Abstract
Background
Abscisic acid (ABA) is a well-studied phytohormone demonstrated to be involved in sub-sets of stress responses in plants, such as iron (Fe) deficiency and phosphorus (P) deficiency in Arabidopsis. However, whether ABA is involved in P deficiency in rice has not been frequently studied. The present study was undertaken to investigate the mechanism underlying ABA-aggravated P deficiency in rice (Oryza sativa).
Results
P deficiency decreased ABA accumulation rapidly (within 1 h) in the roots. Exogenous ABA negatively regulated root and shoot soluble P contents by decreasing pectin content, inhibiting P deficiency-induced increases in pectin methylesterase activity and expression of the phosphate transporter gene-OsPT6, thereby decreasing the re-utilization of P from the cell wall and its translocation to the shoot. Moreover, neither the nitric oxide (NO) donor sodium nitroprusside nor ethylene precursor 1-aminocyclopropane-1-carboxylic acid had any effect on ABA accumulation, and application of ABA or the ABA inhibitor fluridone also had no effect on NO production and ethylene emission.
Conclusions
Under P deficiency, NO levels increase as quickly as ABA levels decrease, to inhibit both the ABA-induced reduction of pectin contents for the re-utilization of cell wall P and the ABA-induced down-regulation of OsPT6 for the translocation of P from roots to shoots. Overall, our results provide novel information indicating that the reduction of ABA under P deficiency is a very important pathway in the re-utilization of cell wall P in rice under P-deficient conditions, which should be a very effective mechanism for plant survival under P deficiency stress for common agronomic practice.
Keywords: ABA, cell wall, ethylene, NO, OsPT6, phosphorus, remobilization, translocation, rice
INTRODUCTION
As a macronutrient that is essential for plants, phosphorous (P) plays crucial roles in many developmental and metabolic processes (Plaxton and Tran, 2011). For instance, P acts as a structural component of nucleic acids/membranes, is a pivotal component of energy metabolism, and plays a central role in signal transduction cascades (Poirier and Bucher, 2002). Despite large reserves of P in natural soil, the bioavailability of inorganic phosphate (Pi) is very low because the available Pi constitutes only 20–50 % of total soil P and the rest is fixed into poorly soluble salts, such as iron/aluminium salts in acid soils and magnesium/calcium salts in alkaline soils (Raghothama, 1999; Wu et al., 2013; Bhadouria et al., 2017). Therefore, P deficiency is a common agricultural trait that affects the growth and production of crops (Chiera et al., 2002). To improve plant P nutrition, P fertilizer is applied. However, as the primary source of P fertilizer, Pi rock, is a non-renewable and finite resource (Beardsley, 2011), basic research aimed at improving P efficiency in plants or developing P-efficient transgenic crops is needed.
The general responses of plants to P deficiency include a multifaceted set of strategies, such as morphological changes in the root system, physiological changes in root exudates and molecular regulation of gene expression (Mehra et al., 2016). For instance, P starvation of plants increases the root-to-shoot ratio (Nacry et al., 2005), the ratio of root branches to hairs (Lopez-Bucio et al., 2003), the formation of ‘root clusters’ (Vance, 2008) and symbiosis with mycorrhizal fungi (Boulet and Lambers, 2005). Plants also secrete organic anions (Raghothama, 1999), mucilage (Grimal et al., 2001), phenolics (Juszczuk et al., 2004), ribonucleases (RNase) (Taylor et al., 1993) and acid phosphatases (Wasaki et al., 2003; Mehra et al., 2017; Pandey et al., 2017) to change the physical and chemical properties of the soil, thus accelerating the liberation of Pi from the soil and allowing it to be taken up by plants through the regulation of a large number of P-responsive genes (Morcuende et al., 2007; Secco et al., 2013). Recently, accumulating evidence has demonstrated that cell wall metabolic pathways are another important strategy for the re-utilization of internal P by plants (X. Zhu et al., 2015, 2017b). Pectin plays a pivotal role in this mechanism through competition with iron (Fe) from FePO4 to release cell wall insoluble P under P-starved conditions.
It has been well documented that numerous phytohormones and signalling molecules are involved in the responses to P deficiency in plants, including auxin (Ribot et al., 2008; Wang et al., 2014a), ethylene (Tanimoto et al., 1995; X. Zhu et al., 2016b, 2017b), nitric oxide (NO) (B. Wang et al., 2010; C. Zhu et al., 2016a; X. Zhu et al., 2017b) and abscisic acid (ABA) (Vysotskaya et al., 2016; Yu et al., 2016). ABA is a well-studied phytohormone involved in a sub-set of stress responses in plants, such as drought and high salt stress (Cutler et al., 2010), Fe deficiency in Arabidopsis (Lei et al., 2014; X. Zhu et al., 2017a), Fe toxicity in African rice (Oryza glaberrima Steud.) (Majerus et al., 2009) and P deficiency in Arabidopsis (Yu et al., 2016). However, whether ABA is involved in P deficiency in rice and the balance between different phytohormones that may also be responsible for the control of P nutrition in P-starved plants has not been frequently studied (Niu et al., 2013).
Here, we investigated the effect of ABA on the P-deficient rice cultivar ‘Nipponbare’. We demonstrate that P deficiency decreased root ABA accumulation, and exogenous ABA aggravated P deficiency by inhibiting P remobilization from root cell walls and translocation to the shoots. Moreover, an ABA regulatory mechanism for cell wall P re-utilization under P-deficient conditions in rice that may independent of NO and ethylene was elucidated.
METHODS
Plant materials and growth conditions
Seeds of the rice cultivar ‘Nipponbare’ (Nip, Oryza sativa) were used in this study. After immersion in deionized water for 2 d, the seeds were washed and grown on a plastic supporting net (approx. 2 mm2) in a 1.25-litre plastic container filled with 0.5 mm CaCl2 (pH 5.6) for another 2 d. Then, full-strength Kimura B solution (consisting of 405 mg L–1 MgSO4.7H2O, 114.25 mg L–1 NH4NO3, 110.75 mg L–1 CaCl2, 89.25 mg L–1 K2SO4, 50.375 mg L–1 NaH2PO4.2H2O, 46.53 mg L–1 EDTA-Na2, 34.75 mg L–1 FeSO4.7H2O, 1.875 mg L–1 MnCl2.4H2O, 1.1675 mg L–1 H3BO3, 0.0925 mg L–1 (NH4)6Mo7O24, 0.04375 mg L–1 ZnSO4.7H2O and 0.03875 mg L–1 CuSO4) was applied instead of the above CaCl2 solution. The cultivation conditions were controlled, with a light intensity of 400 µmol m−2 s−1, a relative humidity of 60 % and a day/night regime of 14/10 h.
To study the possible interactions between NO, ABA and ethylene in P-deficient rice, 2-week-old seedlings were transferred to +P, +P + ABA, +P + fluridone (Flu), −−P, −P + ABA and −P + Flu treatments for 7 d for the measurement of NO contents and ethylene production. For the measurement of ABA contents, 2-week-old seedlings were transferred to the following treatments for 7 d: +P, +P + sodium nitroprusside (SNP), +P + 1-aminocyclopropane-1-carboxylic acid (ACC), −P, −P + SNP and −P + ACC. For the experiments involving the pH-buffered solution, 10 mm MES was added to each of the above nutrient solutions (+P, +P + ABA, −P and −P + ABA). The final concentrations in the above treatments were 1 μm ACC, 0.5 μm ABA, 2.5 μm SNP and 0.001 μm Flu. The Pi concentrations in sufficient (+P) and deficient (−P) media were 50.375 and 0 mg L–1, respectively. As SNP was applied as a pretreatment, the nutrient solution was renewed after 24 h with P-deficient or P-sufficient solutions containing the other substances for another 6 d. All pH levels were adjusted to 5.6, and the solutions were renewed every 3 d.
Measurement of soluble Pi contents
After treatment, roots and shoots were first harvested and then washed with deionized water three times. The samples were subsequently weighed, ground in liquid nitrogen and suspended in 4 mL of deionized water containing 200 µL of sulphuric acid (5 m). Finally, after centrifugation at 12 000g for 10 min, 400 µL of the supernatant was incubated with 200 µL of ammonium molybdate containing 15 % fresh ascorbic acid (pH 5.0) for 30 min. The resultant absorption values were determined with a spectrophotometer at 650 nm.
Cell wall extraction
After the root samples were ground with liquid nitrogen, 8 mL of ethanol was added to wash the samples for 20 min. Then, after the addition of 8 mL of acetone, 8 mL of 1: 1 methanol/chloroform and 8 mL of methanol were added to wash the samples. The pellets were subsequently dried with a freeze dryer and stored at 4 °C for further use (Zhong and Lauchli, 1993).
Extraction of pectin
Pectin was extracted as follows: cell wall materials were weighed, incubated with 1 mL of deionized water at 100 °C for 1 h and then centrifuged at 13 200 rpm for 10 min to collect the supernatant, which was finally referred to as pectin after repeating this procedure three times.
Measurement of pectin contents and pectin methylesterase (PME) activity
The uronic acid content of pectin is an indicator of the pectin content in the cell wall. In brief, 200 µL of pectin was mixed with 1 mL of 98 % H2SO4 containing 12.5 mm Na2B4O7.10H2O at 100 °C for 5 min. Then, 20 µL of 0.15 % M-hydro-diphenyl was added after the solution had cooled. The resultant absorption values were determined with a spectrophotometer at 520 nm.
For PME activity analysis, cell walls were first weighed and then shaken with a 1 m NaCl solution (pH 6.0) at 4 °C for 1 h. After centrifugation at 13 200 rpm for 10 min, 50 µL of the supernatant was collected for further incubation with alcohol oxidase (10 µL) and 200 mm PBS (100 µL, which contained 0.64 mg mL−1 pectin) at 30 °C for 10 min. Finally, 200 µL of 0.5 m NaOH containing 5 mg mL−1 purpald was added, and the absorbance was determined with a spectrophotometer at 550 nm.
Measurement of cell wall P retention
P retention in the cell wall was examined as follows: cell wall materials were weighed and then shaken with 1 mL of 2 m HCl for 24 h, and the supernatant was collected after centrifugation for the measurement of P contents (X. Zhu et al., 2015).
Measurement of root NO contents
Root NO accumulation was tested using 4-amino-5-methylamino-2,7-difluorofluorescein diacetate (DAF-FM DA; 10 μm). The apical portions of the roots (approx. 1 cm) were first detached and then washed with Hepes-KOH (pH 7.4) for 15 min. After the samples were incubated with 500 µL of DAF-FM DA in darkness for 30 min, the excess fluorescent dye was removed by washing with fresh buffer three times. Finally, NO fluorescence was visualized with a Nikon Eclipse 80i light microscope, and the intensity of this fluorescence was determined using Photoshop 7.0 software (X. Zhu et al., 2012).
Measurement of ethylene production
The production of ethylene by the roots was analysed according to Wu et al. (2011). In brief, the roots were first cut and then transferred to 15-mL glass phials containing 1 mL of distilled water, which were immediately sealed with a rubber stopper. After incubation in darkness at 30 °C for 2 h, the production of ethylene was measured according to X. Zhu et al. (2016b).
Measurement of ABA contents
Root ABA contents were analysed as described by Ding et al. (2011). In brief, the roots were first cut and then washed three times with deionized water. After grinding in liquid nitrogen, the samples were homogenized with 90 % (v/v) methanol containing 200 mg L−1 diethydithiocarbamic acid sodium salt, according to the procedures specified in the ELISA kit (MALLBIO lot: MBE21031).
Quantitative real-time PCR analysis
After treatment, the roots were harvested and immediately transferred to liquid nitrogen. The extraction of RNA and its reverse transcription were performed according to the operations manual supplied by TianGen (http://www.tiangen.com/en/; Shanghai, China). The quality of the RNA and cDNA was verified via agarose gel electrophoresis. The mixture used for the real-time PCR was made of 0.01 µg µL–1 cDNA, 0.2 µm each primer (forward and reverse) and 5 µL of SYBR Premix ExTaq (Takara; Code No. RR420A). Each sample was run in triplicate. The primers used for these experiments are shown in Table 1 (Ai et al., 2009; Jia et al., 2011).
Table 1.
Gene-specific primers used in this work.
| Gene | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| OsPT2 | GACGAGACCGCCCAAGAAG | TTTTCAGTCACTCACGTCGAGAC |
| OsPT6 | TATAACTGATCGATCGAGACCAGAG | TGGATAGCCAGGCCAGTTATATATC |
| OsPT8 | AGAAGGCAAAAGAAATGTGTGTTAAAT | AAAATGTATTCGTGCCAAATTGCT |
| OsHISTONE H3 | GGTCAACTTGTTGATTCCCCTCT | AACCGCAAAATCCAAAGAACG |
| OsIPS1 | AAGGGCAGGGCACACTCCACATTATC | ATTAGAGCAAGGACCGAAACACAAAC |
| OsIPS2 | CCTTCTTCTGGATTCCTCTC | AGTTCACCACAAAAGATACAGTAG |
| OsSPX1 | GACCAGCTTCTACCATCAAACG | AGTTCCTGCTGCTCCTCTGG |
| OsSPX3 | TGCAGTCCATCCGATCCG | ATGTGTATGTATGTTCTCTACCACG |
Statistical analyses
All experiments were conducted at least in triplicate. One-way ANOVA was used to analyse the data, and the mean values were compared using Duncan’s multiple range test. The letters in the figures presented here indicate that the mean values were significantly different at P < 0.05.
RESULTS
To investigate whether ABA metabolism is involved in rice P re-utilization, we performed experiments using a typical Japonica variety, ‘Nipponbare’ (Nip), and found that P deficiency initially decreased ABA accumulation (Fig. 1A). Further analysis showed that the reduction in ABA content could be detected within 1 h after seedlings were transferred to a nutrient solution lacking P (Fig. 1B). Therefore, it is clear that P deficiency can rapidly decrease the endogenous ABA level in rice roots.
Fig. 1.
Effect of P deficiency on ABA accumulation in roots. Seedlings were subjected to long-term (7 d, A) or short-term (1–12 h, B) treatment in a P-deficient solution. Error bars represent ±s.d. (n = 4). Different letters represent significant differences at P < 0.05. FW: fresh weight.
To explore the possible role of ABA in rice in response to P deficiency, 2-week-old seedlings were transferred to +P and −P nutrient solutions containing 0.5 µm ABA or 0.001 µm Flu, the latter acting as an inhibitor in the synthesis of ABA (Yoshioka et al., 1998). After 7 d of −P treatment, the root and shoot soluble P contents were significantly decreased, and this severe reduction of P content induced by −P treatment could be further aggravated by ABA addition (Fig. 2A, B), indicating that ABA may have negative roles in internal P re-utilization in rice. This hypothesis was further confirmed by the addition of Flu (Fig. 2C, D), which resulted in the opposite tendency compared with ABA. In addition, exogenous ABA and Flu did not affect the root and shoot soluble P contents under +P conditions (Fig. 2). Furthermore, when the solution was buffered at pH 5.6 with MES, the root and shoot soluble P contents showed no significant difference from those in the non-buffered solution (Supplementary Data Fig. S1), suggesting that the effect of ABA observed in the present study was not due to the lower pH content of the solution, but to the synergetic action of ABA and −P. Moreover, the expression of OsIPS1, OsIPS2, OsSPX1 and OsSPX3, which are marker genes of P deficiency in rice, were all up-regulated under −P + ABA treatment compared with −P treatment alone (Supplementary Data Fig. S2), further indicating that ABA can aggravate P deficiency in rice.
Fig. 2.
Effect of ABA on root (A) and shoot (B) soluble P contents and effect of Flu on root (C) and shoot (D) soluble P contents under +P or −P conditions. Data are means ± s.d. (n = 4). Columns with different letters show significant differences at P < 0.05. FW: fresh weight.
These observations prompted the question of how ABA aggravates rice P deficiency. As the cell wall serves as a major P pool in P-deficient rice (X. Zhu et al., 2015), we obtained cell wall extracts for further analysis. As expected, more P was deposited in the cell walls of −P + ABA-treated rice compared with −P-treated rice (Fig. 3A), indicating that ABA can inhibit the release of P from the cell wall in P-deficient rice. Moreover, compared with −P treatment, −P + ABA treatment caused a reduction of pectin contents and PME activity (Fig. 3B, C), both of which were demonstrated to be well correlated with the decrease in the release of P from root cell walls. Thus, less soluble P was available under −P + ABA treatment, in accordance with our previous findings (Majerus et al., 2009).
Fig. 3.
Effect of ABA on cell wall P content (A), cell wall pectin content (B) and pectin methylesterase (PME) activity (C) in rice root under +P or −P conditions. Data are means ± s.d. (n = 4). Columns with different letters show significant differences at P < 0.05. FW: fresh weight.
As exogenous ABA also decreased the shoot soluble P content (Fig. 2B), we further measured the expression of genes (OsPT2, OsPT6 and OsPT8) responsible for P translocation from the roots to the shoots in rice (Ai et al., 2009; Wang et al., 2014b) and found that the expression of OsPT6 was significantly decreased under −P + ABA treatment compared with −P treatment (Fig. 4B), while no difference in the expression of either OsPT2 or OsPT8 was found between −P and −P + ABA treatments. These findings suggest that the inhibition of P transport by ABA might result from the ABA-induced down-regulation of OsPT6, which correlates well with the occurrence of putative ABA-responsive elements in the promoter of OsPT6 (Fig. 5).
Fig. 4.
Effect of ABA on the expression of OsPT2 (A), OsPT6 (B) and OsPT8 (C) in rice roots under +P or −P conditions. OsHISTONE was used as the reference gene. Data are means ± s.d. (n = 4). Columns with different letters show significant differences at P < 0.05.
Fig. 5.
Occurrence of putative abscisic acid (ABA)-responsive elements in the 2.5-kb promoter regions of OsPT2, OsPT6 and OsPT8. The predicted ABA-responsive element (the ABRE-like element ACGTG) is represented by oval symbols. The numbering below each symbol indicates the position of each motif relative to the site of transcriptional initiation.
As NO acts upstream of ethylene in the reutilization of root cell wall P in P-deficient rice (X. Zhu et al., 2016b, 2017b), and ABA responded as rapidly as NO (being significantly decreased after 1 h of −P treatment and reaching its minimum at 3 h, Fig. 1B, Supplementary Data Fig. S3; X. Zhu et al., 2017a), we first investigated whether there is a direct relationship between NO and ABA. As shown in Fig. 6, NO accumulation increased significantly under P-deficient conditions, and the addition of ABA had no further effect on NO accumulation (Fig. 6A, B), indicating that ABA may act in a manner independent of NO in the re-utilization of root cell wall P in P-deficient rice. This conclusion was further confirmed by the unchanged ABA content observed when an NO donor (SNP) was applied exogenously (Fig. 6C), suggesting that P deficiency may regulate NO production and ABA accumulation independently.
Fig. 6.
Effect of ABA on NO production (A, B) and effect of SNP on ABA accumulation (C) in rice roots under +P or −P conditions. The root tips were collected for the measurement of NO fluorescence. Scale bar = 1 mm. NO production is indicated by green fluorescence and expressed as the relative fluorescence intensity (% of minimal production). Data are means ± s.d. (n = 10). Columns with different letters show significant differences at P < 0.05. FW: fresh weight.
Recently, accumulating evidence has shown that ABA acts upstream of ethylene by inhibiting the expression of the genes (ACS4 and ACS8) responsible for ethylene production (Dong et al., 2016; Yu et al., 2016). Thus, the question arose as to whether the reduction of ABA also acts through ethylene in this cell wall P re-utilization mechanism in P-deficient rice. To address this question, the production of ethylene was determined after the addition of the ABA inhibitor Flu. Interestingly, the addition of Flu had no influence on ethylene production, irrespective of P status (Fig. 7A), and the addition of an ethylene precursor (ACC) also had no effect on the ABA content (Fig. 7B). These findings indicated that ABA may act in a manner independent of ethylene, and the decreased ABA content under P deficiency may occur in parallel with ethylene signalling in P-deficient rice, as described in Fig. 8.
Fig. 7.
Effect of Flu on ethylene emission (A) and effect of ACC on ABA accumulation (B) in rice roots under +P or −P conditions. Data are means ± s.d. (n = 10). Columns with different letters show significant differences at P < 0.05. FW: fresh weight.
Fig. 8.
Model illustrating the negative role of ABA, which may be independent of NO and ethylene, in cell wall P re-utilization in rice (Oryza sativa) under −P conditions. Our study could not rule out the possible involvement of other unknown upstream responses, which needs further clarification. A red cross indicates inhibition of the pathway.
DISCUSSION
Phytohormones and signalling molecules have been demonstrated to participate in responses to P deficiency in rice by accelerating the re-utilization of P retained in cell walls. In rice, P deficiency induces root NO accumulation, triggering an increase in ethylene levels and promoting the accumulation of pectin, in turn releasing P from the cell wall and finally inducing the expression of OsPT2, thereby facilitating root-to-shoot P translocation (C. Zhu et al., 2016a; X. Zhu et al., 2016b, 2017b). Both NO and ethylene are involved in the induction of OsPT2, and P deficiency also up-regulates genes involved in ethylene synthesis (X. Zhu et al., 2016b). Here, we further demonstrated that P deficiency could rapidly decrease root ABA accumulation (Fig. 1). Exogenous ABA aggravated P deficiency by inhibiting the re-utilization of P stored in root cell walls, which may be independent of the NO–ethylene pathway (Figs 3, 6 and 7), and decreased root-to-shoot P translocation (Figs 2 and 4). To our knowledge, this is a novel mechanism regarding the negative role of ABA in regulating plant P nutrition, although the role of ABA in the Pi deficiency response is debatable, as Trull et al. (1997) clearly reported that ABA does not influence the Pi deficiency response on all their test parameters, such as the production of acid phosphatase in Arabidopsis thaliana through using ABA mutants aba-1 and abi2-1, and this inconsistency may be attributed to different plant species (Arabidopsis and rice) or different culture conditions, etc., which needs further study. Furthermore, unexpectedly, under +P conditions, exogenous ABA treatment had almost no effect on the root/shoot soluble P content and cell wall P retention (Figs 2 and 3). Perhaps a threshold concentration of ABA is required in rice in response to P deficiency; that is, the ABA level in +P plants is enough for the retention of the soluble P and cell wall P, and thus the application of the additional ABA has no additional effect. Under −P conditions, the ABA level in plants decreases, and thus exogenous application of ABA plays its role. This issue requires further study.
P deficiency is extremely damaging to the vegetative growth and reproductive growth of plants, so any approaches that can enhance the acquisition and re-utilization of P in crops are key to crop yields under such conditions (Pandey et al., 2017). Indeed, re-utilization of the P stored in roots is a strategy for allowing plant growth in P-limited conditions, as P can easily remobilize within plants. Recent evidence has shown that the P stored in root cell walls, which accounts for approx. 50 % of root total P (X. Zhu et al., 2015, 2016b), can be partially remobilized under P deficiency, resulting in the improvement of shoot P nutrition (X. Zhu et al., 2017b). Here, we found that the amount of P retained in the root cell wall was decreased to a lesser extent under −P + ABA treatment as compared with −P treatment alone (Fig. 3A), indicating that ABA inhibited the remobilization of root cell wall P.
How then does exogenous ABA inhibit the remobilization of P stored in the root cell wall under P deficiency? Cellulose, hemicellulose and pectin are the main components of the cell walls, but only pectin (which possess negative charges) has been shown to be involved in the plant response to P starvation. For example, compared with other plants, groundnut possesses a superior ability to acquire soil P in P-deficient soil because its root cell wall exhibits a ‘contact reaction’ to pectin (Ae and Shen, 2002). Recently, X. Zhu et al. (2015) reported that pectin is able to re-utilize cell wall P by using its negative charges (-COO−-) to bind cations such as Fe, thus facilitating the release of cell wall P. Interestingly, the content of pectin in the rice root cell wall can be regulated by signalling molecules, such as NO, and by ethylene under P-deficient conditions (X. Zhu et al., 2016b, 2017b). In the present study, under −P conditions, when ABA was applied exogenously, a reduction of the cell wall pectin content was observed, associated with a notable reduction of PME activity (Fig. 3B, C). These findings indicate that ABA plays a negative role in the re-utilization of cell wall P to maintain internal P homeostasis and provide an opportunity to further investigate whether there is a relationship between ABA, NO and ethylene. A combination of SNP and ACC treatment had no effect on ABA accumulation (Figs 6C and 7B), and ABA or Flu treatment also had no effect on NO production or ethylene emission (Figs 6B and 7A), respectively, indicating that the regulation of pectin content by ABA may be independent of NO and ethylene in P-deficient rice. Indeed, as the effect of plant hormones is very quick, NO accumulation changed within 4 h under −P conditions, and it then became stable after 6 and 8 h (Supplementary Data Fig. S3), while ABA also responded quickly to −P treatment (within 3 h; Fig. 1). However, in our study of the interaction between NO, ABA and ethylene, the treatment time was much longer, 7 d. It is therefore possible that some upstream responses are neglected, which needs further study (Fig. 8).
In addition, besides the re-utilization of cell wall P, up-regulation of the translocation of internal soluble P via increased expression of the genes responsible for this process is very important for rice under P-deficient conditions. Three rice Pi:H+ cotransporters (PHTs: OsPT2, OsPT6 and OsPT8) have been shown to be essential for the translocation of P from roots to shoots (Ai et al., 2009; Jia et al., 2011). In contrast to OsPT2, which acts as a low-affinity Pi transporter, and is mainly expressed in the stele of primary and lateral roots under −P conditions (Ai et al., 2009), OsPT6 (expressed in epidermis, cortex and stelar tissue under −P conditions) and OsPT8 (constitutively expressed in various tissue organs under +P/−P conditions) are high-affinity Pi transporters (Ai et al., 2009; Jia et al., 2011; Wang et al., 2014b). Interestingly, in the present study under −P conditions, ABA markedly decreased the expression of OsPT6 (Fig. 4B), implying that ABA may act in a manner independent of NO and ethylene in P-deficient rice, as NO and ethylene significantly increased the expression of OsPT2 in P-deficient rice (X. Zhu et al., 2017b). The down-regulation of OsPT6 by ABA is mainly attributed to two ABA-responsive elements (ACGTG motifs) located in the OsPT6 promoter (Fig. 5), while the up-regulation of OsPT2 by ethylene is due to 12 ethylene-responsive element-binding factors (GCCGCC motifs) present in the OsPT2 promoter (Chakravarthy et al., 2003; X. Zhu et al., 2016b), indicating that the reduced shoot soluble P content observed under −P + ABA treatment may be attributed to the significantly reduced expression of OsPT6 (Figs 2 and 4).
CONCLUSIONS
Based on the current results and our previous work, we propose the model shown in Fig. 8. Under P deficiency, NO levels in rice increase as quickly as the ABA levels decrease, to inhibit both the ABA-induced reduction of pectin contents for the re-utilization of cell wall P and the ABA-induced down-regulation of OsPT6 for the translocation of P from roots to shoots. Thus, the growth of rice under P-deficient conditions is improved. Furthermore, this ABA-regulated cell wall P re-utilization may be relatively independent of the NO–ethylene pathway we demonstrated previously, which needs further study.
SUPPLEMENTARY DATA
Supplementary data are available online at https://academic.oup.com/aob and consist of the following. Figure S1: Effect of pH on ABA-aggravated P deficiency symptoms in rice. Figure S2: Effect of ABA on the expression of P starvation marker genes in rice roots under +P or −P conditions. Figure S3: Effect of P deficiency on NO accumulation in roots.
ACKNOWLEDGEMENTS
We thank Professor Yan Hua Su (Institute of Soil Science, Chinese Academy of Science, Nanjing, China) for providing the ‘Nipponbare’ seeds. Thanks are also given to two anonymous reviewers for their valuable comments that helped to improve the quality of our work. This research was funded by the National Key Basic Research Program of China (No. 2014CB441000), the Natural Science Foundation of China (31501825) and the ‘Strategic Priority Research Program’ of the Chinese Academy of Sciences (Nos. XDB15030302 and XDB15030202). XFZ and RFS designed the experiments; XFZ and XSZ performed the experiments. XSZ and QW analysed the data; XFZ and RFS wrote the manuscript. All authors read and approved the final manuscript. The authors declare that they have no competing interests.
LITERATURE CITED
- Ae N, Shen RF. 2002. Root cell-wall properties are proposed to contribute to phosphorus (P) mobilization by groundnut and pigeonpea. Plant and Soil 245: 95–103. [Google Scholar]
- Ai P, Sun S, Zhao J, et al. 2009. Two rice phosphate transporters, OsPht1;2 and OsPht1;6, have different functions and kinetic properties in uptake and translocation. Plant Journal 57: 798–809. [DOI] [PubMed] [Google Scholar]
- Bhadouria J, Singh AP, Mehra P, et al. 2017. Identification of purple acid phosphatases in Chickpea and potential roles of CaPAP7 in seed phytate accumulation. Scientific Reports 7: 11012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Beardsley TM. 2011. Peak phosphorus. Bioscience 61: 91. [Google Scholar]
- Boulet FM, Lambers H. 2005. Characterisation of arbuscular mycorrhizal fungi colonisation in cluster roots of Hakea verrucosa F. Muell (Proteaceae), and its effect on growth and nutrient acquisition in ultramafic soil. Plant and Soil 269: 357–367. [Google Scholar]
- Chakravarthy S, Tuori RP, D’Ascenzo MD, Fobert PR, Després C, Martin GB. 2003. The tomato transcription factor Pti4 regulates defense-related gene expression via GCC box and non-GCC box cis elements. The Plant Cell 15: 3033–3050. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chiera J, Thomas J, Rufty T. 2002. Leaf initiation and development in soybean under phosphorus stress. Journal of Experimental Botany 53: 473–481. [DOI] [PubMed] [Google Scholar]
- Cutler SR, Rodriguez PL, Finkelstein RR, Abrams SR. 2010. Abscisic acid: emergence of a core signaling network. In: Merchant S, Briggs WR, Ort D, eds. Annual Review of Plant Biology, 61: 651–679. [DOI] [PubMed] [Google Scholar]
- Ding Y, Avramova Z, Fromm M. 2011. The Arabidopsis trithorax-like factor ATX1 functions in dehydration stress responses via ABA-dependent and ABA-independent pathways. Plant Journal 66: 735–744. [DOI] [PubMed] [Google Scholar]
- Dong Z, Yu Y, Li S, Wang J, Tang S, Huang R. 2016. Abscisic acid antagonizes ethylene production through the ABI4-mediated transcriptional repression of ACS4 and ACS8 in Arabidopsis. Molecular Plant 9: 126–135. [DOI] [PubMed] [Google Scholar]
- Grimal JY, Frossard E, Morel JL. 2001. Maize root mucilage decreases adsorption of phosphate on goethite. Biology and Fertility of Soils 33: 226–230. [Google Scholar]
- Jia H, Ren H, Gu M, et al. 2011. The phosphate transporter gene OsPht1;8 is involved in phosphate homeostasis in rice. Plant Physiology 156: 1164–1175. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Juszczuk IM, Wiktorowska A, Malusa E, Rychter AM. 2004. Changes in the concentration of phenolic compounds and exudation induced by phosphate deficiency in bean plants (Phaseolus vulgaris L.). Plant and Soil 267: 41–49. [Google Scholar]
- Lei GJ, Zhu XF, Wang ZW, Dong F, Dong NY, Zheng SJ. 2014. Abscisic acid alleviates iron deficiency by promoting root iron reutilization and transport from root to shoot in Arabidopsis. Plant Cell and Environment 37: 852–863. [DOI] [PubMed] [Google Scholar]
- Lopez-Bucio J, Cruz-Ramirez A, Herrera-Estrella L. 2003. The role of nutrient availability in regulating root architecture. Current Opinion in Plant Biology 6: 280–287. [DOI] [PubMed] [Google Scholar]
- Majerus V, Bertin P, Lutts S. 2009. Abscisic acid and oxidative stress implications in overall ferritin synthesis by African rice (Oryza glaberrima Steud.) seedlings exposed to short term iron toxicity. Plant and Soil 324: 253–265. [Google Scholar]
- Mehra P, Pandey BK, Giri J. 2016. Comparative morphophysiological analyses and molecular profiling reveal Pi-efficient strategies of a traditional rice genotype. Frontiers in Plant Science 6: 1184. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mehra P, Pandey BK, Giri J. 2017. Improvement in phosphate acquisition and utilization by a secretory purple acid phosphatase (OsPAP21b) in rice. Plant Biotechnology Journal 15: 1054–1067. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Morcuende R, Bari R, Gibon Y, et al. 2007. Genome-wide reprogramming of metabolism and regulatory networks of Arabidopsis in response to phosphorus. Plant Cell and Environment 30: 85–112. [DOI] [PubMed] [Google Scholar]
- Nacry P, Canivenc G, Muller B, et al. 2005. A role for auxin redistribution in the responses of the root system architecture to phosphate starvation in Arabidopsis. Plant Physiology 138: 2061–2074. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Niu YF, Chai RS, Jin GL, Wang H, Tang CX, Zhang YS. 2013. Responses of root architecture development to low phosphorus availability: a review. Annals of Botany 112: 391–408. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pandey BK, Mehra P, Verma L, Bhadouria J, Giri J. 2017. OsHAD1, a haloacid dehalogenase-like APase enhances phosphate accumulation. Plant Physiology 174: 2316–2332. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Plaxton WC, Tran HT. 2011. Metabolic adaptations of phosphate-starved plants. Plant Physiology 156: 1006–1015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Poirier Y, Bucher M. 2002. Phosphate transport and homeostasis in Arabidopsis. The Arabidopsis book 1: e0024–e0024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Raghothama KG. 1999. Phosphate acquisition. Annual Review of Plant Physiology and Plant Molecular Biology 50: 665–693. [DOI] [PubMed] [Google Scholar]
- Ribot C, Wang Y, Poirier Y. 2008. Expression analyses of three members of the AtPHO1 family reveal differential interactions between signaling pathways involved in phosphate deficiency and the responses to auxin, cytokinin, and abscisic acid. Planta 227: 1025–1036. [DOI] [PubMed] [Google Scholar]
- Secco D, Jabnoune M, Walker H, et al. 2013. Spatio-temporal transcript profiling of rice roots and shoots in response to phosphate starvation and recovery. Plant Cell 25: 4285–4304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tanimoto M, Roberts K, Dolan L. 1995. Ethylene is a positive regulator of root hair development in Arabidopsis thaliana. Plant Journal 8: 943–948. [DOI] [PubMed] [Google Scholar]
- Taylor CB, Bariola PA, Delcardayre SB, Raines RT, Green PJ. 1993. RNS2: a senescence-associated RNase of Arabidopsis that diverged from the S-RNases before speciation. Proceedings of the National Academy of Sciences of the United States of America 90: 5118–5122. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Trull MC, Guiltinan MJ, Lynch JP, Deikman J. 1997. The responses of wild‐type and ABA mutant Arabidopsis thaliana plants to phosphorus starvation. Plant, Cell & Environment 20: 85–92. [Google Scholar]
- Vance CP. 2008. Plants without arbuscular mycorrhizae. In: White PJ, Hammond JP, eds. The Ecophysiology of Plant-Phosphorus Interactions. Dordrecht: Springer Netherlands, 117–142. [Google Scholar]
- Vysotskaya LB, Trekozova AW, Kudoyarova GR. 2016. Effect of phosphorus starvation on hormone content and growth of barley plants. Acta Physiologiae Plantarum 38: 1–6. [Google Scholar]
- Wang BL, Tang XY, Cheng LY, et al. 2010. Nitric oxide is involved in phosphorus deficiency-induced cluster-root development and citrate exudation in white lupin. New Phytologist 187: 1112–1123. [DOI] [PubMed] [Google Scholar]
- Wang S, Zhang S, Sun C, et al. 2014. a Auxin response factor (OsARF12), a novel regulator for phosphate homeostasis in rice (Oryza sativa). New Phytologist 201: 91–103. [DOI] [PubMed] [Google Scholar]
- Wang X, Wang Y, Piñeros MA, et al. 2014. b Phosphate transporters OsPHT1; 9 and OsPHT1; 10 are involved in phosphate uptake in rice. Plant, Cell and Environment 37: 1159–1170. [DOI] [PubMed] [Google Scholar]
- Wasaki J, Yamamura T, Shinano T, Osaki M. 2003. Secreted acid phosphatase is expressed in cluster roots of lupin in response to phosphorus deficiency. Plant and Soil 248: 129–136. [Google Scholar]
- Wu J, Wang C, Zheng L, et al. 2011. Ethylene is involved in the regulation of iron homeostasis by regulating the expression of iron-acquisition-related genes in Oryza sativa. Journal of Experimental Botany 62: 667–674. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wu P, Shou H, Xu G, Lian X. 2013. Improvement of phosphorus efficiency in rice on the basis of understanding phosphate signaling and homeostasis. Current Opinion in Plant Biology 16: 205–212. [DOI] [PubMed] [Google Scholar]
- Yoshioka T, Endo T, Satoh S. 1998. Restoration of seed germination at supraoptimal temperatures by fluridone, an inhibitor of abscisic acid biosynthesis. Plant and Cell Physiology 39: 307–312. [Google Scholar]
- Yu FW, Zhu XF, Li GJ, Kronzucker HJ, Shi WM. 2016. The chloroplast protease AMOS1/EGY1 affects phosphate homeostasis under phosphate stress. Plant Physiology 172: 1200–1208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhong HL, Lauchli A. 1993. Changes of cell-wall composition and polymer size in primary roots of cotton seedlings under high salinity. Journal of Experimental Botany 44: 773–778. [Google Scholar]
- Zhu CQ, Zhu XF, Hu AY, et al. 2016. a Differential effects of nitrogen forms on cell wall phosphorus remobilization are mediated by nitric oxide, pectin content, and phosphate transporter expression. Plant Physiology 171: 1407–1417. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhu XF, Jiang T, Wang ZW, et al. 2012. Gibberellic acid alleviates cadmium toxicity by reducing nitric oxide accumulation and expression of IRT1 in Arabidopsis thaliana. Journal of Hazardous Materials 239–240: 302–7. [DOI] [PubMed] [Google Scholar]
- Zhu XF, Wang ZW, Wan JX, et al. 2015. Pectin enhances rice (Oryza sativa) root phosphorus remobilization. Journal of Experimental Botany 66: 1017–1024. [DOI] [PubMed] [Google Scholar]
- Zhu XF, Zhu CQ, Zhao XS, Zheng SJ, Shen RF. 2016b Ethylene is involved in root phosphorus remobilization in rice (Oryza sativa) by regulating cell-wall pectin and enhancing phosphate translocation to shoots. Annals of Botany 118: 645–653. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhu XF, Wu Q, Zheng L, Shen RF. 2017a NaCl alleviates iron deficiency through facilitating root cell wall iron reutilization and its translocation to the shoot in Arabidopsis thaliana. Plant and Soil 417: 155–167. [Google Scholar]
- Zhu XF, Zhu CQ, Wang C, Dong XY, Shen RF. 2017b Nitric oxide acts upstream of ethylene in cell wall phosphorus reutilization in phosphorus-deficient rice. Journal of Experimental Botany 68: 753–760. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.








