Skip to main content
Bone & Joint Research logoLink to Bone & Joint Research
. 2018 Jun 5;7(5):362–372. doi: 10.1302/2046-3758.75.BJR-2017-0126.R2

The effects of high glucose condition on rat tenocytes in vitro and rat Achilles tendon in vivo

Y Ueda 1, A Inui 1, Y Mifune 1,, R Sakata 1, T Muto 1, Y Harada 1, F Takase 1, T Kataoka 1, T Kokubu 1, R Kuroda 1
PMCID: PMC5987694  PMID: 29922457

Abstract

Objectives

The aim of this study was to investigate the effect of hyperglycaemia on oxidative stress markers and inflammatory and matrix gene expression within tendons of normal and diabetic rats and to give insights into the processes involved in tendinopathy.

Methods

Using tenocytes from normal Sprague-Dawley rats, cultured both in control and high glucose conditions, reactive oxygen species (ROS) production, cell proliferation, messenger RNA (mRNA) expression of NADPH oxidase (NOX) 1 and 4, interleukin-6 (IL-6), matrix metalloproteinase (MMP)-2, tissue inhibitors of matrix metalloproteinase (TIMP)-1 and -2 and type I and III collagens were determined after 48 and 72 hours in vitro. In an in vivo study, using diabetic rats and controls, NOX1 and 4 expressions in Achilles tendon were also determined.

Results

In tenocyte cultures grown under high glucose conditions, gene expressions of NOX1, MMP-2, TIMP-1 and -2 after 48 and 72 hours, NOX4 after 48 hours and IL-6, type III collagen and TIMP-2 after 72 hours were significantly higher than those in control cultures grown under control glucose conditions. Type I collagen expression was significantly lower after 72 hours. ROS accumulation was significantly higher after 48 hours, and cell proliferation after 48 and 72 hours was significantly lower in high glucose than in control glucose conditions. In the diabetic rat model, NOX1 expression within the Achilles tendon was also significantly increased.

Conclusion

This study suggests that high glucose conditions upregulate the expression of mRNA for NOX1 and IL-6 and the production of ROS. Moreover, high glucose conditions induce an abnormal tendon matrix expression pattern of type I collagen and a decrease in the proliferation of rat tenocytes.

Cite this article: Y. Ueda, A. Inui, Y. Mifune, R. Sakata, T. Muto, Y. Harada, F. Takase, T. Kataoka, T. Kokubu, R. Kuroda. The effects of high glucose condition on rat tenocytes in vitro and rat Achilles tendon in vivo. Bone Joint Res 2018;7:362–372. DOI: 10.1302/2046-3758.75.BJR-2017-0126.R2

Keywords: High glucose, Oxidative stress, Tendinitis

Article focus

  • This study focused on the effect on rat tenocytes under high glucose conditions in vitro and in vivo.

  • How does high glucose affect oxidative stress in tenocytes?

  • How does high glucose affect tendon matrix and inflammatory gene expression?

Key messages

  • High glucose conditions induce oxidative stress, in the form of reactive oxygen species production through NADPH oxidase (NOX) upregulation in tenocytes.

  • Oxidative stress induced by high glucose conditions may be one of the causes of tendon degeneration and inflammation.

  • Inhibiting oxidative stress could be a target of the treatment for diabetes mellitus-related tendinitis or tendinopathy.

Strengths and limitations

  • The in vitro glucose concentrations used in this study did not reflect the in vivo environment.

  • The potential effects of NOX inhibitors on tenocytes were not examined.

  • The mechanical properties of the diabetic rat Achilles tendon were not investigated.

  • Hyperglycaemia did not appear to affect Achilles tendon structure until at least four weeks.

Introduction

Musculoskeletal disorders such as tendonitis,1 Dupuytren’s disease,2 carpal tunnel syndrome,3 adhesive capsulitis,4 calcific tendinopathy,5 stiffness6 and frozen shoulder7,8 can be observed in patients with diabetes mellitus (DM). In vivo studies, investigating the effects of hyperglycaemia, and using histological and biomechanical parameters, have shown impaired tendon-bone healing in a rat model of rotator cuff tears.9

Oxidative stress induced by hyperglycaemia has been reported to cause tissue damage and organ dysfunction.10 Chronic inflammation, caused by oxidative stress, may also contribute to the development of other diabetic complications such as atherosclerosis and cardiovascular disease, as well as in other disease states such as malnutrition, anaemia and hyperparathyroidism.10 In hyperglycaemic states, oxidative stress is triggered by reactive oxygen species (ROS) and controlled by antioxidant enzymes such as superoxide dismutase and catalase.11 Some pathways that produce ROS have relevance to the hypermetabolism of polyol,12 the accumulation of advanced glycation end-products (AGEs)13 and the overexpression of a receptor for AGEs,14 the increase in superoxide production by the mitochondrial electron transfer system15 and the activation of NADPH oxidase (NOX).16 High glucose levels have been shown to stimulate ROS production through protein kinase C-dependent activation of NOX in cultured aortic smooth muscle cells and endothelial cells.16

Few studies have examined the molecular mechanisms underlying tendon disorders in the musculoskeletal conditions associated with DM. We hypothesize that hyperglycaemic conditions induce oxidative stress and subsequent inflammation and degeneration within tendons. This study investigates the effect of hyperglycaemia on oxidative stress markers and inflammatory and matrix gene expression within tendons.

Materials and Methods

All animal procedures were performed with the approval and guidance of the Animal Care and Use Committee of our institution.

In vitro experiments: cell preparation

Achilles tendons were excised from 15 healthy male Sprague-Dawley rats of seven to eight weeks age.17 Tendons were washed twice with phosphate-buffered saline and cut into small pieces measuring approximately 1.0 mm3. Several pieces were placed on a culture plate. After five minutes of air drying for enhanced adherence, using Dulbecco’s modified Eagle’s medium (DMEM) (Sigma-Aldrich, St. Louis, Missouri) supplemented with 10% foetal bovine serum, 100 μg/mL streptomycin and 100 U/mL penicillin was added. For all experiments, cells were incubated in DMEM with two different glucose concentrations according to a previous report:17 12 Mm (mmol/l) (control glucose group) and 33 Mm (high glucose group). The culture medium was exchanged every 24 hours to maintain the glucose concentration (n =15 per group).

In vitro experiments: detection of ROS accumulation

In total, 1 × 105 cells were seeded in 2 ml of DMEM in each well of 12-well plates and incubated with control or high glucose conditions at 5% CO2 and 37°C until detection of ROS. The accumulation of ROS in cells was detected by using the Total ROS/Superoxide Detection Kit (Enzo Life Sciences, Farmingdale, New York) after 48 hours and 72 hours, according to the manufacturer’s directions, and the nuclei were visualized with 4’,6-diamidino-2-phenylindole (DAPI) (which stains nuclei specifically by binding to AT-rich regions in DNA). ROS accumulation was analyzed under a BZ-8000 confocal laser microscope (Keyence, Osaka, Japan) using a fluorescein isothiocyanate barrier filter. For quantitative analysis of ROS accumulation, fluorescence intensity was calculated by ImageJ (US National Institutes of Health, Bethesda, Maryland) and normalized to cell number as determined by 4’,6-diamidino-2-phenylindole (DAPI) in five randomly selected fields (n = 15 per group).

In vitro experiments: quantitative real-time polymerase chain reaction (PCR)

Total RNA was extracted from the cell cultures, and incubated both in control or high glucose conditions for 48 hours and 72 hours using an RNeasy Mini Kit (Qiagen, Valencia, California). Total RNA was then reverse transcribed into single-stranded complementary (c)DNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, California). Real-time PCR was performed on the cDNA samples, in duplicate, on an Applied Biosystems 7900HT fast real-time PCR system and using SYBR Green reagents (Applied Biosystems) to analyze the messenger RNA (mRNA) levels of NOX1, NOX4, interleukin (IL)-6, type I and type III collagens, matrix metalloproteinase-2 (MMP-2) and tissue inhibitors of matrix metalloproteinase (TIMP)-1 and -2.(Table I) Results were normalized to the mRNA levels of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase and were expressed relative to their levels in control culture using the 2(−∆∆ CT) method (n = 15 per group).18

Table I.

Primer sequences used for polymerase chain reaction

Gene Oligonucleotide sequence
NOX1 Forward 5′ GTGGCTTTGGTTCTCATGGT 3′ Reverse 5′ TGAGGACTCCTGCAACTCCT 3′
NOX4 Forward 5′ GGGCCTAGGATTGTGTTTGA 3′ Reverse 5′ CTGAGAAGTTCAGGGCGTTC 3′
Type I collagen Forward 5′ TGGAGACAGGTCAGACCTG 3′ Reverse 5′ TATTCGATGACTGTCTTGCC 3′
Type III collagen Forward 5′ TAAAGGGTGAACGGGGCAGT 3′ Reverse 5′ ACGTTCCCCATTATGGCCAC 3′
MMP-2 Forward 5′ GGAAGCATCAAATCGGACTG 3′ Reverse 5′ GGGCGGGAGAAAGTAGCA 3′
TIMP-1 Forward 5′ ATAGTGCTGGCTGTGGGGTGTG 3′ Reverse 5′ TGATCGCTCTGGTAGCCCTTCTC 3′
TIMP-2 Forward 5′ GGACACGCTTAGCATCACCCAGA 3′ Reverse 5′ GTCCATCCAGAGGCACTCATCC 3′
IL-6 Forward 5′ GGTCTTCTGGAGTTCCGTTTC 3′ Reverse 5′ GGTCTTGGTCCTTAGCCACTC 3′
GAPDH Forward 5′ GGTGGTCTCCTCTGACTTCAACA 3′ Reverse 5′ GTTGCTGTAGCCAAATTCGTTGT 3′

In vitro experiments: cell proliferation assays

A total of 5000 cells were seeded in 100 μl of DMEM in each well of two 96-well plates and were incubated in control or high glucose conditions at 5% CO2 and 37°C. At 48 hours and 72 hours, cell proliferation was measured by a water-soluble tetrazolium salt (WST) assay using Cell Counting Kit-8 (Dojindo, Kumamoto, Japan).19 Then, 10 µl of WST was added to each well and cultures were incubated for an additional three hours at 5% CO2 and 37°C prior to spectrophotometric evaluation. The conversion of WST to formazan was spectrophotometrically measured at 450 nm. Total cell proliferation for each treatment condition was expressed as an n-fold difference from the control glucose group at each corresponding timepoint, and the optical density of cells in the control glucose group was set to one, as a reference point. To account for the potential impact of hyperosmolarity on tendon cell proliferation, parallel cultures were incubated in DMEM supplemented with mannitol at 12 mM or 33 mM (n = 15 per group).

In vivo animal experiment: type I diabetic rat model

To induce DM, seven eight-week-old healthy male Sprague-Dawley rats, with a mean weight of 296 g sd 3.66, were injected with a single intravenous dose of streptozotocin (STZ; 65 mg/kg body weight; Sigma-Aldrich) dissolved in sodium citrate buffer (pH 4.5). The ten control rats received citrate buffer by an intravenous injection.9,20 Following the injections, all animals were housed in standard cages with unrestricted food, water and activity. The animals were monitored according to a standardized protocol.21 All STZ-injected rats became diabetic. Their mean blood glucose sugar level was 413 mg/ml sd 7.78 (23 mM) in DM rats and 116 mg/ml sd 5.57 (6.4 mM) in control rats. The animals were sacrificed at six weeks after the STZ injection according to Nouruzian et al’s method.22 Achilles tendons were harvested and stored at -80°C for further analysis. The right Achilles tendon was used for immunohistological evaluation and the left was used for quantitative real-time PCR.

In vivo animal experiment: quantitative real-time PCR

The Achilles tendons were cut into small pieces, carefully isolated from connective tissue contaminants and minced. Isolated Achilles tendons were enzymatically dissociated with type II collagenase (Worthington Biochemical Corporation, Lakewood, New Jersey) and prepared for RNA isolation.23 Total RNA was extracted using a RNeasy Mini Kit. Reverse transcription into single-stranded cDNA and real-time PCR was performed as previously described. We evaluated NOX1 and 4 expression in the Achilles tendons of both control and diabetic rats. The seven left tendons of diabetic rats and ten from the control rats were used for quantitative real-time PCR.

In vivo animal experiment: Achilles tendon histology and immunohistochemistry for NOX analysis

Frozen, long-axis sections of Achilles tendons embedded in Optimal Cutting Temperature compound (Sakura Finetek USA Inc., Torrance, California) were sequentially sectioned into 7 μm thick specimens and fixed using 10% phosphate-buffered paraformaldehyde at room temperature for 15 minutes. Histological evaluation of fibre structure, fibre arrangement, nuclear morphology and zonal variations in tendon cellularity was performed using haematoxylin and eosin (H&E) staining.24 Each variable was scored between 0 and 3, with 0 being normal, 1 slightly abnormal, 2 abnormal and 3 markedly abnormal. The grading of H&E-stained sections from Achilles tendon samples was performed in five randomly selected optical fields in each histological section. Each field was evaluated by two blinded investigators (FT and TK). For the immunohistochemical evaluation of NOX expression, anti-NOX1 and anti-NOX4 antibodies (Abcam, Cambridge, UK) were used. Sections were incubated with proteinase for ten minutes, treated with 3% hydrogen peroxide (Wako Pure Chemical Industries, Osaka, Japan) to block endogenous peroxidase activity and incubated with anti-NOX1 or anti-NOX4 antibodies (1:100 for both) at 4°C overnight. Sections were then incubated with a peroxidase-labelled immunoglobulin antibody (Nichirei Bioscience, Tokyo, Japan) at room temperature for 30 minutes. The signal (NOX1 and NOX4) was detected by the formation of a brown colour following incubation with the peroxidase substrate 3,3’-diaminobenzidine (Nichirei Bioscience). Sections were then counterstained with haematoxylin and microscopically examined. For semi-quantitative analysis, the ratio of NOX-positive tendon cells per field was determined in five randomly selected fields for each tissue section. For each immunohistological analysis with H&E staining, NOX1 staining and NOX4 staining, the seven right tendons of diabetic rats and ten from control rats were used.

Statistical analysis

All data are expressed as means and sd. All statistical analyses of recorded data were performed using the Excel statistical software package (Ekuseru-Toukei 2015; Social Survey Research Information Co., Ltd., Tokyo, Japan). Comparisons between the control and high glucose conditions were made by analysis of variance, and the Mann-Whitney U test was used. Tendon pathological scores were analyzed using a Kruskal-Wallis test. A p-value < 0.05 was considered statistically significant.

Results

In vitro experiments: detection of ROS accumulation

Increased ROS accumulation was observed in cultures incubated in high glucose conditions compared with those incubated in control glucose conditions (Fig. 1). At 48 hours after treatment, the intensity of fluoresence of ROS per cell incubated in control glucose and high glucose conditions were 44.2 sd 5.3 and 71.3 sd 13.6, respectively (Fig. 2). At 72 hours after treatment, the ROS levels were 39.7 sd 6.9 and 42.4 sd 9.2 in control glucose and high glucose conditions, respectively (Fig. 2).

Fig. 1.

Fig. 1

Fluorescence staining showing reactive oxygen species (ROS) accumulation (green) in tenocytes and nuclei (4’,6-diamidino-2-phenylindole) (blue). Increased ROS accumulation was observed in high glucose conditions compared with those in the control glucose conditions.

Fig. 2.

Fig. 2

Quantification of the accumulated of reactive oxygen species (ROS). The ROS accumulation was analyzed by fluorescence intensity normalized to cell number. The intensity was higher in the high glucose than in the control glucose conditions and significant difference was seen at 48 hours (*p < 0.05).

In vitro experiments: quantitative real-time PCR

The mRNA expression of NOX1 was significantly higher in tenocyte cultures incubated in high glucose conditions than in those incubated in the control glucose conditions both after 48 hours and after 72 hours (control 1.0 sd 0.46, high 1.80 sd 0.64, p = 0.04 at 48 hours; control 1.0 sd 0.23, high 4.08 sd 0.84, p = 0.00039 at 72 hours). Similarly, the mRNA expression of NOX4 was increased in cultures incubated in the high glucose conditions, with a significant difference observed after 48 hours, while there was no difference at 72 hours (control 1.0 sd 0.08, high 1.27 sd 0.14, p = 0.01 at 48 hours; control 1.0 sd 0.12, high 1.58 sd 0.52, p = 0.27 at 72 hours) (Fig. 3a). The mRNA levels of type I collagen and type III collagen did not show a significant difference between the groups after 48 hours (collagen I: control 1.0 sd 0.16, high 1.14 sd 0.52, p = 0.48; collagen III: control 1.0 sd 0.08, high 1.0 sd 0.11, p = 0.95). However, after 72 hours, the mRNA expression of type I collagen in cultures incubated in high glucose conditions was significantly lower and that of type III collagen was significantly higher in cultures incubated in high glucose conditions (collagen I: control 1.0 sd 0.12, high 0.32 sd 0.27, p = 0.00094; collagen III: control 1.0 sd 0.13, high 3.27 sd 1.68, p = 0.002) (Fig. 3a). Furthermore, MMP-2 and TIMP-1 mRNA levels were significantly higher in the high glucose group after 48 hours and 72 hours (MMP-2: control 1.0 sd 0.03, high 1.31 sd 0.06, p = 7.42 E-95 at 48 hours; control 1.0 sd 0.15, high 2.06 sd 0.57, p = 0.01 at 72 hours; TIMP-1: control 1.0 sd 0.02, high 1.75 sd 0.22, p = 4.38 E-95 at 48 hours; control 1.0 sd 0.28, high 11.6 sd 0.70, p = 1.33 E-075 at 72 hours) (Fig. 3b). There was a significant increase in TIMP-2 and IL-6 expression in high glucose conditions after 72 hours compared with that in the control glucose conditions (TIMP-2: control 1.0 sd 0.02, high 1.05 sd 0.05, p = 0.16 at 48 hours; control 1.0 sd 0.10, high 1.77 sd 0.16, p = 7.32 E-055 at 72 hours; IL-6: control 1.0 sd 0.80, high 1.70 sd 0.22, p = 0.22 at 48 hours; control 1.0 sd 0.11, high 2.01 sd 0.51, p = 0.023 at 72 hours) (Fig. 3b).

Fig. 3.

Fig. 3

The messenger RNA (mRNA) expressions of NOX1 and NOX4 in the high glucose conditions were significantly higher than those in control glucose conditions at 48 hours. At 72 hours, the expression of NOX1 was significantly higher in the glucose conditions, while there was no significant difference in the expression of NOX4 between the groups. (*p < 0.05). There was no significant difference in the mRNA expression of type I and type III collagen between the two conditions at 48 hours. At 72 hours, in high glucose conditions, the expression of type I collagen was lower while the expression of type III collagen was higher than that in control glucose conditions (*p < 0.05); b) mRNA expressions of MMP-2 and TIMP-1 were significantly higher in high glucose conditions than those in control glucose conditions at 48 hours and 72 hours. There was a significant increase in TIMP-2 expression in high glucose conditions at 72 hours compared with that in the control glucose conditions (*p < 0.05). The mRNA expression of IL-6 was higher in high glucose than that in control glucose conditions at 48 hours and 72 hours, and the significant difference was observed at 72 hours (*p < 0.05).

In vitro experiments: cell proliferation assays

The WST assay of tendon cell proliferation showed that the proliferation of cells cultured in high glucose conditions was significantly lower than that of cultures in the control glucose conditions after both 48 hours and 72 hours (control 1.0 sd 0.10, high 0.69 sd 0.02, p = 0.005 at 48 hours; control 1.0 sd 0.03, high 0.54 sd 0.06, p = 0.005 at 72 hours). Relative fold changes in proliferation are shown in Figure 4. In contrast, there were no significant differences in proliferation between cultures incubated in control (12 mM) and high (33 mM) mannitol concentration after 48 hours and 72 hours (control 1.0 sd 0.02, high 0.99 sd 0.08, p = 0.84 at 48 hours; control 1.0 sd 0.04, high 0.97 sd 0.03, p = 0.22 at 72 hours).

Fig. 4.

Fig. 4

Graphs showing relative fold changes in the proliferation of tenocytes in control and high glucose concentrations at 48 and 72 hours, along with similar concentrations of mannitol (*p < 0.05) (N.S., not significant).

In vivo animal experiments: Achilles tendon histology and immunohistochemistry for NOX analysis

Histological evaluation showed no significant difference was observed in fibre structure, fibre arrangement, rounding of the nuclei and regional variations in cellularity between control and diabetic Achilles tendons (Table II). In both the fibre structure and fibre arrangement, control and diabetic tendons showed similar near parallel collagen fibres orientation to each other (Fig. 5). Tenocytes within the control and diabetic tendons showed flattened or spindle shaped nuclei, arranged in rows between the collagen fibres, and few rounded nuclei were observed (Fig. 5). There were no regional variations in cellularity, either in control or diabetic tendons (Fig. 5). Immunohistochemical staining of the Achilles tendon at six weeks followed the STZ injection and NOX1 expression markedly increased within the tenocytes of the diabetic rats compared with the controls (Figs 6a and 6b). However, NOX4 was weakly expressed in both groups and showed no difference between the groups (Figs 6c and 6d). Using semi-quantitative analysis, the percentage of NOX1-positive cells was significantly higher in the Achilles tendon of diabetic rats compared with the non-diabetic rats (control 12.3 sd 4.64, diabetic 30.7 sd 5.30, p = 0.001) (Fig. 7). There was no significant difference in the percentage of NOX4-positive cells between the groups (control 12.3 sd 3.29, diabetic 13.3 sd 4.23, p = 0.71) (Fig. 7).

Table II.

Tendon pathological scores from haematoxylin and eosin staining. No significant difference was observed in fibre structure, fibre arrangement, nuclear morphology or zonal variations in cellularity between control and diabetic Achilles tendons

Mean control (sd) Mean diabetic (sd) p-value*
Fibre structure 0.75 (1.04) 0.83 (0.72) 0.73
Fibre arrangement 0.75 (0.87) 1.00 (0.76) 0.51
Nuclear morphological changes (rounding) 0.50 (0.67) 0.63 (0.74) 0.76
Regional variations in cellularity 0.33 (0.65) 0.38 (0.52) 0.76
*

Kruskal-Wallis test

n = 10 rats in the control group, n = 7 in the diabetic group

Fig 5.

Fig 5

Achilles tendon histology. Haematoxylin and eosin staining of control and diabetic Achilles tendons harvested at six weeks following streptozotocin treatment. No obvious pathological difference between control and diabetic tendons was observed.

Fig. 6.

Fig. 6

Immunohistochemical staining for NADPH oxidase (NOX)1 and NOX4 expression in the Achilles tendon. The brown-stained cells were NOX-positive. Increased expression of NOX1 in Achilles tendon was observed in diabetic rats compared with control rats. There was no difference in the expression of NOX4 between diabetic and control rats.

Fig. 7.

Fig. 7

Graphs showing the semiquantitative analysis of cells positive for NADPH oxidase (NOX)1 (left) and NOX4 (right). The ratio of NOX1-positive cells in Achilles tendon was significantly higher in the diabetic rat than in the control rat. No significant difference was observed between control and diabetic rats in the ratio of NOX4-positive cells (*p < 0.05).

In vivo animal experiments: quantitative real-time PCR

The mRNA expression of NOX, collagens, MMP-2, TIMP-2 and IL-6 in rat Achilles tendon was analyzed as an in vivo experiment. The expression of NOX1 in Achilles tendons was significantly higher in diabetic rats than in control rats (control 1.0 sd 0.22, diabetic 1.59 sd 0.34, p = 0.028). There was no significant difference in the NOX4 expression between control rats and diabetic rats (control 1.0 sd 0.35, diabetic 1.29 sd 0.66, p = 0.47) (Fig. 8a). The expressions of type I collagen (control 1.0 sd 0.01, diabetic 1.24 sd 0.02, p = 0.01), MMP-2 (control 1.0 sd 0.47, diabetic 3.08 sd 0.40, p = 0.0005), TIMP-2 (control 1.0 sd 0.22, diabetic 2.79 sd 0.23, p = 2.90 E-055) and IL-6 (control 1.0 sd 0.47, diabetic 4.09 sd 0.96, p = 0.001) were significantly higher in the diabetic rats than in the controls (Figs 8a and 8b), while expression of type III collagen did not show a significant difference (control 1.0 sd 0.09, diabetic 1.04 sd 0.21, p = 0.81) (Fig. 8a).

Fig. 8.

Fig. 8

Graphs showing relative fold changes in the messenger RNA (mRNA) levels in tendon: a) mRNA expression of NADPH oxidase (NOX)1 in Achilles tendon was significantly higher in diabetic rats than in control rats. No significant difference between control and diabetic rats was seen in the expression of NOX4 (*p < 0.05). The expression of type I collagen was significantly higher in diabetic rats than in control rats. No significant difference was observed between diabetic and control rats in the expression of type III collagen (*p < 0.05); b) mRNA expression of matrix metalloproteinase (MMP)-2, tissue inhibitors of matrix metalloproteinase (TIMP)-2 and interleukin (IL)-6 in diabetic rat Achilles tendon was significantly higher than in the control.

Discussion

DM has previously been suggested to increase susceptibility to tendinopathy.25,26 However, the molecular mechanisms underlying tendinopathy are unknown. A number of studies have demonstrated that hyperglycaemic conditions induce oxidative stress and cytokine production, leading to inflammation and tissue damage in various organs.27-29 Oxidative stress under experimental high glucose conditions causes an increase in ROS production.15,30 The production of ROS has been shown to lead tissue damage in various cell types.27,31,32 ROS are catalyzed by the multi-subunit enzyme NOX, which is located on the cell membrane.33 NOX-derived ROS are essential modulators of signal transduction pathways that control key physiological activities such as cell growth, proliferation, migration, differentiation, apoptosis, immune responses and biochemical pathways.34 However, under pathological conditions, the upregulation of tissue- and disease-specific NOX subtypes can cause overproduction of ROS.34

To date, there are no reports about the role of NOX as a ROS-producing enzyme in the tenocyte.

A recent study showed that the expression of peroxiredoxin-5, which has antioxidant properties, is increased in tendinopathy, suggesting that oxidative stress is involved in the pathogenesis of tendon degeneration.35 Another study demonstrated that intracellular oxidative stress decreases type I collagen expression in the fibrocartilage layer of rotator cuff enthesis, leading to its degeneration.36 In the present study, ROS production and NOX1 expression were increased in rat tenocytes under high glucose conditions. Moreover, our in vivo study using rat Achilles tendon showed increased NOX1 expression in tenocytes of diabetic rats. According to a study conducted on human aortic endothelial cells under high glucose conditions, NOX1 induced both inflammation and fibrosis.37 The results of our study show that high glucose conditions upregulate the mRNA expression of NOX1 and the production of ROS at 48 hours. At 72 hours, ROS production did not show a significant difference between the groups. A possible explanation is that high glucose concentration decreased cell proliferation and cell number which led to a decrease of ROS production after the longer time period.38 Another possible explanation is that as a consequence of NOX4 up regulation, ROS production only increases during the early phases of high glucose stress. As another possibility, NOX4 upregulation at 48 hours only participated in ROS production in the early phase of high glucose stress.

Previous reports have shown that gene expressions of cytokines (IL-1β, IL-1, IL-6, tumour necrosis factor (TNF)-α) are increased in the subacromial bursa in patients with rotator cuff disease.39 This upregulation of inflammatory mediators is strong evidence that inflammation is a key process in tendinopathy.40 A systematic review on cytokines in tendon disease showed that the expressions of IL-1β, IL-6 and TNF-α in animal tendon injury models tend to increase from the early phase of tendon healing, whereas IL-6 was the only cytokine involved in human tendon disease and found to be elevated in tendon tears.41 Further investigation is needed into the role of these cytokines in the development of tendon disease. In this study, the higher expression of IL-6 in tenocytes in vitro and Achilles tendon from diabetic rats was seen under high glucose conditions. These results indicate that high glucose conditions are associated with and might stimulate inflammatory processes within tendon.

The balance between expression of MMPs and TIMPs regulates normal tendon metabolic activity.42 During inflammation, MMPs cleave damaged interstitial collagen for remodelling, while TIMPs inhibit the overexpression of MMPs.42 High glucose has been reported to increase MMP-2 production in adventitial fibroblasts.43 In the present study, high glucose conditions also increased the expression of MMP-2. TIMP-1 is not present in normal tendon but has been identified in the edges of torn supraspinatus tendon.44 Our expression patterns of these cellular enzymes resembled those observed in acute tendon tears.

Approximately 90% of the collagen in normal tendon is type I, whereas type III collagen is expressed during inflammatory processes.45 High glucose conditions have been found to inhibit type I collagen expression in human periodontal ligament fibroblast cultures.46 Our results show that high glucose conditions lead to the decreased expression of type I collagen and the increased expression of type III collagen and these findings are compatible with previous reports.45,46 In this study, diabetic Achilles tendons harvested at six weeks after induction of DM showed no histological difference compared with control tendons. Previous studies have not shown any significant difference in tendon histology in the diabetic rat model either in the acute onset of diabetes (one week) or in more chronic conditions (ten weeks) compared with controls.47 The results from our study of acute phase reactions were similar. We observed that the expression of type I collagen, MMP-2 and TIMP-2 in the Achilles tendon of diabetic rats was higher than that of control rats. These results indicated that high glucose conditions might affect tendon matrix synthesis and turnover.

The effects of hyperglycaemia on cell proliferation in in vitro studies have been shown to be varied.48,49 Initially, glucose stimulates cell proliferation and thereafter inhibits the proliferation of rat peritoneal fibroblasts.49 In other cell lines, such as human osteoblast-like cells MG63, high glucose conditions inhibit cell proliferation.48 In the present study using control rat tenocytes, it was found that high glucose conditions decreased cell proliferation. A high concentration of mannitol had no effect on the proliferation of tenocytes. This shows that reduction of tenocyte proliferation was not influenced hyperosmolarity. Moreover, in human tenocytes, oxidative stress by hydrogen peroxide has been demonstrated to induce apoptosis in high glucose conditions via bim-mediated apoptosis through miR-28-5p and p53 upregulation.50 Therefore, hyperglycaemia might inhibit the ability to repair the damaged or degenerated tendon.

This study has several limitations. First, the in vitro glucose concentrations used in this study do not reflect the in vivo environment. The glucose concentrations in our experiments were considerably higher than the normal human plasma glucose level of 6 mM. The concentrations we chose were based on previous reports evaluating the effects of high glucose conditions on human and mouse endothelial and cardiac muscle cells.30,42,51 Secondly, the monolayer culture of tenocytes in vitro never reproduces true physiological conditions. However, previous studies have demonstrated that primary tenocytes maintained phenotypical stability until passage 5 when passaged in subconfluence.52,53 In the present experiments, cells were passaged at about 70% confluence and used by passage 3.19,53 Isolation of cells from the native tendon was performed according to previously reported and accepted methods.17 Thirdly, we did not investigate the biomechanical properties of the Achilles tendon of the diabetic rat due to low experimental numbers. It has been reported that the maximum tensile strength of the Achilles tendon in the STZ-treated animals is significantly decreased.54 Further investigations are needed to explore the relevance of high glucose conditions on tendon biomechanical properties. Fourthly, the potential effects of NOX inhibitors on tenocytes were not examined. It has been previously reported that in DM, NOX1 mediates oxidative stress, inflammation and fibrosis and determines plaque size in atherosclerosis. NOX1 inhibition (by siRNA or GKT137831) is associated with reduced generation of ROS and attenuates DM-induced adhesion of inflammatory cells to the vascular wall, which is a key initiating step in the development of atherosclerosis.37

In conclusion, high glucose concentrations upregulated the mRNA of NOX1, IL-6 expression and production of ROS in our experimental model. High glucose concentrations also induced abnormal tendon matrix expression of type I collagen and a decrease in proliferation of rat tenocytes under experimental conditions. These findings may be of importance in understanding the processes involved in tendinopathy.

Acknowledgments

The authors would like to give special thanks to T. Ueha, M. Nagata, K. Tanaka and M. Yasuda for their expert technical assistance.

Footnotes

Author Contributions: Y. Ueda: Study design, Data acquisition, Analysis, Interpretation, Drafting and critically revising the paper.

A. Inui: Study design, Data analysis, Interpretation, Critically revising the paper, Editorial contribution.

Y. Mifune: Study design, Data analysis, Interpretation, Critically revising the paper, Editorial contribution.

R. Sakata: Study design, Data analysis, Interpretation, Editorial contribution.

T. Muto: Data acquisition, Analysis, Interpretation.

Y. Harada: Data acquisition, Analysis, Interpretation.

F. Takase: Data acquisition, Analysis, Interpretation.

T. Kataoka: Data acquisition, Analysis, Interpretation.

T. Kokubu: Study design, Data analysis, Interpretation, Critically revising the paper.

R. Kuroda: Study design, Data analysis, Interpretation, Critically revising the paper, Editorial contribution.

Conflict of Interest Statement: None declared

Follow us @BoneJointRes

Funding Statement

Our Institutional Review Board (Institutional Animal Care and Use Committee at Kusunoki and Myodani Campus Kobe University) provided the approval for our study and the approval information is below. Application Number: A120702; Permission Number: P120801.

References

  • 1. Yosipovitch G, Yosipovitch Z, Karp M, Mukamel M. Trigger finger in young patients with insulin dependent diabetes. J Rheumatol 1990;17:951-952. [PubMed] [Google Scholar]
  • 2. Noble J, Heathcote JG, Cohen H. Diabetes mellitus in the aetiology of Dupuytren’s disease. J Bone Joint Surg [Br] 1984;66-B:322-325. [DOI] [PubMed] [Google Scholar]
  • 3. Pourmemari MH, Shiri R. Diabetes as a risk factor for carpal tunnel syndrome: a systematic review and meta-analysis. Diabet Med 2016;33:10-16. [DOI] [PubMed] [Google Scholar]
  • 4. Balci N, Balci MK, Tüzüner S. Shoulder adhesive capsulitis and shoulder range of motion in type II diabetes mellitus: association with diabetic complications. J Diabetes Complications 1999;13:135-140. [DOI] [PubMed] [Google Scholar]
  • 5. Mavrikakis ME, Drimis S, Kontoyannis DA, et al. Calcific shoulder periarthritis (tendinitis) in adult onset diabetes mellitus: a controlled study. Ann Rheum Dis 1989;48:211-214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Rosenbloom AL, Silverstein JH, Lezotte DC, Richardson K, McCallum M. Limited joint mobility in childhood diabetes mellitus indicates increased risk for microvascular disease. N Engl J Med 1981;305:191-194. [DOI] [PubMed] [Google Scholar]
  • 7. Arkkila PE, Kantola IM, Viikari JS, Rönnemaa T. Shoulder capsulitis in type I and II diabetic patients: association with diabetic complications and related diseases. Ann Rheum Dis 1996;55:907-914. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Bridgman JF. Periarthritis of the shoulder and diabetes mellitus. Ann Rheum Dis 1972;31:69-71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Bedi A, Fox AJ, Harris PE, et al. Diabetes mellitus impairs tendon-bone healing after rotator cuff repair. J Shoulder Elbow Surg 2010;19:978-988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Kisic B, Miric D, Dragojevic I, Rasic J, Popovic L. Role of Myeloperoxidase in Patients with Chronic Kidney Disease. Oxid Med Cell Longev 2016;2016:1069743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Liang W, Zhao YJ, Yang H, Shen LH. Effects of antioxidant system on coronary artery lesions in patients with abnormal glucose metabolism. Aging Clin Exp Res 2016;29:141-146. [DOI] [PubMed] [Google Scholar]
  • 12. Luo X, Wu J, Jing S, Yan LJ. Hyperglycemic stress and carbon stress in diabetic glucotoxicity. Aging Dis 2016;7:90-110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Goh SY, Cooper ME. Clinical review: the role of advanced glycation end products in progression and complications of diabetes. J Clin Endocrinol Metab 2008;93:1143-1152. [DOI] [PubMed] [Google Scholar]
  • 14. Coughlan MT, Thorburn DR, Penfold SA, et al. RAGE-induced cytosolic ROS promote mitochondrial superoxide generation in diabetes. J Am Soc Nephrol 2009;20:742-752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Yu T, Jhun BS, Yoon Y. High-glucose stimulation increases reactive oxygen species production through the calcium and mitogen-activated protein kinase-mediated activation of mitochondrial fission. Antioxid Redox Signal 2011;14:425-437. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Inoguchi T, Li P, Umeda F, et al. High glucose level and free fatty acid stimulate reactive oxygen species production through protein kinase C–dependent activation of NAD(P)H oxidase in cultured vascular cells. Diabetes 2000;49:1939-1945. [DOI] [PubMed] [Google Scholar]
  • 17. Tsai WC, Liang FC, Cheng JW, et al. High glucose concentration up-regulates the expression of matrix metalloproteinase-9 and -13 in tendon cells. BMC Musculoskelet Disord 2013;14:255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402-408. [DOI] [PubMed] [Google Scholar]
  • 19. Muto T, Kokubu T, Mifune Y, et al. Platelet-rich plasma protects rotator cuff-derived cells from the deleterious effects of triamcinolone acetonide. J Orthop Res 2013;31:976-982. [DOI] [PubMed] [Google Scholar]
  • 20. Furman BL. Streptozotocin-induced diabetic models in mice and rats. Curr Protoc Pharmacol 2015;70:1-20. [DOI] [PubMed] [Google Scholar]
  • 21. Muto T, Kokubu T, Mifune Y, et al. Can platelet-rich plasma protect rat achilles tendons from the deleterious effects of triamcinolone acetonide? Orthop J Sports Med 2015;3:2325967115590968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Nouruzian M, Alidoust M, Bayat M, Bayat M, Akbari M. Effect of low-level laser therapy on healing of tenotomized Achilles tendon in streptozotocin-induced diabetic rats. Lasers Med Sci 2013;28:399-405. [DOI] [PubMed] [Google Scholar]
  • 23. Lee JTY, Cheung KMC, Leung VYL. Extraction of RNA from tough tissues with high proteoglycan content by cryosection, second phase separation and high salt precipitation. J Biol Methods. 2015;2:e20. [Google Scholar]
  • 24. Maffulli N, Barrass V, Ewen SW. Light microscopic histology of achilles tendon ruptures. A comparison with unruptured tendons. Am J Sports Med 2000;28:857-863. [DOI] [PubMed] [Google Scholar]
  • 25. Batista F, Nery C, Pinzur M, et al. Achilles tendinopathy in diabetes mellitus. Foot Ankle Int 2008;29:498-501. [DOI] [PubMed] [Google Scholar]
  • 26. Ranger TA, Wong AM, Cook JL, Gaida JE. Is there an association between tendinopathy and diabetes mellitus? A systematic review with meta-analysis. Br J Sports Med 2016;50:982-989. [DOI] [PubMed] [Google Scholar]
  • 27. Baynes JW, Thorpe SR. Role of oxidative stress in diabetic complications: a new perspective on an old paradigm. Diabetes 1999;48:1-9. [DOI] [PubMed] [Google Scholar]
  • 28. Kowluru RA, Engerman RL, Kern TS. Diabetes-induced metabolic abnormalities in myocardium: effect of antioxidant therapy. Free Radic Res 2000;32:67-74. [DOI] [PubMed] [Google Scholar]
  • 29. Nishikawa T, Edelstein D, Du XL, et al. Normalizing mitochondrial superoxide production blocks three pathways of hyperglycaemic damage. Nature 2000;404:787-790. [DOI] [PubMed] [Google Scholar]
  • 30. Cai L, Li W, Wang G, et al. Hyperglycemia-induced apoptosis in mouse myocardium: mitochondrial cytochrome C-mediated caspase-3 activation pathway. Diabetes 2002;51:1938-1948. [DOI] [PubMed] [Google Scholar]
  • 31. Forbes JM, Coughlan MT, Cooper ME. Oxidative stress as a major culprit in kidney disease in diabetes. Diabetes 2008;57:1446-1454. [DOI] [PubMed] [Google Scholar]
  • 32. Jansen F, Yang X, Franklin BS, et al. High glucose condition increases NADPH oxidase activity in endothelial microparticles that promote vascular inflammation. Cardiovasc Res 2013;98:94-106. [DOI] [PubMed] [Google Scholar]
  • 33. Leto TL, Morand S, Hurt D, Ueyama T. Targeting and regulation of reactive oxygen species generation by Nox family NADPH oxidases. Antioxid Redox Signal 2009;11:2607-2619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Manea SA, Constantin A, Manda G, Sasson S, Manea A. Regulation of Nox enzymes expression in vascular pathophysiology: focusing on transcription factors and epigenetic mechanisms. Redox Biol 2015;5:358-366. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Wang MX, Wei A, Yuan J, et al. Antioxidant enzyme peroxiredoxin 5 is upregulated in degenerative human tendon. Biochem Biophys Res Commun 2001;284:667-673. [DOI] [PubMed] [Google Scholar]
  • 36. Morikawa D, Itoigawa Y, Nojiri H, et al. Contribution of oxidative stress to the degeneration of rotator cuff entheses. J Shoulder Elbow Surg 2014;23:628-635. [DOI] [PubMed] [Google Scholar]
  • 37. Gray SP, Di Marco E, Okabe J, et al. NADPH oxidase 1 plays a key role in diabetes mellitus-accelerated atherosclerosis. Circulation 2013;127:1888-1902. [DOI] [PubMed] [Google Scholar]
  • 38. Day RM, Suzuki YJ. Cell proliferation, reactive oxygen and cellular glutathione. Dose Response 2006;3:425-442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Blaine TA, Kim YS, Voloshin I, et al. The molecular pathophysiology of subacromial bursitis in rotator cuff disease. J Shoulder Elbow Surg 2005;14(1 Suppl S):84S-89S. [DOI] [PubMed] [Google Scholar]
  • 40. Legerlotz K, Jones ER, Screen HR, Riley GP. Increased expression of IL-6 family members in tendon pathology. Rheumatology (Oxford) 2012;51:1161-1165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Morita W, Dakin SG, Snelling SJB, Carr AJ. Cytokines in tendon disease: A Systematic Review. Bone Joint Res 2017;6:656-664. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Aimes RT, Quigley JP. Matrix metalloproteinase-2 is an interstitial collagenase. Inhibitor-free enzyme catalyzes the cleavage of collagen fibrils and soluble native type I collagen generating the specific 3/4- and 1/4-length fragments. J Biol Chem 1995;270:5872-5876. [DOI] [PubMed] [Google Scholar]
  • 43. Lee SJ, Bae SS, Kim KH, et al. High glucose enhances MMP-2 production in adventitial fibroblasts via Akt1-dependent NF-kappaB pathway. FEBS Lett 2007;581:4189-4194. [DOI] [PubMed] [Google Scholar]
  • 44. Choi HR, Kondo S, Hirose K, et al. Expression and enzymatic activity of MMP-2 during healing process of the acute supraspinatus tendon tear in rabbits. J Orthop Res 2002;20:927-933. [DOI] [PubMed] [Google Scholar]
  • 45. Amiel D, Frank C, Harwood F, Fronek J, Akeson W. Tendons and ligaments: a morphological and biochemical comparison. J Orthop Res 1984;1:257-265. [DOI] [PubMed] [Google Scholar]
  • 46. Lin YC, Li YJ, Rui YF, et al. The effects of high glucose on tendon-derived stem cells: implications of the pathogenesis of diabetic tendon disorders. Oncotarget 2017;8:17518-17528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Volper BD, Huynh RT, Arthur KA, et al. Influence of acute and chronic streptozotocin-induced diabetes on the rat tendon extracellular matrix and mechanical properties. Am J Physiol Regul Integr Comp Physiol 2015;309:R1135-R1143. [DOI] [PubMed] [Google Scholar]
  • 48. Linxi Z, Guirong Z, Guirong Z, Gang S. The Effect of High Glucose on Proliferation and Expression of Correlation Factors of MG63 Osteoblasts. J Hard Tissue Biol 2015;24:143-146. [Google Scholar]
  • 49. Higuchi C, Sanaka T, Sato T, et al. The effect of glucose on the proliferation of peritoneal fibroblasts. Adv Perit Dial 1997;13:253-256. [PubMed] [Google Scholar]
  • 50. Poulsen RC, Knowles HJ, Carr AJ, Hulley PA. Cell differentiation versus cell death: extracellular glucose is a key determinant of cell fate following oxidative stress exposure. Cell Death Dis 2014;5:e1074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Liu J, Wu Y, Wang B, Yuan X, Fang B. High levels of glucose induced the caspase-3/PARP signaling pathway, leading to apoptosis in human periodontal ligament fibroblasts. Cell Biochem Biophys 2013;66:229-237. [DOI] [PubMed] [Google Scholar]
  • 52. Yao L, Bestwick CS, Bestwick LA, Maffulli N, Aspden RM. Phenotypic drift in human tenocyte culture. Tissue Eng 2006;12:1843-1849. [DOI] [PubMed] [Google Scholar]
  • 53. Harada Y, Kokubu T, Mifune Y, et al. Dose- and time-dependent effects of triamcinolone acetonide on human rotator cuff-derived cells. Bone Joint Res 2014;3:328-334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Lehner C, Gehwolf R, Wagner A, et al. Tendons from non-diabetic humans and rats harbor a population of insulin-producing, pancreatic beta cell-like cells. Horm Metab Res 2012;44:506-510. [DOI] [PubMed] [Google Scholar]

Articles from Bone & Joint Research are provided here courtesy of British Editorial Society of Bone and Joint Surgery

RESOURCES