Abstract
We present raw sequence reads and genome assemblies derived from 17 accessions of the Ethiopian orphan crop plant enset (Ensete ventricosum (Welw.) Cheesman) using the Illumina HiSeq and MiSeq platforms. Also presented is a catalogue of single-nucleotide polymorphisms inferred from the sequence data at an average density of approximately one per kilobase of genomic DNA.
Specifications Table
| Subject area | Biology |
| More specific subject area | Genomics of crop plants |
| Type of data | Deoxyribonucleic acid (DNA) sequence |
| How data was acquired | Illumina HiSeq. 2500; Illumina MiSeq |
| Data format | Raw sequence reads; genome sequence assemblies |
| Experimental factors | Genomic DNA was extracted from a selection of 15 enset cultivars and two wild accessions |
| Experimental features | Genome sequencing |
| Data source location | Ethiopia |
| Data accessibility | Sequence data are available from the Sequence Read Archive via BioProjects PRJNA344540https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA344540, PRJNA342253https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA342253, PRJNA341828https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA341828, PRJNA252658https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA252658 |
Value of the data
-
•
Here we present the first genome-wide sequence data available for enset accessions cultivated or growing wild in Ethiopia.
-
•
There is potential to exploit genetic diversity (e.g. large numbers of single-nucleotide polymorphisms) to generate markers to assist enset selection for key agronomic traits.
-
•
Given the long lifespan of enset, patterns of genetic variation can be used to classify germplasm and to prioritise and select germplasm for use in breeding.
1. Data
The data presented here include enset genomic resequencing data, in the form of sequence reads generated using the Illumina massively parallel deoxyribonucleic acid (DNA) sequencing platform. Also included are draft genome assemblies, a catalogue of single-nucleotide polymorphisms (SNPs) inferred from the sequence data, and images of agarose gels containing results of genotyping assays for several SNPs. Enset (Ensete ventricosum (Welw.) Cheesman) is a perennial, herbaceous plant belonging to the same botanical family as bananas and plantains, namely the Musaceae [1]. Although it does not yield edible fruits, it is the most important cultivated staple food crop in the highlands of central, south and southwestern Ethiopia with cultural significance [2] as well as a key role in food security [3], [4]. The main food value is in the large starch-rich corm, which can be boiled and consumed in a similar manner to tubers such as potato or can be used to generate a fermented product known as kocho [3], [5], [6], [7], [8], [9].
Enset varieties display a great range of genetic and phenotypic variation [7], [10], [11], [12], [13], [14], [15], [16] (Fig. 1) and 15 phenotypic traits have been assayed for a collection of 387 enset accessions [17]. Integration of phenotypic measurements with genetic markers could be of great value in breeding improved varieties with enhanced resistance to abiotic and biotic stresses. Despite its importance for food security of millions in Ethiopia, enset has been relatively neglected in molecular research and few genomic resources are available. We previously published a first draft genome sequence of E. ventricosum [18], but the sequenced individual was obtained from the nursery trade (from the UK-based company Jungle Seeds) and its provenance is unknown and therefore its relevance to Ethiopian agriculture is uncertain. Its phylogenetic relationship with Ethiopian varieties is rather distant (Fig. 2), clustering much more closely with E. ventricosum e4 (GenBank: FJ428156.1) [19], whose provenance is also unknown. In contrast, the data presented here originate from enset accessions collected in Ethiopia. Most of these enset accessions are sourced from the germplasm collection of the Southern Agricultural Research Institute (SARI), with the exception of Bedadeti, which originated from the collection of the International Institute for Tropical Agriculture (IITA). The data presented here complement previously published genomic resequencing data from Ensete species: targetted sequencing of repeats in Ensete gilletii [20] and E. ventricosum variety Gena [21] and exon sequencing of Ensete superbum and E. ventricosum [22].
Fig. 1.
Phenotypic variation among sequenced accessions of E. ventricosum. Panels A, B and C shows cultivars Mazia, Lochingie and Nobo respectively.
Fig. 2.
Phylogenetic positions of the enset accessions sequenced here compared to that of the previously sequenced enset genome based on sequences of the trnF–trnT barcode voucher region of the chloroplast DNA. This locus has previously been used as a barcode and phylogenetic indicator and sequence data for this locus are available from previously published studies (Bekele and Shigeta, [36]; Li et al. [19]; Harrison et al. [18]). There was no sequence variation at this locus among the 17 genomes presented here, as judged by BWA alignments of raw sequence reads against trnF-trnT sequence. Thus, the branch indicated by the black circle represents the phylogenetic position of all 17 sequenced accessions. A black triangle highlights the position of the “Jungle Seeds” individual whose genome was previously sequenced. The Maximum Likelihood tree presented here is based on a multiple sequence alignment of trnF-trnT sequences generated using MUSCLE (Edgar, 2004). Evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura-Nei model (Tamura and Nei [37]). The tree with the highest log likelihood (-1249.11) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 32 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 666 positions in the final dataset. Evolutionary analyses were conducted in MEGA7 (Kumar et al. [38]).
2. Experimental design, materials and methods
Genomic DNA was extracted from the young emerging (cigar) leaves using a previously published mini-prep protocol [23]. Between 0.2 and 0.5 g of young and clean leaf was collected per plant and dried in silica gel. From these dried leaves 0.2 g was taken from each sample and ground with sterile pestle and mortar. Genomic DNA was isolated from about 0.2 g of pulverized leaf sample using a modified triple cetyltrimethyl ammonium bromide (CTAB) extraction technique [24]. The yield and quality of DNA were assessed by agarose gel electrophoresis and by a NanoDrop spectrophotometer (NanoDrop Technologies, Wilmington, Delaware) and quantified by Qubit broad range assay (Thermo Fisher Scientific). Illumina sequencing libraries were prepared, after fragmenting 500 ng of DNA to an average size of 500 bp, using Nextflex Rapid DNAseq kit for Illumina sequencing (Bioo Scientific) with adapters containing indexes and 5–8 cycles polymerase chain reaction (PCR) [25]. Library quality was determined using D1000 screen-tapes (Agilent) and libraries were either sequenced individually or combined in equimolar pools.
We sequenced the enset genomic DNA using a combination of Illumina [26], [27] MiSeq and/or Illumina HiSeq. 2500 in either normal or rapid-run modes, as detailed in Table 1. The 17 sequenced accessions included 15 distinct named varieties. We sequenced two different accessions for cultivar Mazia and two different accessions for cultivar Lochingie (a result of complex vernacular naming systems for enset landraces arising from multiple ethno-linguistic communities); one accession was sequenced for each of the other varieties. Raw sequence reads were submitted to the Sequence Read Archive (SRA) [28] under the accession numbers listed in Table 1.
Table 1.
Illumina sequencing of E. ventricosum accessions. Pairs of 100-bp reads were generated using the Illumina HiSeq. 2500 in normal mode except where indicated. A single asterisk (*) indicates use of the Illumina HiSeq. 2500 in rapid-run mode to generate pairs of 300-bp reads and two asterisks (**) indicate use of the Illumina MiSeq to generate pairs of 300-bp reads.
| SARI ID | Name | Collected from | Depth of coverage of genome | SRA accession numbers |
|---|---|---|---|---|
| 362 | Arkiya | Dawro | 7.36× | SRR4304969, SRR4304970 |
| 455 | Arkiya | Wolaita | 8.04× | SRR4304981*, SRR4304987 |
| 112 | Astara | Sidama | 15.64× | SRR4304989 |
| n/a | Bedadeti | Unknown | 45.81× | SRR1515268, SRR1515269** |
| 406 | Buffero | West Arsi | 18.25× | SRR4304990 |
| 435 | Derea | Gurage | 18.43× | SRR4308285, SRR4308286 |
| 451 | Erpha 13 | Dawro | 9.21× | SRR4304991*, SRR4304992 |
| 449 | Erpha 20 | Dawro | 9.43× | SRR4304971, SRR4304993* |
| 221 | Lochingie | Dawro | 8.86× | SRR4304972*, SRR4304973 |
| 253 | Lochingie | Wolaita | 8.66× | SRR4304974*, SRR4304975 |
| 208 | Mazia | Wolaita | 7.00× | SRR4304976*, SRR4304977 |
| 429 | Mazia | Dawro | 8.24× | SRR4304978*, SRR4304979 |
| 39 | Nechuwe | Gurage | 20.69× | SRR4304982 |
| 49 | Nobo | Sheka | 17.16× | SRR4304983 |
| 170 | Onjamo | Kembata-Tembaro | 21.75× | SRR4308284 |
| 183 | Siyuti | Wolaita | 16.54× | SRR4304984 |
| 54 | Yako | Kaffa | 17.96× | SRR4304985 |
Prior to further analysis, sequence reads were trimmed and filtered using TrimGalore with options “-q 30 --paired”. We performed de novo sequence assembly for sequence reads from Bedadeti, Derea and Onjamo (Table 2). For Bedadeti, we used St. Petersburg genome assembler (SPAdes) v. 3.6.1 [29] to assemble contigs and then scaffolded these using Short Sequence Assembly by progressive K-mer search and 3′ read Extension (SSAKE)-based Scaffolding of Pre-Assembled Contigs after Extension (SSPACE) v. 3.0 [30]. For Onjamo, we generated contigs and scaffolds using SPAdes v. 3.9.0 and for Derea generated contigs only using SPAdes v. 3.9.0. SPAdes assemblies were performed using the “--careful” option.
Table 2.
Assembly statistics for E. ventricosum genomes.
| GenBank accession number | Enset accession | Total length (bp) | Contig N50 (bp) | Scaffold N50 (bp) |
|---|---|---|---|---|
| GCA_000818735.2 | Bedadeti | 451,284,018 | 20,943 | 21,097 |
| GCA_001884805.1 | Derea (435) | 429,479,738 | 10,278 | n.d. |
| GCA_001884845.1 | Onjamo (170) | 444,841,970 | 15,546 | 16,208 |
We identified single-nucleotide polymorphisms by alignment against the reference genome sequence, according to the following procedure. After trimming and filtering with TrimGalore, sequence reads were aligned against the Bedadeti reference genome sequence (GenBank: GCA_000818735.2) using Burrows-Wheeler Aligner (BWA) mem [31], [32] version 0.7.15-r1140 with default options and parameter values.
Candidate SNVs were identified using Sequence Alignment/Map tools (SAMtools)/binary call format tools (BCFtools) package [33], version 1.6, using the following command-lines:
samtools mpileup -u -f genome.fasta alignment.bam > alignment.bcf and.
bcftools call -m -v --Ov alignment.bcf > alignment.vcf
The candidate variants were then filtered using the following command line:
bcftools filter --SnpGap 100 --include '(REF="A" | REF="C" | REF="G" | REF="T") & %QUAL>=35 & MIN(IDV)>=2 & MIN(DP)>=5 & INDEL=0' alignment.vcf > alignment.filtered.vcf
This filtering step eliminates indels with low-confidence single-nucleotide variant calls. It also eliminates candidate SNVs within 10 base pairs of an indel, since alignment artefacts are relatively common in the close vicinity of indels.
Allele frequencies at each SNP site were estimated from frequencies of each base (adenine (A), cytosine (C), guanine (G) or thymine (T)) among the aligned reads. Thus, we would expect an allele frequency of close to zero or one for homozygous sites and approximately 0.5 for heterozygous sites in a diploid genome. The binary alignment/map (BAM)-formatted BWA-mem alignments were converted to pileup format using the samtools mpileup command in SAMtools [33] version 1.6 with default options and parameter values. From the resulting pileup files, we used a custom Perl script (included in Supplementary material) to detect SNPs. For SNP detection, we considered only sites where depth of coverage by aligned reads was at least 5× for all 17 datasets. The distribution of a random sample of variants across the 17 accessions is summarized in Fig. 3.
Fig. 3.
Overview of genetic variation in the sequenced E. ventricosum genomes. Each column in the heat-map represents one of 20,000 single-nucleotide variant sites. Each row represents one of the sequenced genomes. Colour indicates the relative frequency of aligned sequence reads with the variant nucleotide at that site in that genome, on a yellow-orange-red palette. Thus, heterozygous sites would be expected to be orange, while homozygous sites would be yellow (same as Bedadeti reference genome sequence) or red (variant from the Bedadeti reference genome sequence). These frequency values were inferred from mpileup-formatted files, generated by aligning genomic sequence reads against the Bedadeti reference genome sequence. The Perl script used to extract these from the mpileup files is included in the Supplementary Material.
The identification of relatively high-confidence SNPs, distributed throughout the genome at a density of approximately one SNP per kilobase, provides the possibility to develop markers that could be used for genotyping large numbers of plant accessions without the need for large-scale sequencing. One straightforward approach is polymerase chain reaction restriction fragment digest polymorphism (PCR-RFLP) [34]. Another is co-dominant amplified polymorphism (CAPS) [35]. In the PCR-RFLP assay, oligonucleotide primers are designed to amplify a PCR product that flanks a SNP that falls within the recognition site for a restriction enzyme such that one variant is cleavable by the restriction enzyme whilst the other variant is not. Thus, by examining the pattern of bands in agarose electrophoresis of the product after restriction digestion, it is possible to assess the genotype at that SNP location. As a proof of principle, we designed 22 pairs of oligonucleotide primers targeting SNPs identified from the genome sequencing data; these are listed in Table 3. We applied 5 of these assays to several hundred E. ventricosum accessions; agarose gels showing the products of digesting the PCR products can be found in the Supplementary material.
Table 3.
Oligonucleotide primers for PCR-RFLP genotyping assays.
| No. | Forward and reverse primer sequences | PCR product size (bp) | Restriction enzyme | Genomic coordinates of PCR target (GenBank accession number: start-end) | Corresponding location in banana genome |
|---|---|---|---|---|---|
| 1 | TAGACTGCCAAGAGACTGCC, GAGTTTGTTCTCCACTTGCTG | 395 | EcoRV | JTFG02000023: 86778–87172 | Chromosome 9 |
| 2 | CAATGAAATGAGCTCTCGAATGA, CCTCCCTCCCTCTACACAAG | 453 | ClaI | JTFG02000451: 2383–2835 | Chromosome 3 |
| 3 | AGCTGCCTACTTATGTGCCA, AGGATGGGAGGATTTCACTCA | 296 | ClaI | JTFG02001079: 44094–44389 | No match |
| 4 | GAAAGATTCAACCACGCAACA, CAAAGTTGCCCAAATAATAGGGG | 100 | HindIII | JTFG02001701: 16598–16697 | Chromosome 9 |
| 5 | ACGTAGGAAACAGAAGGCGT, AGAATGAAAACCGGACAGATGA | 400 | BglII | JTFG02004430: 21696–22095 | Chromosome 10 |
| 6 | GACCAAGGTTGCAACGATGT, AACTCCCTAAAGTGGACCCG | 296 | HindIII | JTFG02004708: 2865–3160 | No match |
| 7 | TGCCAATTGTAGCACGCTTT, TCCCAATGATCAGGATGTCATC | 321 | BglII | JTFG02007725: 4758–5078 | Chromosome 4 |
| 8 | AGCTGATCGGTAGGCTGTTT, TGTTCACTTGCTCAACTTCAATG | 329 | EcoRV | JTFG02008123: 5568–5896 | Chromosome 4 |
| 9 | CGAAGGAACAAGAGGACGT, CGGCATGAACTAACCGCTTA | 380 | BglII | JTFG02010045: 2436–2815 | No match |
| 10 | AGAGTAGAGGTCAGCGCATC, AGGCGAGTGACTAAAGTGCT | 385 | HindIII | JTFG02015245: 4512–4896 | No match |
| 11 | GTCATGTAGAATTCAAAAGCCCA, ACCCATGACCAAGACTTTTCT | 458 | ClaI | JTFG02000797: 35394–35851 | Chromosome 10 |
| 12 | GCAGAATCCCGTGAACCATC, TGTAAGTTTCTTCTCCTCCGCT | 377 | BglII | JTFG02001387: 44650–45026 | Chromosome 10 |
| 13 | TGCTTTAACCTAGTGAGCTACAA, ACGTCGCCCTTTTACTTTTCT | 400 | BamHI | JTFG02001793: 29736–30135 | Chromosome 7 |
| 14 | GCCCATGCCATTCTTAAGGA, TCCAATTCCATCCTTCTTCATCT | 398 | BglII | JTFG02003127: 17456–17853 | Matches multiple chromosomes |
| 15 | ACTACACAATCCTGGTCCAAAA, CGTAGTTTCCGCCCTTTGAG | 113 | EcoRV | JTFG02004277: 15220–15332 | Chromosome 5 |
| 16 | CCTGGTTGAGAATGCGGATG, CGACCAATTACACTAAGCCCA | 419 | BglII | JTFG02006088: 4069–4489 | Matches several chromosomes |
| 17 | TCCAGCCCAACAATTGATTCTT, CTGAACCTCGGCCAACCT | 400 | ClaI | JTFG02006206: 13985–14384 | Matches several chromosomes |
| 18 | TGCCAACCGAACCTCTCAG, TCAGCCATCTACGACATTTACA | 400 | PstI | JTFG02010369: 10275–10674 | No match |
| 19 | TGCTTACTGACTATGGAGAGCT, TGCCTGTTTGAGTCCATATAAGT | 487 | BamHI | JTFG02011833: 6273–6759 | Matches several chromosomes |
| 20 | CTCGTTAAGGTTCCCCATGC, CCAGCGTGGGAGATCTTTTG | 452 | EcoRV | JTFG02024842: 425–876 | No match |
| 21 | CGAGGGCTTCATCGAAAAGG, GCTGCCGACGAGTTGTTC | 391 | BamHI | JTFG02043259: 629–1019 | No match |
| 22 | CGATCGTTACGTTGCTTCAG, GGAGCCACAACCAACCAATT | 446 | PstI | JTFG02009519: 11979–12424 | No match |
Acknowledgements
The authors are grateful to Satish Kulasakaran, John Sidda and Joana Furtardo at the University of Warwick for assistance with PCR-RFLP assays and to James Harrison at the University of Exeter for assistance with handling Bedadeti genomic DNA. Zerihun Yemataw was supported by the McKnight Foundation. Murray Grant was supported by the Biotechnology and Biological Sciences Research Council (BBSRC) BBSRC IAA award BB/GCRF-IAA/22. DNA sequencing was performed using the Exeter Sequencing Service and Computational core facilities at the University of Exeter, which are supported by a Medical Research Council Clinical Infrastructure award (MR/M008924/1), a Wellcome Trust Institutional Strategic Support Fund (WT097835MF), a Wellcome Trust Multi User Equipment Award (WT101650MA) and a BBSRC LOLA award (BB/K003240/1). David Studholme is supported by The European Community Horizon 2020 grant Project ID 727624, “Microbial uptakes for sustainable management of major banana pests and diseases (MUSA)”.
Footnotes
Supplementary data associated with this article can be found in the online version at doi:10.1016/j.dib.2018.03.026.
Supplementary data associated with this article can be found in the online version at doi:10.1016/j.dib.2018.03.026.
Transparency document. Supplementary material
Supplementary material
.
Appendix A. Supplementary material
Supplementary material
.
Supplementary material
.
Supplementary material
.
Supplementary material
.
Supplementary material
.
Supplementary material
.
References
- 1.Cheesman E. Classification of the bananas: the Genus Ensete Horan. Kew Bull. 1947;2:97–106. [Google Scholar]
- 2.Tsehaye Y., Kebebew F. Diversity and cultural use of enset (Enset ventricosum (Welw.) Cheesman) in Bonga in-situ Conservation Site, Ethiopia. Ethnobot. Res. Appl. 2006;4:147. [Google Scholar]
- 3.Brandt S.A., Spring A., Hiebsch C., McCabe J.T., Tabogie E., Diro M., Wolde-Michael G., Yntiso G., Shigeta M., Tesfaye S. The “Tree Against Hunger” Enset-based agricultural systems in Ethiopia. Am. Assoc. Adv. Sci. 1997 〈http://www.aaas.org/international/africa/enset/〉 [Google Scholar]
- 4.Negash A., Niehof A. The significance of enset culture and biodiversity for rural household food and livelihood security in southwestern Ethiopia. Agric. Human. Values. 2004;21:61–71. [Google Scholar]
- 5.Yirmaga M.T. Improving the indigenous processing of kocho, an Ethiopian traditional fermented food. J. Nutr. Food Sci. 2013;3:1–6. [Google Scholar]
- 6.Bosha A., Dalbato A.L., Tana T., Mohammed W., Tesfaye B., Karlsson L.M. Nutritional and chemical properties of fermented food of wild and cultivated genotypes of enset (Ensete ventricosum) Food Res. Int. 2016;89:806–811. doi: 10.1016/j.foodres.2016.10.016. [DOI] [PubMed] [Google Scholar]
- 7.Tobiaw Analysis of genetic diversity among cultivated enset (Ensete ventricosum) populations from Essera and Kefficho, southwestern part of Ethiopia using inter simple sequence repeats (ISSRs) marker. Afr. J. Biotechnol. 2011;10:15697–15709. [Google Scholar]
- 8.Pijls L.T.J., Timmer A.A.M., Wolde-Gebriel Z., West C.E., Pijls C.E., Ainoid T., J., timmer A.M., Wolde-Gwbriel Zewdie. Cultivation, preparation and consumption of ensete (Ensete ventricosum) in Ethiopia. J. Sci. Food Agric. 1995;67:1–11. [Google Scholar]
- 9.Bezuxeh T., Feleke A. The production and utilization of the Genus Ensete in Ethiopia. Econ. Bot. 1966 〈http://www.springerlink.com/index/k96280651m27x672.pdf〉 (Accessed 30 July 2013) [Google Scholar]
- 10.Tesfaye B., Lüdders P. Diversity and distribution patterns of enset landraces in Sidama, Southern Ethiopia. Genet. Resour. Crop Evol. 2003:359–371. 〈http://link.springer.com/article/〉 (Accessed 12 July 2013) [Google Scholar]
- 11.Birmeta G., Nybom H., Bekele E. RAPD analysis of genetic diversity among clones of the Ethiopian crop plant Ensete ventricosum. Euphytica. 2002;124:315–325. 〈http://link.springer.com/article/〉 (Accessed 19 October 2013) [Google Scholar]
- 12.Birmeta G., Nybom H., Bekele E. Distinction between wild and cultivated enset (Ensete ventricosum) gene pools in Ethiopia using RAPD markers. Hereditas. 2004;140:139–148. doi: 10.1111/j.1601-5223.2004.01792.x. [DOI] [PubMed] [Google Scholar]
- 13.Tesfaye B. On Sidama folk identification, naming, and classification of cultivated enset (Ensete ventricosum) varieties. Genet. Resour. Crop Evol. 2008;55:1359–1370. [Google Scholar]
- 14.Z. Yemataw, H. Mohamed, M. Diro, T. Addis, G. Blomme, Genetic Variability, Inter-Relationships and Path Analysis in Enset ( Ensete ventricosum) Clones, 2012.
- 15.Yemataw Z., Mohamed H., Diro M., Addis T., Blomme G. Ethnic-based diversity and distribution of enset (Ensete ventricosum) clones in southern Ethiopia. J. Ecol. Nat. Environ. 2014;6:244–251. [Google Scholar]
- 16.Zippel K. Springer; US, Boston, MA: 2005. Diversity Over Time and Space in Enset Landraces (Ensete Ventricosum) in Ethiopia, in: African Biodivers; pp. 423–438. [Google Scholar]
- 17.Yemataw Z., Chala A., Ambachew D., Studholme D.J., Grant M., Tesfaye K. Morphological variation and inter-relationships of quantitative traits in enset (Ensete ventricosum (Welw.) Cheesman) germplasm from south and south-western Ethiopia. Plants. 2017;6:56. doi: 10.3390/plants6040056. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Harrison J., Moore K., Paszkiewicz K., Jones T., Grant M., Ambacheew D., Muzemil S., Studholme D. A draft genome sequence for Ensete ventricosum, the drought-tolerant “Tree Against Hunger”. Agronomy. 2014;4:13–33. [Google Scholar]
- 19.Li L.-F., Häkkinen M., Yuan Y.-M., Hao G., Ge X.-J. Molecular phylogeny and systematics of the banana family (Musaceae) inferred from multiple nuclear and chloroplast DNA fragments, with a special reference to the genus Musa. Mol. Phylogenet. Evol. 2010;57:1–10. doi: 10.1016/j.ympev.2010.06.021. [DOI] [PubMed] [Google Scholar]
- 20.Novák P., Hřibová E., Neumann P., Koblížková A., Doležel J., Macas J. Genome-wide analysis of repeat diversity across the family Musaceae. PLoS One. 2014;9:e98918. doi: 10.1371/journal.pone.0098918. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Olango T.M., Tesfaye B., Pagnotta M.A., Pè M.E., Catellani M. Development of SSR markers and genetic diversity analysis in enset (Ensete ventricosum (Welw.) Cheesman), an orphan food security crop from Southern Ethiopia. BMC Genet. 2015;16:98. doi: 10.1186/s12863-015-0250-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Sass C., Iles W.J.D., Barrett C.F., Smith S.Y., Specht C.D. Revisiting the Zingiberales: using multiplexed exon capture to resolve ancient and recent phylogenetic splits in a charismatic plant lineage. Peer J. 2016;4:e1584. doi: 10.7717/peerj.1584. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Doyle J., Doyle J. Isolation of plant DNA from fresh tissue. Focus (Madison) 1990;12:13–15. [Google Scholar]
- 24.Borsch T., Hilu K.W., Quandt D., Wilde V., Neinhuis C., Barthlott W. Noncoding plastid trnT-trnF sequences reveal a well resolved phylogeny of basal angiosperms. J. Evol. Biol. 2003;16:558–576. doi: 10.1046/j.1420-9101.2003.00577.x. [DOI] [PubMed] [Google Scholar]
- 25.Head S.R., Komori H.K., LaMere S.A., Whisenant T., Van Nieuwerburgh F., Salomon D.R., Ordoukhanian P. Library construction for next-generation sequencing: overviews and challenges. Biotechniques. 2014;56 doi: 10.2144/000114133. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Holt R. a, Jones S.J.M. The new paradigm of flow cell sequencing. Genome Res. 2008;18:839–846. doi: 10.1101/gr.073262.107. [DOI] [PubMed] [Google Scholar]
- 27.Mardis E.R. Next-generation sequencing platforms. Annu. Rev. Anal. Chem. 2013;6:287–303. doi: 10.1146/annurev-anchem-062012-092628. [DOI] [PubMed] [Google Scholar]
- 28.Leinonen R., Sugawara H., Shumway M. The sequence read archive. Nucleic Acids Res. 2011;39:D19–D21. doi: 10.1093/nar/gkq1019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Bankevich A., Nurk S., Antipov D., Gurevich A. a, Dvorkin M., Kulikov A.S., Lesin V.M., Nikolenko S.I., Pham S., Prjibelski A.D., Pyshkin A.V., Sirotkin A.V., Vyahhi N., Tesler G., Alekseyev M.A., Pevzner P.A. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012;19:455–477. doi: 10.1089/cmb.2012.0021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Boetzer M., Henkel C.V., Jansen H.J., Butler D., Pirovano W. Scaffolding pre-assembled contigs using SSPACE. Bioinformatics. 2011;27:578–579. doi: 10.1093/bioinformatics/btq683. [DOI] [PubMed] [Google Scholar]
- 31.H. Li, Aligning Sequence Reads, Clone Sequences and Assembly Contigs with BWA-MEM3. 〈http://arxiv.org/abs/1303.3997〉 (Accessed 20 July 2014), 2013.
- 32.Li H., Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009;25:1754–1760. doi: 10.1093/bioinformatics/btp324. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Li H., Handsaker B., Wysoker A., Fennell T., Ruan J., Homer N., Marth G., Abecasis G., Durbin R. 1000 genome project data processing subgroup, the sequence alignment/map format and SAMtools. Bioinformatics. 2009;25:2078–2079. doi: 10.1093/bioinformatics/btp352. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Pourzand C., Cerutti P. Genotypic mutation analysis by RFLP/PCR. Mutat. Res. 1993;288:113–121. doi: 10.1016/0027-5107(93)90213-y. 〈http://www.ncbi.nlm.nih.gov/pubmed/7686255〉 [DOI] [PubMed] [Google Scholar]
- 35.Konieczny A., Ausubel F.M. A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers. Plant J. 1993;4:403–410. doi: 10.1046/j.1365-313x.1993.04020403.x. [DOI] [PubMed] [Google Scholar]
- 36.Bekele E., Shigeta M. Genet. Resour. Crop Evol. 2011;58:259. [Google Scholar]
- 37.Tamura K., Nei M. Estimation of the number of nucleotide substitutions in thecontrol region of mitochondrial DNA in humans and chimpanzees. Mol. Biol.Evol., 1993;10:512–526. doi: 10.1093/oxfordjournals.molbev.a040023. [DOI] [PubMed] [Google Scholar]
- 38.Kumar S., Stecher G. K. Tamura, MEGA7: Molecular Evolutionary Genetics AnalysisVersion 7.0 for Bigger Datasets. Mol. Biol. Evol., 2016;33:1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary material
Supplementary material
Supplementary material
Supplementary material
Supplementary material
Supplementary material
Supplementary material



