater effect on p.H477X (Figure 3F, lane 3, 4 vs lane 7, 8, Figure 3—figure supplement 1B). By contrast, the level of the wild-type protein was reduced, likely due to the toxic effects of MG132 (Figure 3F, lane 2 vs. lane 6). These results suggest that in addition to causing reduced holoenzyme assembly, the p.H477Y mutation might also directly or indirectly reduce the overall CAMK2A levels by compromising its half-life.

To unequivocally demonstrate the pathogenicity of the p.H477Y allele in vivo, we performed rescue experiments using C. elegans. A single ortholog of CAMK2, encoded by unc-43, is present in the worm genome and its functions in the nervous system are welldocumented (Reiner et al., 1999). To study the neuronal defects caused by loss of unc-43, we focused on motor neuron, DA9, which has its cell body located in the pre-anal ganglion with a dendrite that extends anteriorly and a posteriorly oriented axon extending via a commissure into the dorsal nerve cord, where it proceeds anteriorly to form approximately 25 en passant synapses onto body wall muscles and reciprocal inhibitory neurons (Figure 4A) (Klassen and Shen, 2007; Maeder et al., 2014). Using mCherry-tagged UNC-43, we observed that UNC-43 could be found along the entire DA9 neuron but concentrated at synaptic boutons (Figure 4B). The homologous patient-specific mutation p.H466Y in UNC-43 (homologous to p.H477Y in human CAMK2A) significantly disrupted the synaptic localization of UNC-43 and caused the protein to be dispersed throughout the entire axon (Figure 4B). To test the consequence of UNC-43 mutation on DA9 synaptic function, we used the itr-1 pB promoter to express the fluorescently conjugated synaptic vesicle marker RAB-3 (RAB3::GFP) within DA9 in both the wild-type and unc-43 mutant background. In wild-type animals, RAB-3::GFP accumulated in discrete puncta along the axon of DA9 at stereotyped synaptic locations. In the canonical unc-43(e408) loss-of-function mutant, we observed a reduction in individual pre-synaptic puncta fluorescence intensity as compared to wild-type animals. This phenotype could be rescued by cell-autonomous expression of wild-type unc-43 in DA9. However, expression of unc-43 harboring the homologous patient mutation UNC-43H466Y failed to rescue this defect (Figure 4C,D). In addition, transgenic expression of human wild-type CAMK2A fully rescued this defect, confirming the high degree of functional conservation between CAMK2A homologs, while the patient-derived human CAMK2AH477Y failed to do so (Figure 4C, bottom panels). These results suggest that the p.H477Y mutation is defective in supporting pre-synaptic function in C. elegans.

Figure 4. CAMK2AH477Y mutant fails to rescue synaptic defects in unc-43 C. elegans neurons.

Figure 4.

(A) Schematic drawing of C. elegans motor neuron, DA9 in the tail region. DA9 extends a dendrite (red) anteriorly and an axon (blue) that extends posteriorly crosses the midline of the animal and anteriorly in the dorsal nerve cord (DNC). It forms approximately 20 en passant synapses within a discrete stretch along the DNC (blue box). DA9 presynaptic vesicles were marked with RAB-3 (GFP::RAB-3). The asynaptic region (yellow box) is devoid of any synaptic vesicle accumulation. (B) The localization of mCherry::UNC-43 and mCherry::UNC-43(H466Y) in DA9 synapses. Note that UNC-43 accumulates at synaptic boutons while UNC-43(H466Y) is diffusely localized. Fluorescent intensity of mCherry::UNC-43 was measured at synaptic boutons and along the axonal shaft. Graph plots the ratio of fluorescence intensity at synaptic boutons compared to the axonal shaft of 30 synapses from three animals. Graph shows the mean and error bars show SEM, ***p-value 6.32e−19, Student’s T-test. (C) Representative confocal images demonstrating presynaptic puncta size changes between WT and unc-43(e408) mutants. unc-43 mutants have smaller presynaptic puncta along the DNC. This defect is rescued by expression of either UNC-43 or CAMK2A in DA9 whilst the mutated UNC-43H466Y and CAMK2AH477Y fail to rescue. (D) Quantification of average puncta intensity from WT and unc-43(e408) animals. Error bars represent SEM with number of synaptic puncta quantified n > 80, N.S. is not significant, ***p-value<0.001 (uninjected vs unc-43 p-value 5.0e8, uninjected vs unc-43H466Y p-value 4.17, uninjected vs CAMK2A p-value 4.25e−12, uninjected vs CAMK2AH477Y p-value 9.40), One-Way ANOVA with Bonferroni posthoc test. (E) Representative confocal images showing mislocalization of GFP::RAB-3 into the asynaptic region (yellow box) in unc-43 DA9 neuron. (F) Rescue of the unc-43(e408) phenotype by DA9 cell-specific expression of UNC-43 or CAMK2A. UNC-43H466Y and CAMK2AH477Y fail to rescue the unc-43 phenotype. Graph shows the percentage of animals with the WT and unc-43 mutant phenotypes. ***p<0.001 (unc-43 vs unc-43H466Y p-value 2.13e−51, CAMK2A vs CAMK2AH477Y p-value 3.77e−50), Fisher Exact test with n = 100 animals scored for each line. (G) Behavioral rescue by expressing wild-type UNC-43 or UNC-43H466Y in unc-43(e408) mutants. The behavior was scored as either wild-type or unc-43. Two independent worm lines were analyzed for each condition. *** p-value 5.29e−41, Fisher Exact test with n = 100 animals scored for each line.

Immediately posterior to the stretch of presynaptic puncta is an asynaptic domain within the DA9 axon that is devoid of any RAB-3::GFP fluorescence in wild-type animals (Figure 4E, top panel). Loss of unc-43 results in the mislocalization of the synaptic marker RAB3::GFP into this asynaptic region (Figure 4E, bottom panel). This defect could also be rescued by cell autonomous expression of either unc-43 or human CAMK2A. Patient derived mutation CAMK2AH477Y or the worm homologous mutation UNC-43H466Y both failed to rescue this phenotype (Figure 4E). In addition, expression of UNC-43H466Y in wild-type animals did not cause any synaptic defect or mislocalizaton of RAB3::GFP, suggesting that the mutation does not have dominant negative effects (Figure 4F).

We further tested if the patient derived mutation in CAMK2A impacted worm locomotor behavior. Null mutants for unc-43 are flaccid in posture and move with a flattened uncoordinated waveform. The animals are variably convulsive, often spontaneously contracting and relaxing their body-wall muscles in brief repeating bursts that resemble seizures (Reiner et al., 1999). We expressed either wild-type UNC-43 or UNC-43H466Y in the muscles and neurons of unc-43(e408) mutant worms and scored the behavior of young adults in a double-blind experiment. Only the wildtype UNC-43 was able to rescue the movement defects in unc-43(e408) animals, but not UNC-43H466Y, suggesting that UNC-43H466Y is not functional (Figure 4G). Together, the data show that CAMK2AH477Y is a loss-of-function mutation which fails to support synaptic function in vivo.

In summary, we have identified an autosomal recessive neurodevelopmental syndrome characterized by growth delay, frequent seizures and severe intellectual disability that is caused by a biallelic germline loss-of-function mutation in CAMK2A. Mechanistically this mutation disrupts CAMK2A self-oligomerization and holoenzyme assembly via its association domain. Our functional results are consistent with the high degree of evolutionary conservation of the affected residue H477 in CAMK2A orthologs, as well as previous structural data demonstrating that His477 is located in the interface between two stacked CAMK2A subunits, which together form the basic repeat unit of the ring-shaped holoenzyme (Bhattacharyya et al., 2016; Stratton et al., 2014). The pathogenicity of the biallelic p.H477Y mutation is furthered highlighted by rescue experiments in C. elegans, where in contrast to wild-type human CAMK2A the p.H477Y mutant failed to rescue the neuronal and behavioral defect in unc-43 (CAMK2 ortholog) null worms. Together, these data demonstrate that the loss of function of CAMK2A is the most plausible genetic cause for the neurodevelopmental defects observed in the two affected siblings.

Discussion

CAMK2 plays important and evolutionary conserved roles in synaptic plasticity, neuronal transmission and cognition in near all model organisms examined, and several groups have shown that somatic mutations in human CAMK2 isoforms may contribute to neurological disorders (Ghosh and Giese, 2015; Robison, 2014; Takemoto-Kimura et al., 2017). Notably, a de novo p.E183V mutation in the CAMK2A catalytic domain was shown to cause autism spectrum disorder (Stephenson et al., 2017). This mutation was shown to act in a dominant-negative manner to reduce wild-type CAMK2A auto-phosphorylation and localization to dendritic spines. While this manuscript was under revision, S. Küry et al. reported multiple families with intellectual disability caused by de novo, heterozygous mutations in both CAMK2A and CAMK2B kinase and auto-regulatory domains, which disrupted CAMK2 phosphorylation and caused neuronal migratory defects in murine models (Küry et al., 2017).

Our discovery of a novel neuro-developmental syndrome caused by biallelic CAMK2A mutations further broadens the spectrum of human neurological disorders caused by the CAMK2 family of kinases. To the best of our knowledge, this represents the first Mendelian human disease caused by biallelic CAMK2A mutations. Our functional characterization of the novel mutation p.H477Y in vitro and in vivo also reveal novel insights on how the CAMK2A holoenzyme regulates neuronal function. In contrast to all previously reported mutations in CAMK2A in intellectual disability syndromes, the p.H477Y is located within the C-terminal association domain and results in a partial but significant disruption of self-oligomerization, suggesting that the assembly of CAMK2A oligomers, in addition to its kinase function is required for neuronal function. Interestingly, the CAMK2AH477Y mutant retains the ability to interact with wild-type CAMK2A but not with itself (Figure 3D). CAMK2A displays very specific cellular and subcellular expression patterns that is important for regulating substrate phosphorylation in cells (Liu and Murray, 2012; Tsui et al., 2005). The p.H477Y missense affects the subcellular localization in neurons and this may affect its ability to function efficiently. These biochemical results provide a mechanistic basis for the autosomal recessive nature of the disease in our family: the p.H477Y allele is hypomorphic and becomes pathogenic when recessively inherited in the homozygous state. We speculate that heterozygous carriers retain sufficient CAMK2A activity for proper neuronal function. As compared to the milder disease phenotypes reported by Kury et. al., the symptoms afflicting the p.H477Y patients likely represent the most severe manifestation of the CAMK2A dysfunction in humans.

Due to the high degree of conservation of CAMK2A across evolution, we employed the established C. elegans unc-43 mutant to prove the pathogenicity of the p.H477Y mutation. UNC-43 is the worm homologue of vertebrate CAMK2. We demonstrated wild-type human CAMK2A could rescue the locomotive defects of the unc-43 mutants, while the p.H477Y mutant failed to do so, likely due to its inability to localize into neuronal synapses (Figure 4). We anticipate this in vivo functional assay in C. elegans to be widely applicable to assess the pathogenicity of newly discovered CAMK2 alleles found in human diseases.

Materials and methods

Key resources table.

Reagent type (species)
or resource
Designation Source or reference Identifiers Additional information
Gene (human) CAMK2A Calcium/Calmodulin Dependent Protein Kinase II Alpha Uniprot: Isoform B (identifier: Q9UQM7-2) Q9UQM7-2
Gene (C. elegans) unc-43 Calcium/Calmodulin-Dependent Protein Kinase type II Protein UNC-43 isoform d (Wormbase CDS K11E8.1d) K11E8.1d
Strain, strain background (C. elegans) Worm (C. elegans) N2 Bristol Strain;unc-43(e408) Caenorhabditis Genetics Center (CGC) PMID: 17941711 17941711
Recombinant DNA pCDH-CMV-MCS-EF1α-Neo Systems Biosciences (SBI) CD514B-1
Recombinant DNA pSM vector (a derivative of pPD49.26 with additional cloning sites) Modified for this paper NA ADDGENE https://media.addgene.org/cms/files/Vec95.pdf
Recombinant DNA pCDH-CMV-CAMK2A-T2A-mCherry This paper; based on pCDH-CMV-MCS-EF1α-Neo NA
Recombinant DNA pMIG-hOCT4 Addgene Plasmid #17225
Recombinant DNA MSCV h c-MYC IRES GFP Addgene Plasmid #18119
Recombinant DNA pMIG-hKLF4 Addgene Plasmid #17227
Recombinant DNA pMIG-hSOX2 Addgene Plasmid #17226
Cell line (human) Patient derived iPS neurons This paper NA
Cell line (human) 293T Lab stock NA
Chemical compound, drug MG132 Sigma-Aldrich M7449
Commercial kit NativeMark PAGE ThermoFisher BN1002BOX
Commercial kit TnT Quick Coupled Transcription/Translation System Promega L1170
Antibody Anti-FLAG Clone M2 Sigma-Aldrich F3165
Antibody Anti-HA Clone Y-11 Santa Cruz Biotechnology sc-7392
Antibody Anti-GADPH Santa Cruz Biotechnology sc-47724
Antibody Anti-Tuj1 Covance Research MMS-435P
Antibody Anti-MAP2 Synaptic Systems 188 004
Cell culture reagent 20% Knock Out Serum Replacement Thermo Fisher 10828–028
Cell culture reagent bFGF Stemgent 37316
Cell culture reagent Matrigel Basement Membrane Matrix Corning 354234
Cell culture reagent mTeSR1 STEMCELL Technologies 85850
Cell culture reagent CytoTune-iPS 2.0 Sendai Reprogramming Kit ThermoFisher A16517
Cell line (human) H1 embryonic stem cells Gift from Dr. Lawrence W. Stanton, WiCell RRID:CVCL_C813
Antibody Alexa Fluor 594 secondary Ab ThermoFisher Cat# A-11076, RRID:AB_2534120
Antibody Alexa Fluor 488 secondary Ab ThermoFisher Cat# A-11001, RRID:AB_2534069
Assay system/kit Maestro MEA System Axion Biosystem -

Disease diagnosis and informed consent

Patients were identified and diagnosed by clinical geneticists at King Hussein Medical Centre, Amman, Jordan. Informed consent was obtained from the families for genetic testing in accordance with approved institutional ethical guidelines (Institute of Medical Biology, Singapore, A*STAR, Singapore, NUS-IRB reference code 10–051). For patients in Figure 1, informed consent to publish photographs and videos was obtained from parents. Genomic DNA samples were isolated from saliva using the Oragene DNA collection kit (OG-500, DNAGenotek) and a punch skin biopsy was taken from patient II.4.

Whole exome sequencing

Whole exome sequencing of proband II-1 was performed using the Illumina TruSeq Exome Enrichment Kit for exome capture using 1 ug of genomic DNA. Illumina HiSeq2000 High-output mode was used for sequencing as 100 bp paired-end runs at the UCLA Clinical Genomics Centre and at the UCLA Broad Stem Cell Research Centre as previously described (Hu et al., 2014). An average coverage of 34X was achieved across the exome with 87% of these bases covered at ≥10X. After filtering, a total of 73 homozygous, 125 compound heterozygous and 493 heterozygous variants were protein-changing variants with population minor allele frequencies < 1%.

Homozygosity mapping

Both parents and their five children were genotyped using Illumina Humancore-12v1 BeadChips following manufacturer’s instructions. Call rates were above 99%. Gender and relationships were verified using Illumina BeadStudio. Mapping was performed by searching for shared regions that are homozygous and identical-by-descent (IBD) in the two affected children using custom programs written in the Mathematica (Wofram Research, Inc.) data analysis software (Source code file 1 - IBD linkage program). Candidate regions were further refined by exclusion of common homozygous segments with any unaffected family members. The confidence criteria to identify IBD blocks were a minimum of 5 cM. We identified one shared candidate loci on chromosome 5.

Cell culture and plasmid transfection

HEK 293 T cells (ATCC Cat# CRL-3216, RRID:CVCL_0063, from Lab Stock) were cultured in DMEM media (Gibco) supplemented with 10% FBS. Cell line identity was authenticated by commercial human STR profiling with ATCC (ATCC, #135-XV). All cell lines used in this paper tested negative for mycoplasma using Lonza MycoAlert (Lonza LT07). For transient transfection, 6 × 105 cells per well were seeded in 6 well plates 24 hr before being transfected with Lipofectamine 2000 (ThermoFisher)-complexed plasmids in OPTIMEM (ThermoFisher). To construct the CAMK2A expression plasmids, human CAMK2A cDNA was PCR-amplified from ImageClone with AscI and PacI restriction sites and cloned into pCDNA3.1 with an N-terminal 3xFLAG or 3xHA tag. All CAMK2A mutants were generated using QuikChange XL (Agilent). Cells were treated with MG132 (Sigma, M8699) at 5 µM to block proteasome degradation.

Generation of iPSCs

Control iPSCs from an unrelated but ethnically and sex-matched individual

Fibroblasts were transduced with OCT4, SOX2, KLF4 and c-MYC (Addgene plasmids #17225, #17226, #17227 were gifts from George Daley, and #18119 a gift from John Cleveland) as previously described (Park et al., 2008). After 4 days, transduced cells were reseeded onto irradiated mouse embryonic fibroblast in human ES cell medium (DMEM/F12 (Sigma, D6421) supplemented with 20% Knock Out Serum Replacement (Thermo Fisher Scientific, 10828–028), 0.1 mM 2-mercaptoethanol (Thermo Fisher Scientific, 21985–023), 2 mM L-glutamine (Thermo Fisher Scientific, 25030), 0.2 mM NEAA (Thermo Fisher Scientific, 11140–050) and 5 ng/mL bFGF (Stemgent, 03–0002). iPSC colonies were picked between days 17–28 and maintained in matrigel (Corning, 354234) and mTeSR1 (STEMCELL Technologies, 85850) for expansion.

Patient-derived iPSC from proband, II.4

Dermal primary fibroblasts were reprogrammed using the CytoTune-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific, A16517) in accordance with the manufacturer’s instructions. Cells were passaged and plated onto irradiated mouse embryonic feeders 7 days after viral transfection in human ES cell medium (DMEM/F12 (Sigma, D6421) supplemented with 20% Knock Out Serum Replacement (Thermo Fisher Scientific, 10828–028), 0.1 mM 2-mercaptoethanol (Thermo Fisher Scientific, 21985–023), 2 mM L-glutamine (Thermo Fisher Scientific, 25030), 0.2 mM NEAA (Thermo Fisher Scientific, 11140–050) and 5 ng/mL bFGF (Stemgent, 03–0002). iPSC colonies were picked between days 17–28 and maintained in Matrigel Basement Membrane Matrix (Corning, 354234) and mTeSR1 (STEMCELL Technologies, 85850) for expansion.

Neuronal differentiation and Multi-electrode Array Recordings

iPSCs-derived NPCs were differentiated into neurons for 21 days using a previously published protocol (Xu et al., 2017a). Briefly, NPCs were plated at a density of 50,000 cells/cm2 in a poly-L-ornithine and laminin-coated plates, cultured in N2B27 medium supplemented BDNF (20 ng/ml), GDNF (20 ng/ml), cAMP (N6,2’-O-dibutyryladenosine 3’,5’-cyclic monophosphate; Sigma; 0.3 mM) and ascorbic acid (0.2 mM). H1 embryonic stem cells (Gift from Lawrence W. Stanton, WiCell, RRID:CVCL_C813) were also differentiated into neurons to use as controls. H1 embryonic stem cells were verified by karyotyping (Cytogenetics Laboratory, KK Women's and Children's Hospital, Singapore) and checked for pluripotency by differentiation into the three germ layers marked by Nestin (ectoderm), AFP (endoderm) and ASM-1 (mesoderm). For the immunofluorescence staining, neurons were fixed for 15 min in ice cold 4% (w/v) paraformaldehyde. Permeabilization using 0.3% (v/v) Triton-X in 1X PBS was performed for 10 min then incubated with 1:1000 mouse anti-Tuj1 (Covance Research Products Inc Cat# MMS-435P, RRID:AB_2313773), 1:1500 guinea pig anti-MAP2 (Synaptic Systems Cat# 188 004, RRID:AB_2138181) overnight at 4°C in 5% (w/v) BSA diluted with 1X PBS. For visualization, 1:1000 secondary antibody conjugated to Alexa Fluor 594 (Thermo Fisher Scientific Cat# A-11076, RRID:AB_2534120) or Alexa Fluor 488 (Thermo Fisher Scientific Cat# A-11001, RRID:AB_2534069) was applied. Counter staining for nuclei were performed using Dapi. Images were captured using the FV3000 Olympus confocal.

For the multi-electrode array (MEA) recordings, neurons on day 21 were dissociated and replated on 0.1 polyethylenimine (Sigma)-coated 48 well MEA plates (Axion Biosystems) in BrainPhys media supplemented with BDNF, GDNF, cAMP and ascorbic acid as previously described (Xu et al., 2017b). Spontaneous neuronal activity was observed and recorded at 37°C for 5 min every 2–3 days using the Maestro MEA System (Axion Biosystem). Independent measurements were taken from seven wells for each condition (technical replicates).

In vitro transcription/translation and co-immunoprecipitation

CAMK2A proteins were synthesized in vitro using TNT T7 Quick Coupled Transcription/Translation (Promega) with 1 μg of plasmids in 20 μl reaction volumes for 90 mins at 30°C. For co-immunoprecipitation, the reactions were diluted 10x in TBS (100 mM Tris-HCl, pH = 8, 150 mM NaCl) with 1% Nonidet P40 (NP40) and incubated with 10 μl anti-FLAG M2 agarose beads (Sigma) at 4°C overnight. Proteins were eluted with 1x Laemmli buffer after 3 washes in the 1xTBS with 1% NP40.

Protein electrophoresis and immunoblotting

Total protein lysate was quantified using a standard Bradford assay and 10 μg of lysate was used for immunoblotting experiments. For Blue Native PAGE, cells were lysed in 1x Sample Preparation buffer (ThermoFisher) containing 1% digitonin. 1% SDS was supplemented for SDS-PAGE. All proteins were transferred to PVDF membranes using TurboBlot (Bio-rad) at 2.5 mA for seven mins. The primary antibodies used were anti-FLAG (M2, Sigma-Aldrich Cat# F3165, RRID:AB_259529), anti-GAPDH (Santa Cruz Biotechnology Cat# sc-47724, RRID:AB_627678) and anti-HA (Y-11, Santa Cruz Biotechnology Cat# sc-805, RRID:AB_631618). The secondary antibodies were anti-rabbit IgG-HRP (Jackson ImmunoResearch Labs Cat# 111-035-003, RRID:AB_2313567), anti-mouse IgG-HRP (light chain specific) (Jackson ImmunoResearch Labs Cat# 205-032-176, RRID:AB_2339056) and anti-mouse IgG-HRP (Jackson ImmunoResearch Labs Cat# 115-035-003, RRID:AB_10015289).

Worm strains

All strains were maintained at 20°C on OP50 E. coli nematode growth medium plates as described (Brenner, 1974). N2 Bristol strain worms (WB Cat# CB4852, RRID:WB-STRAIN:CB4852) were used as the WT reference, and the unc-43(e408) mutant was used. To visualize synaptic vesicles in DA9 neuron, wyIs85 [Pitr-1::GPF::RAB-3] was used (Klassen and Shen, 2007).

Transgenic lines

OTL70 wyIs85[Podr-1::dsred, Pitr-1::gfp::rab-3]; jpnEx40[Podr-1::gfp, Pmig-13::unc-43]

OTL71 wyIs85; jpnEx41[Podr-1::gfp, Pmig-13::unc-43]

OTL72 unc-43(e408); wyIs85; jpnEx44[Podr-1::gfp, Pmig-13::unc-43(H466Y)]

OTL73 unc-43(e408); wyIs85; jpnEx45[Podr-1::gfp, Pmig-13::unc-43(H466Y)]

OTL74 unc-43(e408); wyIs85; jpnEx42[Podr-1::gfp, Pmig-13::unc-43]

OTL75 unc-43(e408); wyIs85; jpnEx43[Podr-1::gfp, Pmig-13::unc-43]

OTL76 unc-43(e408); wyIs85; jpnEx47[Podr-1::gfp, Pmig-13::CAMK2A]

OTL77 unc-43(e408); wyIs85; jpnEx48[Podr-1::gfp, Pmig-13::CAMK2A]

OTL78 unc-43(e408); wyIs85; jpnEx49[Podr-1::gfp, Pmig-13::CAMK2AH477Y]

OTL79 unc-43(e408); wyIs85; jpnEx50[Podr-1::gfp, Pmig-13::CAMK2AH477Y]]

OTL82: jpnEx54[Podr-1::gfp, Pmig-13::mcheery::unc-43]

OTL83: jpnEx55[Podr-1::gfp, Pmig-13::mcherry::unc-43]

OTL84: jpnEx56[Podr-1::gfp, Pmig-13::mcherry::unc-43(H466Y)]

OTL85: jpnEx57[Podr-1::gfp, Pmig-13::mcherry::unc-43(H466Y)]

OTL86: unc-43(e408); jpnEx58[Punc-122::dsred, Punc-104::mcherry::unc-43, Phlh-1::mcherry::unc-43]

OTL87: unc-43(e408); jpnEx59[Punc-122::dsred, Punc-104::mcherry::unc-43, Phlh-1::mcherry::unc-43]

OTL88: unc-43(e408); jpnEx60[Punc-122::dsred, Punc-104::mcherry::unc-43(H466Y), Phlh-1::mcherry::unc-43(H466Y)]

OTL89: unc-43(e408); jpnEx61[Punc-122::dsred, Punc-104::mcherry::unc-43(H466Y), Phlh-1::mcherry::unc-43(H466Y)]

Plasmids for transgenic expression in worms

Expression plasmids for transgenic worm lines were made using the pSM vector (C. Bargmann), a derivative of pPD49.26 (A. Fire). The mig-13 promoter was cloned between SphI/AscI, and C.elegans unc-43 isoform d or human CAMK2α was cloned between NheI/KpnI or AscI/NheI, respectively. P.H466Y and p.H477Y mutations were introduced by PCR-based mutagenesis using KOD-plus- high fidelity DNA polymerase (TOYOBO, Tokyo, Japan). Transgenic worms were generated as described (Mello, 1995). Plasmids were injected into animals at 10 ng/μl (in the case of Pmig-13::unc-43) and 50 ng/μl (in the case of Pmig-13::CAMK2α) together with coinjection markers at 90 ng/μl.

Fluorescence quantification and confocal imaging

All fluorescence images of DA9 were taken in live worms immobilized with 5% agar pad, 10 μM levamisol (Sigma) and 0.1 mm polystylene beads (Polysciences, Inc., Warrington, PA, USA) with a 63×/1.4 NA objective on a Zeiss Axioplan 2 Imaging System or a Plan-Apochromat 63×/1.3 objective on a Zeiss LSM710 confocal microscope using similar imaging parameters for the same marker across different genotypes. Fluorescence quantification was determined using Image J software (ImageJ, RRID:SCR_003070).

Behavioral analysis

mcherry::unc-43 or mcherry::unc-43(H466Y) were expressed in unc-43(e403) mutant worms using both unc-104 promoter (neuron-specific promoter) and hlh-1 promoter (muscle-specific promoter). Two independent lines were established and analyzed. The behavioral phenotype of the transgenic worms was scored in a double-blind manner using a stereo microscope (SZX16, Olumpus, Tokyo, Japan). From the movement behavior on OP50 feeder NGM plates, each worm was classified to behave like ‘wild-type’ or ‘unc-43’. 100 worms were observed for each genotype on the same day from two independently derived transgenic lines.

Acknowledgements

We would like to thank all patient family members for their kind participation in this study. We would like to acknowledge funding support from the Strategic Positioning Fund for Genetic Orphan Diseases from the Agency for Science, Technology, and Research in Singapore. We are grateful to all members of the BR Laboratory for their support. MAP is supported by grants from the Agency for Science Technology and Research (Singapore), and the National University of Singapore (Singapore). BR is a fellow of the Branco Weiss Foundation and a recipient of the A*STAR Investigatorship and EMBO Young Investigator.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Poh Hui Chia, Email: Pohhui.chia@reversade.com.

Franklin Lei Zhong, Email: franklin.zhong@reversade.com.

Bruno Reversade, Email: bruno@reversade.com.

Partha Majumder, National Institute of Biomedical Genomics, India.

Funding Information

This paper was supported by the following grant:

  • Agency for Science, Technology and Research GODAFIT Strategic Positioning Fund to Bruno Reversade.

Additional information

Competing interests

No competing interests declared.

Author contributions

Conceptualization, Resources, Data curation, Supervision, Funding acquisition, Visualization, Methodology, Writing—original draft, Project administration, Writing—review and editing.

Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing—original draft, Project administration, Writing—review and editing.

Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing—original draft, Project administration, Writing—review and editing.

Resources, Formal analysis, Validation, Investigation.

Data curation, Validation, Project administration.

Formal analysis, Investigation.

Formal analysis, Investigation.

Formal analysis, Investigation.

Formal analysis, Investigation.

Data curation, Supervision.

Formal analysis, Validation, Investigation.

Resources.

Resources.

Resources, Investigation.

Resources, Funding acquisition.

Resources.

Ethics

Human subjects: Informed consent was obtained from the families for genetic testing in accordance with approved institutional ethical guidelines (Institute of Medical Biology, Singapore, A*STAR, Singapore, NUS-IRB reference code 10-051). Parent of the patients has signed the eLife Consent to Publish Form and is available if necessary.

Additional files

Supplemental file 1. Statistical Data Analysis.
elife-32451-fig1.xlsx (24.1KB, xlsx)
DOI: 10.7554/eLife.32451.012
Source code 1. IBD linkage program.
elife-32451-code1.nb (4.6MB, nb)
DOI: 10.7554/eLife.32451.013
Transparent reporting form
DOI: 10.7554/eLife.32451.014

References

  1. Achterberg KG, Buitendijk GH, Kool MJ, Goorden SM, Post L, Slump DE, Silva AJ, van Woerden GM, Kushner SA, Elgersma Y. Temporal and region-specific requirements of αCaMKII in spatial and contextual learning. Journal of Neuroscience. 2014;34:11180. doi: 10.1523/JNEUROSCI.0640-14.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bennett MK, Erondu NE, Kennedy MB. Purification and characterization of a calmodulin-dependent protein kinase that is highly concentrated in brain. The Journal of Biological Chemistry. 1983;258:12735–12744. [PubMed] [Google Scholar]
  3. Bhattacharyya M, Stratton MM, Going CC, McSpadden ED, Huang Y, Susa AC, Elleman A, Cao YM, Pappireddi N, Burkhardt P, Gee CL, Barros T, Schulman H, Williams ER, Kuriyan J. Molecular mechanism of activation-triggered subunit exchange in Ca(2+)/calmodulin-dependent protein kinase II. eLife. 2016;5:e13405. doi: 10.7554/eLife.13405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Brenner S. The Genetics of CAENORHABDITIS ELEGANS. Genetics. 1974;77:71. doi: 10.1093/genetics/77.1.71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cho KO, Wall JB, Pugh PC, Ito M, Mueller SA, Kennedy MB. The alpha subunit of type II Ca2+/calmodulin-dependent protein kinase is highly conserved in Drosophila. Neuron. 1991;7:439–450. doi: 10.1016/0896-6273(91)90296-C. [DOI] [PubMed] [Google Scholar]
  6. Frankland PW, O'Brien C, Ohno M, Kirkwood A, Silva AJ. Alpha-CaMKII-dependent plasticity in the cortex is required for permanent memory. Nature. 2001;411:309–313. doi: 10.1038/35077089. [DOI] [PubMed] [Google Scholar]
  7. Ghosh A, Giese KP. Calcium/calmodulin-dependent kinase II and Alzheimer's disease. Molecular Brain. 2015;8:78. doi: 10.1186/s13041-015-0166-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Hanson PI, Schulman H. Neuronal Ca2+/calmodulin-dependent protein kinases. Annual Review of Biochemistry. 1992;61:559–601. doi: 10.1146/annurev.bi.61.070192.003015. [DOI] [PubMed] [Google Scholar]
  9. Hu WF, Pomp O, Ben-Omran T, Kodani A, Henke K, Mochida GH, Yu TW, Woodworth MB, Bonnard C, Raj GS, Tan TT, Hamamy H, Masri A, Shboul M, Al Saffar M, Partlow JN, Al-Dosari M, Alazami A, Alowain M, Alkuraya FS, Reiter JF, Harris MP, Reversade B, Walsh CA. Katanin p80 regulates human cortical development by limiting centriole and cilia number. Neuron. 2014;84:1240–1257. doi: 10.1016/j.neuron.2014.12.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Hudmon A, Schulman H. Neuronal CA2+/calmodulin-dependent protein kinase II: the role of structure and autoregulation in cellular function. Annual Review of Biochemistry. 2002a;71:473–510. doi: 10.1146/annurev.biochem.71.110601.135410. [DOI] [PubMed] [Google Scholar]
  11. Hudmon A, Schulman H. Structure-function of the multifunctional Ca2+/calmodulin-dependent protein kinase II. Biochemical Journal. 2002b;364:593. doi: 10.1042/bj20020228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Kandel ER, Dudai Y, Mayford MR. The molecular and systems biology of memory. Cell. 2014;157:163–186. doi: 10.1016/j.cell.2014.03.001. [DOI] [PubMed] [Google Scholar]
  13. Klassen MP, Shen K. Wnt signaling positions neuromuscular connectivity by inhibiting synapse formation in C. elegans. Cell. 2007;130:704–716. doi: 10.1016/j.cell.2007.06.046. [DOI] [PubMed] [Google Scholar]
  14. Küry S, van Woerden GM, Besnard T, Proietti Onori M, Latypova X, Towne MC, Cho MT, Prescott TE, Ploeg MA, Sanders S, Stessman HAF, Pujol A, Distel B, Robak LA, Bernstein JA, Denommé-Pichon AS, Lesca G, Sellars EA, Berg J, Carré W, Busk ØL, van Bon BWM, Waugh JL, Deardorff M, Hoganson GE, Bosanko KB, Johnson DS, Dabir T, Holla ØL, Sarkar A, Tveten K, de Bellescize J, Braathen GJ, Terhal PA, Grange DK, van Haeringen A, Lam C, Mirzaa G, Burton J, Bhoj EJ, Douglas J, Santani AB, Nesbitt AI, Helbig KL, Andrews MV, Begtrup A, Tang S, van Gassen KLI, Juusola J, Foss K, Enns GM, Moog U, Hinderhofer K, Paramasivam N, Lincoln S, Kusako BH, Lindenbaum P, Charpentier E, Nowak CB, Cherot E, Simonet T, Ruivenkamp CAL, Hahn S, Brownstein CA, Xia F, Schmitt S, Deb W, Bonneau D, Nizon M, Quinquis D, Chelly J, Rudolf G, Sanlaville D, Parent P, Gilbert-Dussardier B, Toutain A, Sutton VR, Thies J, Peart-Vissers L, Boisseau P, Vincent M, Grabrucker AM, Dubourg C, Tan WH, Verbeek NE, Granzow M, Santen GWE, Shendure J, Isidor B, Pasquier L, Redon R, Yang Y, State MW, Kleefstra T, Cogné B, Petrovski S, Retterer K, Eichler EE, Rosenfeld JA, Agrawal PB, Bézieau S, Odent S, Elgersma Y, Mercier S, Undiagnosed Diseases Network. GEM HUGO. Deciphering Developmental Disorders Study De novo mutations in protein kinase genes camk2a and CAMK2B cause intellectual disability. American Journal of Human Genetics. 2017;101:768–788. doi: 10.1016/j.ajhg.2017.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Lisman J, Schulman H, Cline H. The molecular basis of CaMKII function in synaptic and behavioural memory. Nature reviews. Neuroscience. 2002;3:175–190. doi: 10.1038/nrn753. [DOI] [PubMed] [Google Scholar]
  16. Liu XB, Murray KD. Neuronal excitability and calcium/calmodulin-dependent protein kinase type II: location, location, location. Epilepsia. 2012;53:45–52. doi: 10.1111/j.1528-1167.2012.03474.x. [DOI] [PubMed] [Google Scholar]
  17. Lord JM. Protein degradation: Go outside and see the proteasome. Current Biology. 1996;6:1067–1069. doi: 10.1016/S0960-9822(02)70666-0. [DOI] [PubMed] [Google Scholar]
  18. Maeder CI, San-Miguel A, Wu EY, Lu H, Shen K. In vivo neuron-wide analysis of synaptic vesicle precursor trafficking. Traffic. 2014;15:273–291. doi: 10.1111/tra.12142. [DOI] [PubMed] [Google Scholar]
  19. Matsuo N, Yamasaki N, Ohira K, Takao K, Toyama K, Eguchi M, Yamaguchi S, Miyakawa T. Neural activity changes underlying the working memory deficit in alpha-CaMKII heterozygous knockout mice. Frontiers in Behavioral Neuroscience. 2009;3:20. doi: 10.3389/neuro.08.020.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Meador WE, Means AR, Quiocho FA. Modulation of calmodulin plasticity in molecular recognition on the basis of x-ray structures. Science. 1993;262:1718–1721. doi: 10.1126/science.8259515. [DOI] [PubMed] [Google Scholar]
  21. Mello C. DNA transformation. Methods Cell Biology. 1995;48:451–482. doi: 10.1016/S0091-679X(08)61399-0. [DOI] [PubMed] [Google Scholar]
  22. Oromendia AB, Dodgson SE, Amon A. Aneuploidy causes proteotoxic stress in yeast. Genes & Development. 2012;26:2696–2708. doi: 10.1101/gad.207407.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Park IH, Zhao R, West JA, Yabuuchi A, Huo H, Ince TA, Lerou PH, Lensch MW, Daley GQ. Reprogramming of human somatic cells to pluripotency with defined factors. Nature. 2008;451:141. doi: 10.1038/nature06534. [DOI] [PubMed] [Google Scholar]
  24. Shevell M, Ashwal S, Donley D, Flint J, Gingold M, Hirtz D, Majnemer A, Noetzel M, Sheth RD, Quality Standards Subcommittee of the American Academy of Neurology. Practice Committee of the Child Neurology Society practice parameter: evaluation of the child with global developmental delay: report of the quality standards subcommittee of the american academy of neurology and the practice committee of the child neurology society. Neurology. 2003;60:367–380. doi: 10.1212/01.WNL.0000031431.81555.16. [DOI] [PubMed] [Google Scholar]
  25. Reiner DJ, Newton EM, Tian H, Thomas JH. Diverse behavioural defects caused by mutations in Caenorhabditis elegans unc-43 CaM kinase II. Nature. 1999;402:199–203. doi: 10.1038/46072. [DOI] [PubMed] [Google Scholar]
  26. Rich RC, Schulman H. Substrate-directed function of calmodulin in autophosphorylation of Ca2+/calmodulin-dependent protein kinase II. Journal of Biological Chemistry. 1998;273:28424–28429. doi: 10.1074/jbc.273.43.28424. [DOI] [PubMed] [Google Scholar]
  27. Robison AJ. Emerging role of CaMKII in neuropsychiatric disease. Trends in Neurosciences. 2014;37:653–662. doi: 10.1016/j.tins.2014.07.001. [DOI] [PubMed] [Google Scholar]
  28. Rongo C, Kaplan JM. CaMKII regulates the density of central glutamatergic synapses in vivo. Nature. 1999;402:195–199. doi: 10.1038/46065. [DOI] [PubMed] [Google Scholar]
  29. Shevell M. Global developmental delay and mental retardation or intellectual disability: conceptualization, evaluation, and etiology. Pediatric clinics of North America. 2008;55:1071–1084. doi: 10.1016/j.pcl.2008.07.010. [DOI] [PubMed] [Google Scholar]
  30. Silva AJ, Paylor R, Wehner JM, Tonegawa S. Impaired spatial learning in alpha-calcium-calmodulin kinase II mutant mice. Science. 1992a;257:206–211. doi: 10.1126/science.1321493. [DOI] [PubMed] [Google Scholar]
  31. Silva AJ, Stevens CF, Tonegawa S, Wang Y. Deficient hippocampal long-term potentiation in alpha-calcium-calmodulin kinase II mutant mice. Science. 1992b;257:201–206. doi: 10.1126/science.1378648. [DOI] [PubMed] [Google Scholar]
  32. Srour M, Shevell M. Genetics and the investigation of developmental delay/intellectual disability. Archives of Disease in Childhood. 2014;99:386–389. doi: 10.1136/archdischild-2013-304063. [DOI] [PubMed] [Google Scholar]
  33. Stephenson JR, Wang X, Perfitt TL, Parrish WP, Shonesy BC, Marks CR, Mortlock DP, Nakagawa T, Sutcliffe JS, Colbran RJ. A novel human CAMK2A mutation disrupts dendritic morphology and synaptic transmission, and causes ASD-related behaviors. Journal of Neuroscience. 2017;37:2216–2233. doi: 10.1523/JNEUROSCI.2068-16.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Stratton M, Lee IH, Bhattacharyya M, Christensen SM, Chao LH, Schulman H, Groves JT, Kuriyan J. Activation-triggered subunit exchange between CaMKII holoenzymes facilitates the spread of kinase activity. eLife. 2014;3:e01610. doi: 10.7554/eLife.01610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Stratton MM, Chao LH, Schulman H, Kuriyan J. Structural studies on the regulation of Ca2+/calmodulin dependent protein kinase II. Current Opinion in Structural Biology. 2013;23:292–301. doi: 10.1016/j.sbi.2013.04.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Takemoto-Kimura S, Suzuki K, Horigane SI, Kamijo S, Inoue M, Sakamoto M, Fujii H, Bito H. Calmodulin kinases: essential regulators in health and disease. Journal of Neurochemistry. 2017;141:808–818. doi: 10.1111/jnc.14020. [DOI] [PubMed] [Google Scholar]
  37. Tsui J, Inagaki M, Schulman H. Calcium/calmodulin-dependent protein kinase II (CaMKII) localization acts in concert with substrate targeting to create spatial restriction for phosphorylation. Journal of Biological Chemistry. 2005;280:9210–9216. doi: 10.1074/jbc.M407653200. [DOI] [PubMed] [Google Scholar]
  38. van Bokhoven H. Genetic and epigenetic networks in intellectual disabilities. Annual Review of Genetics. 2011;45:81–104. doi: 10.1146/annurev-genet-110410-132512. [DOI] [PubMed] [Google Scholar]
  39. Xu X, Radulescu C, Utami K, Pouladi M. Obtaining multi-electrode array recordings from human induced pluripotent stem cell–derived neurons. Bio-Protocol. 2017a;7 doi: 10.21769/BioProtoc.2609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Xu X, Tay Y, Sim B, Yoon SI, Huang Y, Ooi J, Utami KH, Ziaei A, Ng B, Radulescu C, Low D, Ng AYJ, Loh M, Venkatesh B, Ginhoux F, Augustine GJ, Pouladi MA. Reversal of phenotypic abnormalities by crispr/cas9-mediated gene correction in huntington disease patient-derived induced pluripotent stem cells. Stem Cell Reports. 2017b;8:619–633. doi: 10.1016/j.stemcr.2017.01.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Yang E, Schulman H. Structural examination of autoregulation of multifunctional calcium/calmodulin-dependent protein kinase II. Journal of Biological Chemistry. 1999;274:26199–26208. doi: 10.1074/jbc.274.37.26199. [DOI] [PubMed] [Google Scholar]

Decision letter

Editor: Partha Majumder1

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "A homozygous loss-of-function CAMK2A mutation causes growth delay, frequent seizures and severe intellectual disability" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and K VijayRaghavan as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Karl Giese (Reviewer #1); A.J Robison (Reviewer #3).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

All reviewers have substantive comments, most of which are non-overlapping. Some of the comments require you to carry out new experiments. For submitting a revised version, it is essential that you address all the comments of all the reviewers. Along with your revised submission, please attach a point-by-point statement of the actions taken by you. If you disagree with any of the points raised by the reviewers, please state so with justification in your actions-taken-report.

Reviewer #1:

This manuscript is of fundamental importance for the CaMKII field, as for the first time it makes a convincing case that CaMKII dysfunction is relevant for brain diseases. The strength of the manuscript is that a family is described where two children are homozygous for a missense mutation in CaMKIIalpha. Biochemical characterisation of the missense mutation strongly suggests that this mutation causes loss-of function, by not only preventing oligomerisation of CaMKIIalpha subunits, but also mislocalising CaMKIIalpha to the nucleus and enhancing the proteasomal dedragation of the kinase subunits. I think that this work is important that it deserves to be published in eLife. I have some suggestions that can further strengthen the manuscript:

1) I could not find any data regarding impaired intellectual disability. If possible, could such data be included?

2) Regarding the table in Figure 1—figure supplement 1, it would be amazing if data for heterozygous and wild-type children could be included. This would provide very strong evidence that specifically the missense mutation causes the observed phenotypes. Would you have patient consent to include such information?

3) The authors found that the identified missense mutation mislocalizes CaMKIIalpha to nucleus in a non-neuronal cell line. If possible, it would be good to show that this also happens in primary neurons. This would suggest that CaMKIIalpha with the missense mutation is not delivered to synapses, substantially blocking synaptic plasticity.

4) Unfortunately, the presented in vivo studies with C. elegans focus on the wrong neuronal cell type. In mammals CaMKIIalpha is expressed exclusively in glutamatergic neurons (not cholinergic motoneurons). Therefore, I think that Figure 2 must be removed from the manuscript, as the findings are misleading. -- In my opinion, for this manuscript it is not necessary to include in vivo data. However, if authors wish to include in vivo data, then they should focus on the correct neuronal cell type in any in vivo system.

Reviewer #2:

Chia and colleagues have authored a potentially important manuscript identifying an association between a novel homozygous missense mutation in CAMK2A and global neurodevelopmental delay with severe intellectual disability, seizures, and delayed growth. Although interesting, a number of major issues need to be addressed:

1) Substantially more details are required regarding the genetic analysis, in order to better establish the likely causality of the candidate CAMK2A mutation. In particular, the workflow by which the proposed causative variant has been identified needs to be much better clarified.

a) Can the authors provide additional pedigree data regarding the parental consanguineous relationship? If not, then on what basis are the parents reported as consanguineous?

b) The authors should provide the genome-wide results of the homozygosity mapping prior to filtering out homozygous segments found in the unaffected family members, and prior to filtering for regions of homozygosity >5cM.

c) On what basis have the authors established the "confidence criteria to identify IBD blocks were a minimum of 5 cM"?

d) Regarding the variants identified by exome sequencing, the authors should minimally provide a list of all 72 homozygous protein-coding variants with MAF<1%, and sufficient information to determine their localization within the regions of homozygosity in all of the genotyped family members.

2) Functional experiments: a) The authors convincingly establish that the H477Y mutation blocks oligomerization of the CAMK2A holoenzyme. However, they subsequently attempt to evaluate protein stability using MG132. I have some difficulties with this experiment.

Specifically, how can it be that in the DMSO treated lysates (Figure 2—figure supplement 2C), such big differences are found between the different CAMK2A construct expression levels, whereas in Figure 1H the expression levels are similar?

Was each experiment done at different time points after transfection?

How do the authors control for transfection efficiency? Based on the results shown here, in the absence of a demonstration that the transfection efficiency was equal across the various constructs, it is difficult to reach a firm conclusion regarding the stability or expression levels of CAMK2A [H477Y].

b) Figure 2C and 2E: The images provided are consistent with a rescue of the synaptic phenotype when expressing either Unc-43 or wild-type human CAMK2, but not with the H477Y mutant. However, the experimental design is unclear.

The legend reports n>80 (Figure 2C) and n=100 (Figure 2E). But what does 'n' represent (e.g., is this the number of puncta, images, or worms measured)? For Figure 2C, why is it not possible to provide an exact value?

c) Figure 2C: Why do the authors use a Student's t-test for these data? If they want to compare the different conditions, a one-way ANOVA with post-hoc correction should be applied.

d) Figure 2D: By what criteria have the authors defined the asynaptic region?

e) The Unc-43 worm has clear phenotypes, as the authors themselves describe in the Results section: "Null mutants for unc-43 are flaccid in posture and move with a flattened uncoordinated waveform." These phenotypes are very clear. Why didn't they try rescuing these phenotypes? This would have provided a much stronger opportunity to assess the functional relevance of the rescue experiments.

f) What is the relevance of examining the localization of the association domain? The authors reason that since the mutation blocks oligomerization, it is more likely to diffuse through the nuclear pore, thereby reducing cytosolic accumulation. But does the association domain itself oligomerize in HEK293T cells?

The authors seem to infer on the basis of these experiments that CAMK2A is likely to be mislocalized in the homozygous H477Y carriers. However, they would need to show the same experiment using full-length reference and mutant CAMK2A in order to establish more definitive evidence.

Reviewer #3:

The manuscript "A homozygous loss-of-function CaAMK2A mutation causes loss of growth, frequent seizures, and severe intellectual disability" uses sequencing of patient DNA, biochemistry, and C. elegans phenotyping to characterize a novel coding mutation preventing holoenzyme formation in CaMKIIalpha protein in humans. The authors demonstrate that an autosomal recessive mutation in a histidine residue critical for association domain interactions is associated with disease state in a human family, then go on to use traditional biochemistry to show that this mutant kinase forms interactions with WT but not with itself, a finding beautifully consistent with the recessive nature of the disease state. Further, they use a rescue strategy in a C. elegans model lacking expression of the CaMKII homolog to show that neither the human nor the worm kinase with this mutation can rescue worm phenotype, while either WT kinase does so. Because CaMKII has long been associated with cognition through mostly mouse studies but has never before been directly and causally tied to a human cognitive disorder, this is a very exciting finding that will help to validate and reinvigorate study of this essential molecule. The paper is clear and well-written, the experiments directly address the hypotheses and are appropriately interpreted (for the most part – see below), and the findings are certain to strongly impact the field. I have some minor concerns below about interpretation and mechanism, and one somewhat larger concern:

The C. elegans experiments are very convincing. However, I wonder whether the mutant and WT CaMKII proteins used in the rescue experiments have the same localization. This ought to be very easy to determine by immunofluorescence, even if the constructs aren't tagged. Does the mutant accumulate in the nucleus of the C. elegans neurons as it does in HEK cells? Does the WT adopt a postsynaptic localization? Data such as these would greatly strengthen the manuscript.

Overall, I am highly enthusiastic about this manuscript.

eLife. 2018 May 22;7:e32451. doi: 10.7554/eLife.32451.018

Author response


Reviewer #1:

This manuscript is of fundamental importance for the CaMKII field, as for the first time it makes a convincing case that CaMKII dysfunction is relevant for brain diseases. The strength of the manuscript is that a family is described where two children are homozygous for a missense mutation in CaMKIIalpha. Biochemical characerisation of the missense mutation strongly suggests that this mutation causes loss-of function, by not only preventing oligomerisation of CaMKIIalpha subunits, but also mislocalising CaMKIIalpha to the nucleus and enhancing the proteasomal degradation of the kinase subunits. I think that this work is important that it deserves to be published in eLife. I have some suggestions that can further strengthen the manuscript:

1) I could not find any data regarding impaired intellectual disability. If possible, could such data be included?

The clinicians cannot obtain a definitive IQ test since both affected siblings are non-verbal and do not respond to verbal cues. We believe that the supplementary videos do convey the extent and severity of the ID in both affected siblings.

2) Regarding the table in Figure 1—figure supplement 1, it would be amazing if data for heterozygous and wild-type children could be included. This would provide very strong evidence that specifically the missense mutation causes the observed phenotypes. Would you have patient consent to include such information?

We have confirmed that the healthy siblings (who are either heterozygous or non-carrier for the CAMK2A H477Y allele) do not display any signs of neuro-developmental delay. We have updated the clinical table in Figure 1—figure supplement 1 to include all five siblings.

3) The authors found that the identified missense mutation mislocalizes CaMKIIalpha to nucleus in a non-neuronal cell line. If possible, it would be good to show that this also happens in primary neurons. This would suggest that CaMKIIalpha with the missense mutation is not delivered to synapses, substantially blocking synaptic plasticity.

We have significantly revised our initial biochemical analyses of overexpressed CAMK2A mutant. In the initial submission, the nuclear localization was shown using GFP-tagged to the CAMK2A association domain, but not with the full length CAMK2A protein. We did not mean to claim that full length CAMK2A would mislocalize in vivo. Instead, we simply used nuclear exclusion as an in vitro assay to test the oligomerization of CAMK2A association domain.

We have removed these data to avoid any confusion and replaced them with a more rigorous functional experiment using neurons derived from the proband’s iPS cells. These new results demonstrate a profound impairment in neuronal activity in patient’s neurons that are cultured in vitro (Figure 2) suggesting that endogenous CAMK2AH477Y is most likely dysfunctional.

We have attempted to decipher the localization of endogenous CAMK2A by immunofluorescence in iPSC-derived neurons. However, all five commercial CAMK2A antibodies tested failed to give a single band by Western blot using lysates from wild-type neurons (Author response image 1). Likewise, these antibodies could not reflect the synaptic localization of wild-type CAMK2A in iPSC-derived neurons using IF. We therefore could not carry out a rigorous evaluation of the localization of the CAMK2AH477Y in iPSCs-derived neurons.

Author response image 1.

Author response image 1.

4) Unfortunately, the presented in vivo studies with C. elegans focus on the wrong neuronal cell type. In mammals CaMKIIalpha is expressed exclusively in glutamatergic neurons (not cholinergic motoneurons). Therefore, I think that Figure 2 must be removed from the manuscript, as the findings are misleading. -- In my opinion, for this manuscript it is not necessary to include in vivo data. However, if authors wish to include in vivo data, then they should focus on the correct neuronal cell type in any in vivo system.

We understand your concern that in mammals, CAMK2A is mostly found in glutamatergic neurons. In vertebrates, CAMKII isoforms are encoded by at least four genes (⍺, β, γ, δ). In the worm, the unc-43 gene encodes only one CaMKII orthologue which is found in all neurons. Mutations in unc-43 cause multiple behavioral defects in locomotory activity, in the clock control of defecation, in the regulation of body-wall muscle excitation and spontaneous activity (David et al., 1999). Thus in C. elegans, unc-43 can perform all these functions regardless of the neuronal cell type in which it is expressed.

CAMK2 is highly conserved from humans to worm. We show in Figure 4C and 4F that the human CAMK2A orthologue is able to fully rescue synaptic defects due to the loss of unc-43 in the DA9 neuron. This indicates that the human CAMK2A functions similarly in cholinergic neurons of C. elegans. More importantly, the identified patient mutation p.H477Y when introduced in either UNC-43 or CAMK2A, is unable to rescue the unc-43 synaptic defects.

To further strengthen this data, we have performed behavioural rescue experiments by expressing either wildtype or H466Y mutated UNC-43 protein in worms defective for unc-43. We have used a pan-neuronal promoter to express UNC-43 in all neurons and scored the phenotype in a double-blind experimental setup. Consistently, we observe that the wildtype UNC-43, but not UNC-43H466Y, is able to fully rescue all behavioral defects of unc-43 worms. This is providing further evidence that the patient identified mutation renders CAMK2A non-functional in multiple in vivo assays.

We believe the C. elegans data are key to prove the pathogenicity of this human allele. They are now complemented by functional assays using patient IPSCs-derived neurons (Figure 2).

Reviewer #2:

Chia and colleagues have authored a potentially important manuscript identifying an association between a novel homozygous missense mutation in CAMK2A and global neurodevelopmental delay with severe intellectual disability, seizures, and delayed growth. Although interesting, a number of major issues need to be addressed:

1) Substantially more details are required regarding the genetic analysis, in order to better establish the likely causality of the candidate CAMK2A mutation. In particular, the workflow by which the proposed causative variant has been identified needs to be much better clarified.

We have included in this revised manuscript, a more detailed description of the pipeline, including IBD mapping, whole-exome sequencing and data filtering. We are adhering to our standard operating procedures which have allowed us to genetically diagnose numerous Mendelian disorders over the years (Reversade et al., 2009; Bonnard et al., 2012; Hu and Pomp, 2014; Cetinkaya and Xiong, 2016; Zhong et al., 2016; Gordon and Xue, 2017).

a) Can the authors provide additional pedigree data regarding the parental consanguineous relationship? If not, then on what basis are the parents reported as consanguineous?

We could not obtain additional medical record from members of the extended family. We confirm that parents are first cousins as stated by them during several clinical visits. This is independently verified from the SNP genotyping analysis of their 5 children. On average, 10% of the children’s genomes are homozygous- proving that their parents are at least first cousins.

% of homozygosity in all children from family
Child Mb % homozygous
II-1 309.4 10.3
II-2 319.2 10.6
II-3 378.2 12.6
II-4 310.2 10.3
II-5 183.1 6.1

b) The authors should provide the genome-wide results of the homozygosity mapping prior to filtering out homozygous segments found in the unaffected family members, and prior to filtering for regions of homozygosity >5cM.

These data are now provided in Supplemental file 1 and Figure 1—figure supplement 1D.

c) On what basis have the authors established the "confidence criteria to identify IBD blocks were a minimum of 5 cM"?

IBD regions <5 cM are likely to be false positives. According to Duran et al., (2014), "most 2–3 cM segments are erroneous and only segments longer than 5 cM have a negligible number of false positives".

d) Regarding the variants identified by exome sequencing, the authors should minimally provide a list of all 72 homozygous protein-coding variants with MAF<1%, and sufficient information to determine their localization within the regions of homozygosity in all of the genotyped family members.

These data are now provided in Figure 1—figure supplement 1E, with a thorough description in the text. Briefly, four homozygous variants from the proband’s exome were identified within the chromosome 5 IBD candidate block. Notably, homozygotes for these variants, except the CAMK2AH477Y allele, have been identified in public sequencing databases, such as ExAC and GnomAD, and therefore can be ruled out.

2) Functional experiments: a) The authors convincingly establish that the H477Y mutation blocks oligomerization of the CAMK2A holoenzyme. However, they subsequently attempt to evaluate protein stability using MG132. I have some difficulties with this experiment.

Specifically, how can it be that in the DMSO treated lysates (Figure S2C), such big differences are found between the different CAMK2A construct expression levels, whereas in Figure 1H the expression levels are similar?

Was each experiment done at different time points after transfection?

How do the authors control for transfection efficiency? Based on the results shown here, in the absence of a demonstration that the transfection efficiency was equal across the various constructs, it is difficult to reach a firm conclusion regarding the stability or expression levels of CAMK2A [H477Y].

Thank you for encouraging us to improve these results. These experiments have been significantly revised with improved constructs consisting of a single cistronic T2A-mCherry cassette to control for both transfection and translation efficiency. These results are described in Figure 3E, 3F and Figure 2—figure supplement 2B.

b) Figure 2C and 2E: The images provided are consistent with a rescue of the synaptic phenotype when expressing either Unc-43 or wild-type human CAMK2, but not with the H477Y mutant. However, the experimental design is unclear.

The legend reports n>80 (Figure 2C) and n=100 (Figure 2E). But what does 'n' represent (e.g., is this the number of puncta, images, or worms measured)? For Figure 2C, why is it not possible to provide an exact value?

We have made changes in the legend text to clarify the exact parameter of measurement for each experiment. For instance, “error bars represent SEM with number of synaptic puncta quantified n> 80” and “Graph shows the percentage of animals with the WT and unc-43 mutant phenotypes with n=100 animals scored for each line”.

c) Figure 2C: Why do the authors use a Student's t-test for these data? If they want to compare the different conditions, a one-way ANOVA with post-hoc correction should be applied.

The statistics for experiments comparing multiple conditions has been revised according to your suggestions. We have implemented a one-way ANOVA test with either Bonferroni post-hoc test or two-way ANOVA with Tukey post-hoc test.

d) Figure 2D: By what criteria have the authors defined the asynaptic region?

The asynaptic region is the defined as the part of the axon extending out from the DA9 cell body to the first en passant synapse located on the dorsal part of the axon. It has been shown that the positional information required to define this asynaptic region is controlled by lin-44/Wnt secreted by four hypodermal cells in the tail of the worm (Klassen and Shen, (2007). This asynaptic region of the axon is also defined by different synaptic vesicle transport dynamics as compared to the dendrite and distal axon of DA9 (Maeder et al., (2014).

e) The Unc-43 worm has clear phenotypes, as the authors themselves describe in the Results section: "Null mutants for unc-43 are flaccid in posture and move with a flattened uncoordinated waveform." These phenotypes are very clear. Why didn't they try rescuing these phenotypes? This would have provided a much stronger opportunity to assess the functional relevance of the rescue experiments.

We have carried out a behavioral rescue as shown Figure 3G: in contrast to UNC-43wild-type, UNC-43H466Y which is homologous to CAMK2AH477Y, completely failed to rescue the uncoordinated and convulsive phenotype of the mutant unc-43 worms. Thank you for suggesting this crucial experiment which provides further support to our initial observation.

f) What is the relevance of examining the localization of the association domain? The authors reason that since the mutation blocks oligomerization, it is more likely to diffuse through the nuclear pore, thereby reducing cytosolic accumulation. But does the association domain itself oligomerize in HEK293T cells?

We have removed these data to avoid any confusion. Our biochemical data using native PAGE and co-immunoprecipitation (Figure 3C,D) support the oligomerization defect when CAMK2A was expressed in 293T cells as well as when translated in vitro.

The authors seem to infer on the basis of these experiments that CAMK2A is likely to be mislocalized in the homozygous H477Y carriers. However, they would need to show the same experiment using full-length reference and mutant CAMK2A in order to establish more definitive evidence.

These experiments are now shown in Figure 3E and Figure 2—figure supplement 2B, with full length CAMK2A. We focused on the most striking difference, which was the reduction in overall level in mutant CAMK2A.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Supplemental file 1. Statistical Data Analysis.
    elife-32451-fig1.xlsx (24.1KB, xlsx)
    DOI: 10.7554/eLife.32451.012
    Source code 1. IBD linkage program.
    elife-32451-code1.nb (4.6MB, nb)
    DOI: 10.7554/eLife.32451.013
    Transparent reporting form
    DOI: 10.7554/eLife.32451.014

    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES