Skip to main content
NCBI home page
Oxidative Medicine and Cellular Longevity logoLink to Oxidative Medicine and Cellular Longevity
. 2018 May 24;2018:9647809. doi: 10.1155/2018/9647809

Hydrogen Sulfide Alleviates Lipopolysaccharide-Induced Diaphragm Dysfunction in Rats by Reducing Apoptosis and Inflammation through ROS/MAPK and TLR4/NF-κB Signaling Pathways

Guo-Yu Zhang 1, Dan Lu 2,3, Shao-Feng Duan 3,4, Ying-Ran Gao 2,3, Shi-Yu Liu 2,3, Ya Hong 2,3, Peng-Zhen Dong 2,3, Ya-Ge Chen 2,3, Tao Li 2,3, Da-Yong Wang 1, Xiang-Shu Cheng 5, Fei He 5, Jian-She Wei 3,6, Guang-Yu Li 7, Qing-Yong Zhang 8, Dong-Dong Wu 2,3,✉, Xin-Ying Ji 2,3,9,✉
PMCID: PMC5994286  PMID: 29977458

Abstract

Diaphragm dysfunction is an important clinical problem worldwide. Hydrogen sulfide (H2S) is involved in many physiological and pathological processes in mammals. However, the effect and mechanism of H2S in diaphragm dysfunction have not been fully elucidated. In this study, we detected that the level of H2S was decreased in lipopolysaccharide- (LPS-) treated L6 cells. Treatment with H2S increased the proliferation and viability of LPS-treated L6 cells. We found that H2S decreased reactive oxygen species- (ROS-) induced apoptosis through the mitogen-activated protein kinase (MAPK) signaling pathway in LPS-treated L6 cells. Administration of H2S alleviated LPS-induced inflammation by mediating the toll-like receptor-4 (TLR-4)/nuclear factor-kappa B (NF-κB) signaling pathway in L6 cells. Furthermore, H2S improved diaphragmatic function and structure through the reduction of inflammation and apoptosis in the diaphragm of septic rats. In conclusion, these findings indicate that H2S ameliorates LPS-induced diaphragm dysfunction in rats by reducing apoptosis and inflammation through ROS/MAPK and TLR4/NF-κB signaling pathways. Novel slow-releasing H2S donors can be designed and applied for the treatment of diaphragm dysfunction.

1. Introduction

The diaphragm is a dome-shaped skeletal muscle in mammals that is mainly required for respiratory function [1, 2]. Pleural pressure is decreased by the contraction of the diaphragm, which makes the inspiration step of ventilation possible. Therefore, the efficiency of respiration is partly determined by the contractile performance of the diaphragm [3]. Diaphragm dysfunction is involved in a number of clinical conditions, including interstitial lung disease, chronic obstructive pulmonary disease, heart failure, spinal cord injury, critical illness and mechanical ventilation, and neuromuscular disease [4–9]. An increasing number of studies indicate that diaphragm dysfunction has been linked to impaired exercise tolerance, increased breathlessness, prolonged and difficult weaning from mechanical ventilation, and adverse health outcomes [10–12].

Hydrogen sulfide (H2S) has been considered the third gaseous signaling molecule, accompanying nitric oxide, and carbon monoxide [13, 14]. H2S can be endogenously produced from L-cysteine (L-Cys) and homocysteine in mammals mainly by two pyridoxal-5′-phosphate- (PLP-) dependent enzymes, namely cystathionine γ-lyase (CSE) and cystathionine β-synthase (CBS) [15–17]. 3-Mercaptopyruvate sulfurtransferase (3-MST), a PLP-independent enzyme, acts in combination with cysteine aminotransferase to produce H2S from L-Cys in the presence of α-ketoglutarate [15, 18]. There is increasing evidence that H2S plays important roles in a wide range of physiological and pathological conditions [13, 16, 18]. In the respiratory system, H2S has been shown to regulate many important functions such as pulmonary circulation, airway tone, fibrosis, cell proliferation or apoptosis, oxidative stress, and inflammation [19–21]. However, the effect and mechanism of H2S in diaphragm dysfunction have not been fully elucidated.

Sepsis is a life-threatening organ dysfunction caused by a dysregulated host response to infection [22, 23]. A number of studies have indicated that sepsis could induce diaphragm dysfunction, which can be attributed to the localized elaboration of cytokines within the diaphragm [24–26]. Lipopolysaccharide (LPS) is one of the cell wall components of most Gram-negative bacteria and acts as a potent initiator of inflammation [27, 28]. Recently, LPS has been widely adopted to induce septic diaphragm dysfunction in many different animal models [24, 27, 29]. In the present study, we detected the protein expressions of H2S-generating enzymes and the level of endogenous H2S in LPS-treated skeletal muscle cells, and further determined the effect of exogenous H2S on diaphragm dysfunction and clarified the associated molecular mechanism.

2. Materials and Methods

2.1. Cell Culture

Rat skeletal muscle cell line L6 was obtained from the Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (IBCB, CAS, Shanghai, China) and maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum, 100 U/ml penicillin, and 100 μg/ml streptomycin. Cells were cultured in a humidified incubator with 5% CO2 and 95% air at 37°C. Confluent L6 cells were transferred to serum-free DMEM medium for overnight starvation before each experiment. The cells were divided into three groups: control group, LPS group, and LPS + H2S group. The control group was treated with phosphate-buffered saline (PBS) and the LPS group was treated with 250 μg/ml LPS (dissolved in PBS). The LPS + H2S group was treated with 250 μg/ml LPS and 100 μM NaHS (an H2S donor, dissolved in PBS). After 24 h of treatment, the cells were then used for subsequent experiments.

2.2. Measurement of H2S Levels

The concentrations of H2S in L6 cells and culture supernatant were measured using an enzyme-linked immunosorbent assay (ELISA) kit (LanpaiBio, Shanghai, China) as previously described [30].

2.3. Cell Growth Assay

The 5-ethynyl-2′-deoxyuridine (EdU) incorporation assay was performed using the Cell-Light EdU Apollo 567 In Vitro Imaging Kit (RiboBio, Guangzhou, Guangdong, China) according to the manufacturer's instructions. Cell proliferation rate = (EdU-positive cells)/(total number of cells) × 100%. The cell viability was detected using the CellTiter 96 AQueous One Solution Cell Proliferation Assay kit (MTS; Promega, Madison, WI, USA) according to the manufacturer's protocols. The cell viability was expressed as a percentage of the untreated control.

2.4. Cellular Apoptosis Analysis

Cellular apoptosis was analyzed by the in situ terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay using a cell death detection kit (Beyotime Institute of Biotechnology, Shanghai, China) following the manufacturer's instructions. Briefly, cells were fixed with 4% paraformaldehyde, permeabilized with 0.1% Triton X-100, incubated with 50 μl TUNEL reaction mixture for 60 min at 37°C in darkness and then rinsed with PBS three times. After counterstaining with 5 mg/ml DAPI for 5 min at room temperature, cells were photographed with a fluorescent microscope (Eclipse Ti, Nikon, Melville, NY, USA) from six random fields. The apoptotic index = (positively stained apoptotic cells)/(total number of cells) × 100%.

2.5. Detection of Intracellular Reactive Oxygen Species (ROS)

Intracellular ROS generation was detected by using a 2′,7′-dichlorofluorescin diacetate- (DCF-DA-) Cellular Reactive Oxygen Species Detection Assay Kit (Beyotime Institute of Biotechnology, Shanghai, China). Cells were incubated with 10 μM DCF-DA for 30 min in darkness at 37°C and washed three times with PBS. The fluorescence was observed under a fluorescent microscope (Eclipse Ti, Nikon, Melville, NY, USA) from six random fields and measured by Image J software (National Institutes of Health, Bethesda, MD, USA).

2.6. Antioxidant Activity Determination

The activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), and catalase (CAT) in L6 cells were measured using commercial kits (Beyotime Institute of Biotechnology, Shanghai, China) according to the manufacturer's instructions.

2.7. Biochemical Analysis

The contents of IL-6, IL-10, and IL-18 in L6 cells were determined using commercial ELISA kits (Elabscience, Wuhan, Hubei, China) according to the manufacturer's protocols.

2.8. Western Blotting

Total protein was extracted from L6 cells. Western blotting was performed to detect the target proteins. The primary antibodies, including anti-CSE, anti-CBS, anti-3-MST, anti-B-cell lymphoma-2 (Bcl-2), anti-B-cell lymphoma-extra large (Bcl-xl), anti-Bcl-2-associated X protein (Bax), anti-Bcl-xl/Bcl-2-associated death promoter (Bad), anti-cleaved caspase-3, anti-cleaved caspase-8, anti-cleaved caspase-9, anti-cleaved polyadenosine diphosphate-ribose polymerase (PARP), and anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibodies were purchased from Proteintech (Chicago, IL, USA). Anti-extracellular signal-regulated protein kinase 1/2 (ERK1/2), anti-phospho (p)-ERK1/2 (Thr202/Tyr204), anti-p38, anti-p-p38 (Thr180/Tyr182), anti-c-Jun N-terminal kinase (JNK), anti-p-JNK (Thr183/Tyr185), anti-toll-like receptor-4 (TLR-4), anti-transforming growth factor-activated kinase-1 (TAK1), anti-p-TAK1 (Ser412), anti-inhibitor of nuclear factor kappa-B kinase (IKK) subunit alpha (IKKα), anti-IKK subunit β (IKKβ), anti-p-IKKα/β (Ser176/180), anti-nuclear factor of kappa light polypeptide gene enhancer in B-cell inhibitor, alpha (IκBα), anti-p-IκBα (Ser32), anti-p50, anti-p65, anti-p-p65 (Ser536), and the horseradish peroxidase-conjugated secondary antibody were purchased from Cell Signaling Technology (CST, Danvers, MA, USA). Results were normalized to the level of GAPDH. The reaction was visualized using an enhanced chemiluminescence system (Thermo Fisher Scientific, Rockford, IL, USA). The bands were semiquantified with Image J software.

2.9. Animal Study

Animal experiments were approved by the Committee of Medical Ethics and Welfare for Experimental Animals of Henan University School of Medicine in compliance with the Experimental Animal Regulations formulated by the National Science and Technology Commission, China (HUSOM-2017-198). All animal experiments were conducted in accordance with the committee's approved guidelines. Eighteen male Wistar rats (6–8 weeks old), initially weighing 180–220 g, were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). Rats were housed in individual cages in a temperature- and humidity-controlled room with a 12-hour light/dark cycle. All rats were fed standard pellet food and distilled water ad libitum and allowed to acclimatize to new surroundings for one week prior to the study. Animal studies were performed as previously described with minor modifications [24]. Briefly, rats received an intraperitoneal (i.p.) injection of 5 mg/kg LPS which was dissolved in normal saline (NS) to induce diaphragm dysfunction. A normal control group was also allocated. Subsequently, the rats from the control and LPS groups received an i.p. injection of NS and the rats from the LPS + H2S group received an i.p. injection of NaHS (100 μmol/kg, dissolved in NS).

2.10. Diaphragm Contractile Measurements

Twenty-four hours after the administration of NaHS or NS, all rats were killed and the body weight change was measured. The right hemidiaphragm was quickly removed and immediately immersed in Krebs solution that was continuously aerated with 95% O2/5% CO2 and contained the following (mmol/l): 135 NaCl, 5 KCl, 2.5 CaCl2, 1 MgSO4, 1 NaH2PO4, 15 NaHCO3, and 1 glucose, with a pH of 7.4. A diaphragm muscle strip (5 mm wide) was obtained from the midcostal region of the right diaphragm by careful dissection parallel to the long axis of the fibers. The muscle strip was suspended vertically in a 37°C tissue bath containing Krebs solution. The end of the muscle was tied to a rigid support. The muscle tendon was connected to an isometric force transducer mounted on a micrometer.

Two silver stimulating electrodes were placed parallel to the muscle strip. After equilibration for 15 min, isometric contractions were recorded at the optimal muscle length (L0) at which the peak twitch force was observed. Stimuli were applied using a rectangular 0.2 ms duration pulse and a train duration of 250 ms. To ensure supramaximal stimulation, the strips were stimulated at 20% above voltage to obtain maximal forces. The signal was amplified and recorded using a data acquisition system (MedLab, Nanjing, Jiangsu, China). Once maximal stimulus intensity and the L0 for force production were determined, peak twitch tension was determined at L0 from a series of contractions induced by single-pulse stimuli and maximal rate of contraction (+dT/dtmax) and maximal rate of relaxation (−dT/dtmax) were measured. Maximal tetanic tension was produced by a supramaximal 250 ms stimulus train at 100 Hz. To measure the force-frequency response, each strip was stimulated with a 250 ms train at 10, 20, 40, 60, and 100 Hz, with at least a 2 min interval between each stimulus train. The fatigue index of the diaphragm was assessed by a series of 150 tetanic contractions (400 ms contraction times at 10, 20, 40, 60, and 100 Hz once every second). The fatigue index was calculated from the ratio of the force produced during the 150th contraction relative to the 1st contraction [31]. After the measurements were taken, the muscle strip was blotted dry and weighed. The forces were normalized to muscle cross-sectional area (CSA) and expressed as specific force (N/cm2). Tissue CSA was estimated using measurements of muscle length (cm), mass (g), and density (1.056 g/cm3). The left costal hemidiaphragm was used for biochemical and molecular experiments, or embedded in FSC 22 frozen section compound (Leica, Buffalo Grove, IL, USA) for histological staining.

2.11. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

Total RNA was isolated from diaphragmatic muscle tissues using a TRIzol reagent, treated with DNase I, and purified using an RNA clean-up kit (Cwbiotech, Beijing, China). Total RNA (1 μg) was applied for cDNA synthesis using a cDNA reverse transcription kit (Cwbiotech, Beijing, China). Primers were designed according to the primer design principles with Primer Premier 5.0 (Premier Biosoft, Palo Alto, CA, USA). The sequences of primers were listed in Table 1. The reactions were performed in a total volume of 20 μl using the following thermal cycling parameters: 95°C for 10 min, 40 cycles of 95°C for 15 s, 60°C for 60 s, and 72°C for 1 min. The results were normalized to the level of GAPDH.

Table 1.

Primers used in this study.

Genes Sense primers (5′–3′) Antisense primers (5′–3′)
TNF-α GAAAGCATGATCCGAGATGTGGAA CAGTAGACAGAAGAGCGTGGTGGC
MCP-1 CTATGCAGGTCTCTGTCACGCTTC CAGCCGACTCATTGGGATCA
IL-1β TGCAGGCTTCGAGATGAA AGGCCACAGGGATTTTGTC
IL-6 ACAGCCACTGCCTTCCCTAC GAATTGCCATTGCACAACTCTT
IL-10 CCTCTGGATACAGCTGCGAC CAGTAGATGCCGGGTGGTTC
IL-18 GACCGAACAGCCAACGAATC GATAGGGTCACAGCCAGTCC
GAPDH CGTGTTCCTACCCCCAATGTA CACAGGAGACAACCTGGTCC
Open in a new tab

2.12. Histological Analysis

A necropsy examination was performed immediately after the rats were sacrificed. Diaphragmatic muscle tissues were fixed in 10% neutral buffered formalin, embedded in paraffin, sectioned at 5 μm thickness, and processed according to the hematoxylin and eosin (HE) staining protocols. Diaphragmatic muscle tissues were then stained with anti-myosin heavy chain (MHC) Type I, anti-MHC Type IIa, anti-Ki67, and anti-cleaved caspase 3 antibodies (CST, Danvers, MA, USA), followed by incubation with a secondary antibody. Diaphragmatic muscle tissues were observed using a Zeiss Axioskop 2 plus microscope (Carl Zeiss, Thornwood, NY, USA). The cross-sectional area (CSA) of a diaphragm muscle fiber was determined according to a previous study [32]. The proliferation index (PI) was determined by the number of Ki67 positive cells among the total number of cells [33]. Furthermore, apoptosis rate was estimated as cleaved caspase 3 positive cells/total cells [34].

2.13. Statistical Analysis

All results were presented as the mean ± standard error of the mean (SEM). Statistical differences were analyzed by one-way analysis of variance (ANOVA) using SPSS 17.0 software, followed by an LSD post hoc test. A P value of less than 0.05 was considered to be statistically significant.

3. Results

3.1. The Level of H2S Is Decreased in LPS-Treated L6 Cells and Administration of H2S Increases the Growth of LPS-Treated L6 Cells

As shown in Figures 1(a)–1(d), the protein levels of CSE, CBS, and 3-MST in LPS-treated L6 cells were lower than those in untreated L6 cells. In addition, the levels of H2S in LPS-treated L6 cells, as well as in the supernatant, were lower than those in untreated L6 cells and the supernatant (Figures 1(e) and 1(f)). These results suggest that H2S may play an important role in the growth of L6 cells. To test this hypothesis, we determined the effect of exogenous H2S on the growth of LPS-treated L6 cells. The proliferation and viability of L6 cells were inhibited by the treatment of LPS, while 100 μM NaHS enhanced the proliferation and viability of LPS-treated L6 cells (Figures 1(g)–1(i)).

Figure 1.

Figure 1

Open in a new tab

The levels of endogenous H2S in L6 cells and LPS-treated L6 cells were detected, and the effects of exogenous H2S on the growth of LPS-treated L6 cells were examined. (a) The protein expression of CSE, CBS, and 3-MST were examined by Western blot. GAPDH was used as the loading control. (b–d) Bar graphs showed the quantification of CSE, CBS, and 3-MST. The densitometry analysis of each factor was performed, normalized to the corresponding GAPDH level. (e) The levels of H2S in L6 cells and LPS-treated L6 cells. (f) The levels of H2S in the culture supernatant. (g) DNA replication activities were examined by EdU assay; original magnification, ×200. (h) The proliferation rate of each group was analyzed. (i) The percentages of viable cells were determined using the MTT assay, and the cell viability of L6 cells was normalized as 100% and considered to be the control group. Data are presented as mean ± SEM of three independent experiments; ∗P < 0.05 and ∗∗P < 0.01 compared with the control group; ##P < 0.01 compared with the LPS group.

3.2. H2S Reduces Apoptosis in LPS-Treated L6 Cells

As shown in Figures 2(a) and 2(b), the apoptotic index increased in the LPS group compared with the control group. Administration of H2S decreased the apoptotic index in the LPS group. The ratios of Bax/Bcl-2 and Bad/Bcl-xl have been widely considered important factors in the regulation of apoptosis. In mammalian cells, increased Bad/Bcl-xl and Bax/Bcl-2 ratios are common phenomena in mitochondrial apoptosis [35, 36]. As shown in Figures 2(c), 2(e), and 2(f), the Bax/Bcl-2 and Bad/Bcl-xl ratios increased in the LPS group compared with the control group and decreased in the LPS + H2S group compared with the LPS group. Furthermore, the protein expression levels of cleaved caspase-3, -8, and -9 and cleaved PARP showed similar trends (Figures 2(d), 2(g)–2(j)). In sum, these results indicate that the apoptotic level in LPS-treated L6 cells is increased and administration of H2S significantly reduces the apoptotic level.

Figure 2.

Figure 2

Open in a new tab

Effects of H2S on the apoptosis of LPS-treated L6 cells. (a) The apoptotic levels were measured by TUNEL staining; original magnification, ×100. (b) The percentages of TUNEL-positive cells were calculated by the formula: the apoptotic index = (positively stained apoptotic cells)/(total number of cells) × 100%. (c–d) Western blotting analysis for the expression levels of Bcl-2, Bax, Bcl-xl, and Bad, cleaved caspase-3, -8, and -9 and cleaved PARP in each group. GAPDH was used as the loading control. (e–j) The densitometry analysis of each factor was performed in each group, normalized to the corresponding GAPDH level. Data are presented as mean ± SEM of three independent experiments; ∗P < 0.05 and ∗∗P < 0.01 compared with the control group; #P < 0.05 and ##P < 0.01 compared with the LPS group.

3.3. H2S Mediates the ROS/Mitogen-Activated Protein Kinase (MAPK) Signaling Pathway in L6 Cells

ROS are formed upon partial reduction of oxygen, including hydrogen peroxide, superoxide anion, singlet oxygen, and hydroxyl radical [37]. Enzymatic ROS-scavenging mechanisms include a number of antioxidant enzymes such as SOD, GSH-Px, and CAT [37, 38]. Compared to the control group, the levels of ROS were increased, and the activities of SOD, GSH-Px, and CAT were decreased in the LPS group, which were all reversed by treatment with H2S (Figures 3(a)–3(e)). These results suggest that H2S is able to abate LPS-induced oxidative stress in L6 cells. ROS are important and common messengers produced in various environmental stresses and are known to activate the MAPK pathway [37, 39, 40]. The MAPK family is composed of three major components: ERK, JNK, and p38 protein kinases [41, 42]. As shown in Figures 3(f)–3(h), LPS triggered phosphorylations of p38, JNK, and ERK with distinct patterns. However, treatment with H2S decreased phosphorylations of these protein kinases. The results show that H2S mediates the ROS/MAPK pathway in L6 cells.

Figure 3.

Figure 3

Open in a new tab

Effects of H2S on the ROS/MAPK signaling pathway in LPS-treated L6 cells. (a) The intracellular ROS production was detected using the fluorescent probe DCF-DA (shown in green; original magnification, ×100). (b) The intracellular ROS production was measured. (c–e) The activities of SOD, GSH-Px, and CAT were measured. (f–h) The protein expressions of ERK1/2, p-ERK1/2, p38, p-p38, JNK, and p-JNK were analyzed by Western blotting. Data are presented as mean ± SEM of three independent experiments; ∗P < 0.05 and ∗∗P < 0.01 compared with the control group; #P < 0.05 and ##P < 0.01 compared with the LPS group.

3.4. H2S Alleviates LPS-Induced Inflammation by Mediating the TLR4/Nuclear Factor-Kappa B (NF-κB) Signaling Pathway in L6 Cells

Many studies have shown that treatment with LPS could induce increased expressions of inflammatory cytokines in L6 cells, such as MCP-1, TNF-α, IL-6, and IL-10 [43–45]. Whether H2S could reduce the levels of inflammation in LPS-treated L6 cells remains unknown. In this study, the inflammatory cytokine levels in L6 cells were determined using ELISA techniques. Compared with the control group, expression levels of MCP-1, TNF-α, IL-1β, IL-6, IL-10, and IL-18 were increased in the LPS group. Treatment with H2S decreased the levels of these inflammatory cytokines (Figures 4(a)–4(f)), suggesting that H2S could alleviate inflammation in LPS-treated L6 cells. TLR4, a type I transmembrane receptor, plays an important role in the innate immune system. It is widely accepted that LPS can activate the TLR4/NF-κB signaling pathway [46, 47]. In the present study, we found that LPS increased the expression of TLR4, which was reduced by H2S treatment (Figure 4(g)). TAK1, IKK, and IκB are key upstream modulators for NF-κB activation [48]. As shown in Figures 4(h)–4(j), LPS treatment increased levels of phosphorylated TAK1, IKKα/β, and IκBα. However, these effects were reversed by treatment with H2S. The most abundant form of NF-κB is the heterodimer composed of p50 and p65 [49]. Compared with the control group, LPS treatment increased protein expressions of p50 and p-p65 and the p-p65/p65 ratio. Administration of H2S decreased expression levels of p50 and p-p65, as well as the ratio of p-p65/p65 (Figures 4(k) and 4(l)). These results together indicate that H2S is capable of reducing LPS-induced inflammation through inhibition of the TLR4/NF-κB signaling pathway.

Figure 4.

Figure 4

Open in a new tab

Effects of H2S on the cytokine levels and the TLR4/NF-κB signaling pathway in diaphragmatic muscle tissues of septic rats. (a–f) The expression levels of MCP-1, TNF-α, IL-1β, IL-6, IL-10, and IL-18 were measured. (g–l) The protein expressions of TLR4, TAK1, p-TAK1, IKKα, IKKβ, p-IKKα/β, IκBα, p-IκBα, p50, p65, p-p65, and GAPDH were analyzed by Western blotting. Data are presented as mean ± SEM of three independent experiments; ∗P < 0.05 and ∗∗P < 0.01 compared with the control group; #P < 0.05 and ##P < 0.01 compared with the LPS group.

3.5. H2S Improves Diaphragmatic Function and Structure of Septic Rats

There was no significant difference in body weight at the beginning of the animal study. After 24 h, LPS treatment reduced the body weights of the rats, while H2S increased the body weights of septic rats (Figure 5(a)). However, there was no significant difference in strip weight among each group (Figure 5(b)). LPS elicited a large reduction in the force-generating capacity of the diaphragm, producing dramatic reductions in muscle-specific force generation of the diaphragm. Administration of H2S attenuated the effects of LPS on diaphragm strength, with force generation at the stimulation frequencies from 20 to 100 Hz (Figure 5(c)). As shown in Figures 5(d) and 5(e), LPS decreased both maximum tetanic tension and peak twitch tension, whereas the effects were reversed by treatment with H2S. In addition, LPS reduced the fatigue index, which was enhanced by H2S treatment (Figure 5(f)). Furthermore, LPS decreased the maximal rates of contraction and relaxation (±dT/dtmax), while H2S increased the maximal rates of contraction/relaxation (Figures 5(g) and 5(h)). As shown in Figures 5(i)–5(k), the CSA of both MHCfast and MHCslow was decreased in the LPS group. However, administration of H2S prevented the loss of the CSA of MHCfast and MHCslow compared with the LPS group, indicating that H2S can reduce LPS-induced diaphragm injury. Collectively, these data demonstrate that H2S improves diaphragmatic function and structure of septic rats.

Figure 5.

Figure 5

Open in a new tab

Effects of H2S on the diaphragmatic function and structure of septic rats. (a, b) The body weight and strip weight of rats were measured. (c) The contractile force was measured. (d, e) The maximum tetanic tension and peak twitch tension were detected. (f) The fatigue index was measured. (g, h) The maximal rate of contraction (+dT/dtmax) and the maximal rate of relaxation (−dT/dtmax) were detected. (i) Representative photographs of diaphragm muscle cross-sectional area in diaphragm skeletal muscle myofibers of rats; original magnification, ×400. (j, k) Fast-twitch fibers and slow-twitch fibers were calculated. Values were presented as mean ± SEM (n = 6). ∗P < 0.05 and ∗∗P < 0.01 compared with the control group; #P < 0.05 and ##P < 0.01 compared with the LPS group.

3.6. H2S Decreases Inflammation and Apoptosis in the Diaphragm of Septic Rats

The expressions of cytokine genes were detected by qRT-PCR. As shown in Figures 6(a)–6(f), gene expressions of MCP-1, TNF-α, IL-1β, IL-6, IL-10, and IL-18 were increased in the LPS group. Treatment with H2S decreased gene expressions of these inflammatory cytokines. IHC with the Ki67 antibody confirmed that the in vivo proliferation of diaphragmatic muscle cells was inhibited in the LPS group and promoted in the LPS + H2S group (Figures 6(g) and 6(h)). However, the protein expression of cleaved caspase-3 exhibited an opposite trend (Figures 6(g) and 6(i)). These results together indicate that H2S is able to decrease inflammation and apoptosis in the diaphragm of septic rats.

Figure 6.

Figure 6

Open in a new tab

Effects of H2S on the inflammation, proliferation, and apoptosis in the diaphragm of septic rats. (a–f) The expressions of MCP-1, TNF-α, IL-1β, IL-6, IL-10, and IL-18 were detected by qRT-PCR. Data are presented as mean ± SEM of three independent experiments. (g) Representative photographs of HE, Ki67, and cleaved caspase-3 staining in the diaphragm of rats; original magnification, ×400. (h, i) The proliferation index and apoptosis index were calculated. Values were presented as mean ± SEM (n = 6). ∗P < 0.05 and ∗∗P < 0.01 compared with the control group; #P < 0.05 and ##P < 0.01 compared with the LPS group.

4. Discussion

H2S has been considered the third gaseous signaling molecule and plays important roles in a wide range of physiological and pathological conditions [13, 16, 18]. However, the effect and mechanism of H2S in diaphragm dysfunction have not been fully elucidated. Rat skeletal muscle cell line L6 has been widely used to study the regeneration and function of skeletal muscle [50–52]. LPS, a major constituent of the cell wall of Gram-negative bacteria, is a potent agent widely used to model bacterial challenges of mammalian cells [27, 28]. In the present study, L6 cells were used to evaluate the effects of H2S on the LPS-induced diaphragmatic injury in vitro. The results demonstrated that the protein levels of H2S-generating enzymes and the levels of H2S in LPS-treated L6 cells and supernatant were lower than those in L6 cells and the supernatant, suggesting that H2S may be involved in the growth of L6 cells. To test this hypothesis, we examined the effect of exogenous H2S on the growth of LPS-treated L6 cells. The results showed that the proliferation and viability of L6 cells were inhibited in the LPS group, whereas administration of H2S enhanced the proliferation and viability of LPS-treated L6 cells, indicating that H2S is involved in the growth of L6 cells.

Apoptosis is a highly regulated mechanism of cell death which plays a critical role in the normal development and maintenance of tissue homeostasis in multicellular organisms [53]. There are two main apoptotic signaling pathways: an extrinsic pathway initiated by death receptors and an intrinsic pathway that occurs through the mitochondria [54]. Apoptosis is regulated by Bcl-2 family proteins, including proapoptotic proteins such as Bax and Bad, and antiapoptotic proteins such as Bcl-2 and Bcl-xl [55]. Caspases can be activated by apoptotic stimuli and cleaved caspase-3 can inactivate PARP, thus leading to the occurrence of apoptotic cascade [56]. Recent studies have shown that LPS could induce apoptosis in different types of cells [28, 57, 58]. Similarly, our results indicated that LPS increased the apoptotic index, Bax/Bcl-2 and Bad/Bcl-xl ratios, as well as protein expression levels of cleaved caspase-3, -8, and -9 and cleaved PARP in L6 cells. Treatment with H2S decreased the apoptotic level in the LPS group. In sum, these results demonstrate that the apoptotic level in LPS-treated L6 cells is increased and administration of H2S can reduce the apoptotic level.

High levels of ROS could lead to an imbalance of the cellular redox state and oxidative stress, as well as induce cell apoptosis or necrosis in a number of physiological and pathological conditions [59, 60]. Our results demonstrated that LPS increased the levels of ROS and decreased the activities of SOD, GSH-Px, and CAT, which were similar to a previous study [61]. All these changes were reversed by treatment with H2S. It has been shown that ROS could activate MAPKs, and apoptotic cell death induced by ROS is mediated by the MAPK pathway [62]. The MAPK family is mainly composed of three components, including ERK, JNK, and p38 protein kinases [41, 42]. Recently, it has been demonstrated that LPS is able to decrease the protein synthetic rate in C2C12 mouse myoblasts through P38/ERK1/2 activation [63]. Furthermore, JNK and p38 can be phosphorylated in LPS-induced inflammatory responses in L6 myoblasts [44]. In line with the above findings, our results showed that LPS triggered the phosphorylations of p38, JNK, and ERK with distinct patterns. However, H2S decreased the phosphorylations of these protein kinases. These results together suggest that H2S can decrease ROS-induced apoptosis through the MAPK signaling pathway in LPS-treated L6 cells.

It has been shown that LPS could increase expressions of inflammatory cytokines in L6 cells, such as TNF-α, MCP-1, IL-6, and IL-10 [43–45]. In the present study, LPS treatment increased the expression levels of MCP-1, TNF-α, IL-1β, IL-6, IL-10, and IL-18. H2S treatment decreased the levels of these inflammatory cytokines, indicating that H2S is capable of alleviating inflammation in LPS-treated L6 cells. TLR4, a main receptor of LPS, plays a key role in the initiation and acceleration of inflammatory responses induced by LPS [64, 65]. Activation of TLR4 by LPS can induce the activation of the NF-κB signaling pathway to regulate the release of proinflammatory cytokines [46, 47]. Our results showed that LPS increased the expressions of TLR4, p-TAK1, p-IKKα/β, p-IκBα, p50, and p-p65. However, these effects were reversed by treatment with H2S, suggesting that H2S is able to reduce LPS-induced inflammation by suppressing the TLR4/NF-κB signaling pathway in L6 cells.

Recent studies have demonstrated that administration of LPS can induce diaphragmatic contractile dysfunction in several animal models [24, 27, 29]. Our results indicated that LPS treatment reduced the force-generating capacity, maximum tetanic tension, peak twitch tension, fatigue index, and the maximal rates of contraction and relaxation of the diaphragm of septic rats. Administration of H2S improved the impaired diaphragmatic function induced by LPS in septic rats. In addition, a recent study has shown that LPS treatment decreases the CSA of embryonic MHC fibers in the preterm diaphragm of pregnant ewes [66]. Our results showed that LPS decreased the CSA of both MHCslow and MHCfast, while H2S prevented LPS-induced loss of CSA of MHCslow and MHCfast in the diaphragm of septic rats. Furthermore, H2S decreased levels of inflammation and apoptosis induced by LPS in the diaphragm of septic rats. These data together indicate that H2S is capable of improving diaphragmatic function and structure through reduction of inflammation and apoptosis in the diaphragm of septic rats.

In conclusion, our results demonstrate that H2S is able to ameliorate LPS-induced diaphragm dysfunction in rats by reducing apoptosis and inflammation through ROS/MAPK and TLR4/NF-κB signaling pathways. Novel slow-releasing H2S donors can be designed and applied for the treatment of diaphragm dysfunction.

Acknowledgments

This work was supported by grants from the National Natural Science Foundation of China (no. U1504817 to Dong-Dong Wu and no. 81670088 to Xin-Ying Ji), the Foundation of Science & Technology Department of Henan Province, China (no. 182102310335 to Dong-Dong Wu and no. 172102410019 to Xin-Ying Ji), the Natural Science Foundation of Education Department of Henan Province, China (no. 15A310017 to Dong-Dong Wu), and the Science Foundation of Henan University, China (nos. yqpy20170044 and 16NB048 to Dong-Dong Wu).

Contributor Information

Dong-Dong Wu, Email: dongyangwu2007@sina.com.

Xin-Ying Ji, Email: xinying_ji@henu.edu.cn.

Data Availability

The raw data used to support the findings of this study are available from the corresponding author upon request.

Conflicts of Interest

The authors declare that they have no conflicts of interest related to this work.

Authors' Contributions

Guo-Yu Zhang, Dan Lu, and Shao-Feng Duan contributed equally to this work.

References

  • 1.Coles G. L., Ackerman K. G. Kif7 is required for the patterning and differentiation of the diaphragm in a model of syndromic congenital diaphragmatic hernia. Proceedings of the National Academy of Sciences of the United States of America. 2013;110(21):E1898–E1905. doi: 10.1073/pnas.1222797110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Ahn B., Coblentz P. D., Beharry A. W., et al. Diaphragm abnormalities in patients with end-stage heart failure: NADPH oxidase upregulation and protein oxidation. Frontiers in Physiology. 2017;7:p. 686. doi: 10.3389/fphys.2016.00686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Tuncer S., Dalkilic N., Burat I. Electrophysiological alterations in diaphragm muscle caused by abdominal ischemia-reperfusion. Respiratory Physiology & Neurobiology. 2017;238:7–13. doi: 10.1016/j.resp.2016.12.015. [DOI] [PubMed] [Google Scholar]
  • 4.Faisal A., Alghamdi B. J., Ciavaglia C. E., et al. Common mechanisms of dyspnea in chronic interstitial and obstructive lung disorders. American Journal of Respiratory and Critical Care Medicine. 2016;193(3):299–309. doi: 10.1164/rccm.201504-0841OC. [DOI] [PubMed] [Google Scholar]
  • 5.Barreiro E., Gea J. Epigenetics and muscle dysfunction in chronic obstructive pulmonary disease. Translational Research. 2015;165(1):61–73. doi: 10.1016/j.trsl.2014.04.006. [DOI] [PubMed] [Google Scholar]
  • 6.Kelley R. C., Ferreira L. F. Diaphragm abnormalities in heart failure and aging: mechanisms and integration of cardiovascular and respiratory pathophysiology. Heart Failure Reviews. 2017;22(2):191–207. doi: 10.1007/s10741-016-9549-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Charsar B. A., Urban M. W., Lepore A. C. Harnessing the power of cell transplantation to target respiratory dysfunction following spinal cord injury. Experimental Neurology. 2017;287(Part 2):268–275. doi: 10.1016/j.expneurol.2016.08.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Dres M., Goligher E. C., Heunks L. M. A., Brochard L. J. Critical illness-associated diaphragm weakness. Intensive Care Medicine. 2017;43(10):1441–1452. doi: 10.1007/s00134-017-4928-4. [DOI] [PubMed] [Google Scholar]
  • 9.Aboussouan L. S., Mireles-Cabodevila E. Sleep-disordered breathing in neuromuscular disease: diagnostic and therapeutic challenges. Chest. 2017;152(4):880–892. doi: 10.1016/j.chest.2017.03.023. [DOI] [PubMed] [Google Scholar]
  • 10.Laghi F., Tobin M. J. Disorders of the respiratory muscles. American Journal of Respiratory and Critical Care Medicine. 2003;168(1):10–48. doi: 10.1164/rccm.2206020. [DOI] [PubMed] [Google Scholar]
  • 11.Abdallah S. J., Chan D. S., Glicksman R., et al. Abdominal binding improves neuromuscular efficiency of the human diaphragm during exercise. Frontiers in Physiology. 2017;8:p. 345. doi: 10.3389/fphys.2017.00345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Supinski G. S., Morris P. E., Dhar S., Callahan L. A. Diaphragm dysfunction in critical illness. Chest. 2018;153(4):1040–1051. doi: 10.1016/j.chest.2017.08.1157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Szabo C. Gasotransmitters in cancer: from pathophysiology to experimental therapy. Nature Reviews Drug Discovery. 2016;15(3):185–203. doi: 10.1038/nrd.2015.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Hartle M. D., Pluth M. D. A practical guide to working with H2S at the interface of chemistry and biology. Chemical Society Reviews. 2016;45(22):6108–6117. doi: 10.1039/C6CS00212A. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wang R. Physiological implications of hydrogen sulfide: a whiff exploration that blossomed. Physiological Reviews. 2012;92(2):791–896. doi: 10.1152/physrev.00017.2011. [DOI] [PubMed] [Google Scholar]
  • 16.Szabo C., Coletta C., Chao C., et al. Tumor-derived hydrogen sulfide, produced by cystathionine-β-synthase, stimulates bioenergetics, cell proliferation, and angiogenesis in colon cancer. Proceedings of the National Academy of Sciences of the United States of America. 2013;110(30):12474–12479. doi: 10.1073/pnas.1306241110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Paul B. D., Snyder S. H. H2S signalling through protein sulfhydration and beyond. Nature Reviews Molecular Cell Biology. 2012;13(8):499–507. doi: 10.1038/nrm3391. [DOI] [PubMed] [Google Scholar]
  • 18.Wallace J. L., Wang R. Hydrogen sulfide-based therapeutics: exploiting a unique but ubiquitous gasotransmitter. Nature Reviews Drug Discovery. 2015;14(5):329–345. doi: 10.1038/nrd4433. [DOI] [PubMed] [Google Scholar]
  • 19.Lin F., Liao C., Sun Y., et al. Hydrogen sulfide inhibits cigarette smoke-induced endoplasmic reticulum stress and apoptosis in bronchial epithelial cells. Frontiers in Pharmacology. 2017;8:p. 675. doi: 10.3389/fphar.2017.00675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Bazhanov N., Ansar M., Ivanciuc T., Garofalo R. P., Casola A. Hydrogen sulfide: a novel player in airway development, pathophysiology of respiratory diseases, and antiviral defenses. American Journal of Respiratory Cell and Molecular Biology. 2017;57(4):403–410. doi: 10.1165/rcmb.2017-0114TR. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ivanciuc T., Sbrana E., Ansar M., et al. Hydrogen sulfide is an antiviral and antiinflammatory endogenous gasotransmitter in the airways. Role in respiratory syncytial virus infection. American Journal of Respiratory Cell and Molecular Biology. 2016;55(5):684–696. doi: 10.1165/rcmb.2015-0385OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Singer M., Deutschman C. S., Seymour C. W., et al. The third international consensus definitions for sepsis and septic shock (Sepsis-3) JAMA. 2016;315(8):801–810. doi: 10.1001/jama.2016.0287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Wu D. D., Li T., Ji X. Y. Dendritic cells in sepsis: pathological alterations and therapeutic implications. Journal of Immunology Research. 2017;2017:9. doi: 10.1155/2017/3591248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Maes K., Stamiris A., Thomas D., et al. Effects of controlled mechanical ventilation on sepsis-induced diaphragm dysfunction in rats. Critical Care Medicine. 2014;42(12):e772–e782. doi: 10.1097/CCM.0000000000000685. [DOI] [PubMed] [Google Scholar]
  • 25.Jiang J., Yang B., Han G., Yang M., Li S. Early administration of cisatracurium attenuates sepsis-induced diaphragm dysfunction in rats. Inflammation. 2015;38(1):305–311. doi: 10.1007/s10753-014-0034-8. [DOI] [PubMed] [Google Scholar]
  • 26.Susa Y., Masuda Y., Imaizumi H., Namiki A. Neutralization of receptor for advanced glycation end-products and high mobility group box-1 attenuates septic diaphragm dysfunction in rats with peritonitis. Critical Care Medicine. 2009;37(9):2619–2624. doi: 10.1097/CCM.0b013e3181a930f7. [DOI] [PubMed] [Google Scholar]
  • 27.Kim K. E., Koh Y. J., Jeon B. H., et al. Role of CD11b+ macrophages in intraperitoneal lipopolysaccharide-induced aberrant lymphangiogenesis and lymphatic function in the diaphragm. The American Journal of Pathology. 2009;175(4):1733–1745. doi: 10.2353/ajpath.2009.090133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Shi J., Zhao Y., Wang Y., et al. Inflammatory caspases are innate immune receptors for intracellular LPS. Nature. 2014;514(7521):187–192. doi: 10.1038/nature13683. [DOI] [PubMed] [Google Scholar]
  • 29.Song Y., Karisnan K., Noble P. B., et al. In utero LPS exposure impairs preterm diaphragm contractility. American Journal of Respiratory Cell and Molecular Biology. 2013;49(5):866–874. doi: 10.1165/rcmb.2013-0107OC. [DOI] [PubMed] [Google Scholar]
  • 30.Wu D., Li M., Tian W., et al. Hydrogen sulfide acts as a double-edged sword in human hepatocellular carcinoma cells through EGFR/ERK/MMP-2 and PTEN/AKT signaling pathways. Scientific Reports. 2017;7(1):p. 5134. doi: 10.1038/s41598-017-05457-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Javen I., Williams N. A., Young I. R., Luff A. R., Walker D. Growth and differentiation of fast and slow muscles in fetal sheep, and the effects of hypophysectomy. The Journal of Physiology. 1996;494(3):839–849. doi: 10.1113/jphysiol.1996.sp021537. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Zhu X., van Hees H. W. H., Heunks L., et al. The role of calpains in ventilator-induced diaphragm atrophy. Intensive Care Medicine Experimental. 2017;5(1):p. 14. doi: 10.1186/s40635-017-0127-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Keam B., Im S. A., Lee K. H., et al. Ki-67 can be used for further classification of triple negative breast cancer into two subtypes with different response and prognosis. Breast Cancer Research. 2011;13(2):p. R22. doi: 10.1186/bcr2834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Chang M. Y., Rhee Y. H., Yi S. H., et al. Doxycycline enhances survival and self-renewal of human pluripotent stem cells. Stem Cell Reports. 2014;3(2):353–364. doi: 10.1016/j.stemcr.2014.06.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Chen M., Wang X., Zha D., et al. Apigenin potentiates TRAIL therapy of non-small cell lung cancer via upregulating DR4/DR5 expression in a p53-dependent manner. Scientific Reports. 2016;6(1, article 35468) doi: 10.1038/srep35468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Pitchakarn P., Suzuki S., Ogawa K., et al. Induction of G1 arrest and apoptosis in androgen-dependent human prostate cancer by Kuguacin J, a triterpenoid from Momordica charantia leaf. Cancer Letters. 2011;306(2):142–150. doi: 10.1016/j.canlet.2011.02.041. [DOI] [PubMed] [Google Scholar]
  • 37.Liu Y., He C. A review of redox signaling and the control of MAP kinase pathway in plants. Redox Biology. 2017;11:192–204. doi: 10.1016/j.redox.2016.12.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Vucetic M., Stancic A., Otasevic V., et al. The impact of cold acclimation and hibernation on antioxidant defenses in the ground squirrel (Spermophilus citellus): an update. Free Radical Biology & Medicine. 2013;65:916–924. doi: 10.1016/j.freeradbiomed.2013.08.188. [DOI] [PubMed] [Google Scholar]
  • 39.Ma Y., Zhang J. X., Liu Y. N., et al. Caffeic acid phenethyl ester alleviates asthma by regulating the airway microenvironment via the ROS-responsive MAPK/Akt pathway. Free Radical Biology & Medicine. 2016;101:163–175. doi: 10.1016/j.freeradbiomed.2016.09.012. [DOI] [PubMed] [Google Scholar]
  • 40.Jalmi S. K., Sinha A. K. ROS mediated MAPK signaling in abiotic and biotic stress—striking similarities and differences. Frontiers in Plant Science. 2015;6:p. 769. doi: 10.3389/fpls.2015.00769. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Johnson G. L., Lapadat R. Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science. 2002;298(5600):1911–1912. doi: 10.1126/science.1072682. [DOI] [PubMed] [Google Scholar]
  • 42.Liu X., Ma B., Malik A. B., et al. Bidirectional regulation of neutrophil migration by mitogen-activated protein kinases. Nature Immunology. 2012;13(5):457–464. doi: 10.1038/ni.2258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Seyoum B., Fite A., Abou-Samra A. B. Effects of 3T3 adipocytes on interleukin-6 expression and insulin signaling in L6 skeletal muscle cells. Biochemical and Biophysical Research Communications. 2011;410(1):13–18. doi: 10.1016/j.bbrc.2011.05.073. [DOI] [PubMed] [Google Scholar]
  • 44.Hussey S. E., Liang H., Costford S. R., et al. TAK-242, a small-molecule inhibitor of Toll-like receptor 4 signalling, unveils similarities and differences in lipopolysaccharide- and lipid induced inflammation and insulin resistance in muscle cells. Bioscience Reports. 2012;33(1):37–47. doi: 10.1042/BSR20120098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Samokhvalov V., Bilan P. J., Schertzer J. D., Antonescu C. N., Klip A. Palmitate- and lipopolysaccharide-activated macrophages evoke contrasting insulin responses in muscle cells. American Journal of Physiology-Endocrinology and Metabolism. 2009;296(1):E37–E46. doi: 10.1152/ajpendo.90667.2008. [DOI] [PubMed] [Google Scholar]
  • 46.Fiorotto R., Scirpo R., Trauner M., et al. Loss of CFTR affects biliary epithelium innate immunity and causes TLR4-NF-κB-mediated inflammatory response in mice. Gastroenterology. 2011;141(4):1498–1508.e5. doi: 10.1053/j.gastro.2011.06.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Xiang N. L., Liu J., Liao Y. J., et al. Abrogating ClC-3 inhibits LPS-induced inflammation via blocking the TLR4/NF-κB pathway. Scientific Reports. 2016;6(1, article 27583) doi: 10.1038/srep27583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Zeng K. W., Fu H., Liu G. X., Wang X. M. Icariin attenuates lipopolysaccharide-induced microglial activation and resultant death of neurons by inhibiting TAK1/IKK/NF-κB and JNK/p38 MAPK pathways. International Immunopharmacology. 2010;10(6):668–678. doi: 10.1016/j.intimp.2010.03.010. [DOI] [PubMed] [Google Scholar]
  • 49.Shu G., Tang Y., Zhou Y., Wang C., Song J. G. Zac1 is a histone acetylation-regulated NF-κB suppressor that mediates histone deacetylase inhibitor-induced apoptosis. Cell Death & Differentiation. 2011;18(12):1825–1835. doi: 10.1038/cdd.2011.51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Andrade-Lopes A. L., Pires-Oliveira M., Menezes-Rodrigues F. S., Godinho R. O. Functional characterization of heterotrimeric G-proteins in rat diaphragm muscle. Respiratory Physiology & Neurobiology. 2011;175(2):212–219. doi: 10.1016/j.resp.2010.11.005. [DOI] [PubMed] [Google Scholar]
  • 51.Moresi V., Garcia-Alvarez G., Pristerà A., et al. Modulation of caspase activity regulates skeletal muscle regeneration and function in response to vasopressin and tumor necrosis factor. PLoS One. 2009;4(5, article e5570) doi: 10.1371/journal.pone.0005570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Trapani L., Segatto M., La Rosa P., et al. 3-Hydroxy 3-methylglutaryl coenzyme A reductase inhibition impairs muscle regeneration. Journal of Cellular Biochemistry. 2012;113(6):2057–2063. doi: 10.1002/jcb.24077. [DOI] [PubMed] [Google Scholar]
  • 53.Wu D., Si W., Wang M., Lv S., Ji A., Li Y. Hydrogen sulfide in cancer: friend or foe? Nitric Oxide. 2015;50:38–45. doi: 10.1016/j.niox.2015.08.004. [DOI] [PubMed] [Google Scholar]
  • 54.Wu D., Gao Y., Qi Y., Chen L., Ma Y., Li Y. Peptide-based cancer therapy: opportunity and challenge. Cancer Letters. 2014;351(1):13–22. doi: 10.1016/j.canlet.2014.05.002. [DOI] [PubMed] [Google Scholar]
  • 55.Lovell J. F., Billen L. P., Bindner S., et al. Membrane binding by tBid initiates an ordered series of events culminating in membrane permeabilization by Bax. Cell. 2008;135(6):1074–1084. doi: 10.1016/j.cell.2008.11.010. [DOI] [PubMed] [Google Scholar]
  • 56.Fan C. D., Li Y., Fu X. T., et al. Reversal of beta-amyloid-induced neurotoxicity in PC12 cells by curcumin, the important role of ROS-mediated signaling and ERK pathway. Cellular and Molecular Neurobiology. 2017;37(2):211–222. doi: 10.1007/s10571-016-0362-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Tang S. E., Wu C. P., Wu S. Y., et al. Stanniocalcin-1 ameliorates lipopolysaccharide-induced pulmonary oxidative stress, inflammation, and apoptosis in mice. Free Radical Biology & Medicine. 2014;71:321–331. doi: 10.1016/j.freeradbiomed.2014.03.034. [DOI] [PubMed] [Google Scholar]
  • 58.Zanoni I., Ostuni R., Capuano G., et al. CD14 regulates the dendritic cell life cycle after LPS exposure through NFAT activation. Nature. 2009;460(7252):264–268. doi: 10.1038/nature08118. [DOI] [PubMed] [Google Scholar]
  • 59.Circu M. L., Aw T. Y. Reactive oxygen species, cellular redox systems, and apoptosis. Free Radical Biology & Medicine. 2010;48(6):749–762. doi: 10.1016/j.freeradbiomed.2009.12.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Dunnill C. J., Ibraheem K., Mohamed A., Southgate J., Georgopoulos N. T. A redox state-dictated signalling pathway deciphers the malignant cell specificity of CD40-mediated apoptosis. Oncogene. 2017;36(18):2515–2528. doi: 10.1038/onc.2016.401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Chen L., Liu P., Feng X., Ma C. Salidroside suppressing LPS-induced myocardial injury by inhibiting ROS-mediated PI3K/Akt/mTOR pathway in vitro and in vivo. Journal of Cellular and Molecular Medicine. 2017;21(12):3178–3189. doi: 10.1111/jcmm.12871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Hao W., Yuan X., Yu L., et al. Licochalcone A-induced human gastric cancer BGC-823 cells apoptosis by regulating ROS-mediated MAPKs and PI3K/AKT signaling pathways. Scientific Reports. 2015;5(1, article 10336) doi: 10.1038/srep10336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Tarabees R., Hill D., Rauch C., Barrow P. A., Loughna P. T. Endotoxin transiently inhibits protein synthesis through Akt and MAPK mediating pathways in C2C12 myotubes. American Journal of Physiology-Cell Physiology. 2011;301(4):C895–C902. doi: 10.1152/ajpcell.00387.2010. [DOI] [PubMed] [Google Scholar]
  • 64.Jiang K., Zhang T., Yin N., et al. Geraniol alleviates LPS-induced acute lung injury in mice via inhibiting inflammation and apoptosis. Oncotarget. 2017;8(41):71038–71053. doi: 10.18632/oncotarget.20298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Cheng P., Wang T., Li W., et al. Baicalin alleviates lipopolysaccharide-induced liver inflammation in chicken by suppressing TLR4-mediated NF-κB pathway. Frontiers in Pharmacology. 2017;8:p. 547. doi: 10.3389/fphar.2017.00547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Karisnan K., Mahzabin T., Bakker A. J., et al. Gestational age at time of in utero lipopolysaccharide exposure influences the severity of inflammation-induced diaphragm weakness in lambs. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology. 2018;314(4):R523–R532. doi: 10.1152/ajpregu.00150.2017. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The raw data used to support the findings of this study are available from the corresponding author upon request.

Articles from Oxidative Medicine and Cellular Longevity are provided here courtesy of Wiley

RESOURCES