Skip to main content
Stem Cells International logoLink to Stem Cells International
. 2018 Jun 6;2018:3697971. doi: 10.1155/2018/3697971

Isolation and Characterization of Multipotent Turkey Tendon-Derived Stem Cells

Qian Liu 1,2, Yaxi Zhu 3, Peter C Amadio 1, Steven L Moran 1, Anne Gingery 1, Chunfeng Zhao 1,✉
PMCID: PMC6011053  PMID: 29977306

Abstract

Tendon injuries are among the most common and severe hand injuries with a high demand for functional recovery. Stem cells have been identified and isolated from different species and a variety of tissues for the sake of regenerative medicine. Recently, turkey has been suggested as a potential new large animal model for flexor tendon-related research. However, turkey tissue-specific stem cells have not been investigated. Here, we presented the isolation and verification of tendon-derived stem cells (TDSCs) from 6- to 8-month-old heritage-breed turkey. TDSCs were isolated from turkey flexor tendon by plating nucleated cells at the determined optimal density. Approximately 4% of the nucleated cells demonstrated clonogenicity, high proliferation rate, and trilineage differentiation potential after induction culturing. These cells expressed surface antigens CD90, CD105, and CD44, but did not express CD45. There was a high level of gene expression of tenogenic markers in TDSCs, including mohawk, collagen type I, tenascin C, and elastin. Turkey TDSCs also expressed transcription factors PouV, Nanog, and Sox2, which are critically involved in the regulation of stemness. The successful isolation of tendon-derived stem cells from turkey was beneficial for future studies in tendon tissue engineering and would help in the development of new treatment for tendon diseases using this novel animal model.

1. Introduction

Tendon injuries debilitate numerous people in athletic and occupational surroundings and remain a clinical challenge [1–3]. Injured tendon tissue heals very slowly, especially flexor tendons in the hand which is one of the most common injuries in upper extremity [4–6]. Clayton and Court-Brown studied 2794 tendinous or ligamentous injuries and found that hand tendon injuries accounted for over 1/3 of all cases [1]. Surgical interventions following flexor tendon injury are needed to restore function [7, 8] but often associated with inferior structural integrity and mechanical strength [9, 10]. Currently, stem cell-mediated approaches play a crucial role in regeneration medicine to improve the outcome of tendon injuries [11–14]. Mesenchymal stem cells (MSCs) possess clonogenicity, multipotency, and high proliferative capacity. MSCs are capable of adhering to plastic culture and can differentiate towards osteogenic, chondrogenic, and adipogenic lineages [15]. Therefore, MSCs serve as a favorable cell source for applications in the field of regenerative medicine and tissue engineering. MSCs can be isolated from several tissues such as synovium [16], umbilical cord [17], adipose [18], cartilage [19], and periosteum [20] but most commonly from bone marrow [21] and adipose tissue [22].

In addition to MSCs from bone marrow [11, 13, 14], tendon-derived stem cells (TDSCs) are emerging as a better candidate for application in tissue regenerative medicine [23–25]. TDSCs are a unique cell population present within the tendon tissues that have self-renewal and multilineage differential potential [26]. Compared with bone marrow-derived stem cells (BMSCs), TDSCs have been demonstrated to form more colonies, proliferate faster, and exhibit higher multilineage differentiation potential [26–28]. Moreover, TDSCs have been found to express tenogenic markers with increased collagen synthesis in cell culture, which makes them superior for tendon injuries repair than BMSCs [29].

Canine and chicken are currently the most popular animal models for flexor tendon-related research. However, they have several disadvantages that demand development of a new large animal model [30]. The canine model disadvantages include the cost and concerns regarding companion animal use. Although the chicken model is more affordable and has similarity to human vasculature [31, 32], it is complicated by an additional phalanx in the third digit and difficulties in postoperative rehabilitation [33]. Recently, our group has shown that turkey flexor tendons have many similarities such as anatomy and biomechanical properties to human flexor tendons, which would make the turkey a potential new large animal model for clinically relevant flexor tendon research [34]. The ability to identify turkey TDSCs would pave the way for studies on its role in tendon physiology and tendinopathy and open up new treatment for tendon diseases.

In this study, the isolation and verification of stem cells from heritage-breed turkeys' flexor tendon are evaluated. We assessed TDSCs' ability to form colonies, proliferative capacity, and morphology change. Stem cell markers were examined by electrophoresis. The multilineage potential of TDSCs was investigated by histological assay and gene expression analysis.

2. Materials and Methods

2.1. Turkey TDSC Isolation and Expansion

Three 6- to 8-month-old heritage-breed turkeys, weighing 8–10 kg, were used for the isolation of TDCSs. All animal protocols were approved by our Institutional Animal Care and Use Committee (IACUC). After euthanasia, the intact flexor digitorum profundus (FDP) tendon in the zone II area where the tendon is located within the flexor sheath was dissected out from the third digit of each turkey. The tendon sheath and peritendinous tissue were carefully removed. The tendon midsubstance was then gently cut into small pieces and digested with collagenase type I (Sigma-Aldrich, St. Louis, MO) at the concentration of 3 mg/ml for 2.5 h at 37°C and filtered through a 70 μm cell strainer (BD Falcon, Bedford, MA) to remove undigested tissue. After centrifugation at 300g for 5 min, the cell pellet was resuspended in Dulbecco's modified Eagle's medium (DMEM; Gibco, Carlsbad, CA) containing 1% antibiotics (antibiotic–antimycotic; Gibco) and 10% fetal bovine serum (FBS). The cells were plated in 100 mm Corning® dishes at a low density (500 cells/cm2) and cultured at 37°C with 5% CO2. Nonadherent cells were removed with PBS wash after 48 h of plating. The medium was changed every 3 days. When the cultured primary cells reached 70%–80% confluence, they were subcultured after digestion with 0.25% trypsin/1 mM EDTA and used for further studies.

2.2. Colony-Forming Unit (CFU) Assay

For the isolation of stem cells from tendon, the optimal cell seeding density was determined by culturing nucleated cells obtained from turkey flexor tendon in 6-well plates at 50, 500, and 5000 cells/cm2 and the procedure was repeated in triplicate. 10 days after culture, the cells were stained with 0.5% crystal violet (Sigma, St. Louis, MO) after fixation with 4% paraformaldehyde to quantify the colony formation. Colonies larger than 2 mm in diameter and were distinguishable were included for counting. The optimal cell seeding density was determined based on the largest number of colonies obtained without contact inhibition between colonies [35]. The percentage of tendon-derived stem cells was calculated by dividing the colony number at the optimal seeding density by the nucleated cell number.

2.3. Cell Proliferation of Turkey TDSCs

P3 tendon-derived cells were plated in 12-well plates at 5000 cells/cm2 in triplicate and cultured at 37°C, 5% CO2. Cell proliferation was evaluated every 2 days until day 12 after cell seeding. Viable cells were determined by using Trypan blue staining. The proliferative potential of cells was presented in relative fold change.

2.4. RNA Isolation and Gene Expression

The gene expression of osteogenic, adipogenic, and chondrogenic markers after induction and embryonic stem cell (ESC) markers at different cell passages was examined by quantitative real-time polymerase chain reaction (qRT-PCR). The mRNA expression of tendon-related markers was also examined. Total RNA was isolated using TRIzol® reagent (Invitrogen, Grand Island, NY) per the manufacturer's protocol. RNA concentration was assessed by absorbance at 260 and 280 nm with a DS-11 spectrophotometer (DeNovix, Wilmington, DE). Complementary DNA (cDNA) was synthesized from equal amounts of RNA (1 μg) using the iScript™ cDNA Synthesis Kit (Bio-Rad). All reactions were performed using SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) on a C1000 Touch™ Thermal Cycler (Bio-Rad Laboratories, Hercules, CA) for the following genes: scleraxis (SCX), mohawk (MKX), tenomodulin (TNMD), thrombospondin-4 (THBS4), tenascin C (TNC), collagen type I (COL1A1), decorin (DCN), elastin (ELN), peroxisome proliferator-activated receptor (PPARγ), adipocyte-binding protein 2 (aP2), runt-related transcription factor 2 (RUNX2), osteopontin (SPP1), osteocalcin (BGLAP), sex-determining region Y-box9 (SOX9), collagen type II (COL2A1), aggrecan (ACAN), PouV, Nanog, and Sox2. The cycling program was 2 min at 95°C, then 40 cycles of amplifications, 5 s at 95°C for denaturation, 5 s at 65°C for annealing, and 5 s at 95°C for extension. PCR primers were designed using Primer3 version 0.4.0 software (Table 1). All primers were from chicken. Each sample was analyzed in triplicate. The gene expression level of the target genes was normalized to GAPDH and then analyzed by the 2−∆Ct formula with reference to the noninduced controls. The experiment was performed in duplicates of cells from two turkeys.

Table 1.

Sequences of primers used for reverse transcription polymerase chain reaction.

Gene Primer 5′-sequence-3′ Product size (bp) Accession no.
GAPDH Fwd
Rev
TGGGAAGCTTACTGGAATGG
CTTGGCTGGTTTCTCCAGAC
88 NM_204305.1
CD44 Fwd
Rev
GGTTTTATAGTGGGGCATATTGTTATCCC
TTAACCGCGATGCACACGGC
700 AF153205
CD45 Fwd
Rev
CACTGGGAATCGAGAGGAAA
CTGGTCTGGATGGCACTTTT
574 NM 204417
CD90 Fwd
Rev
GGTCTACATGTGCGAGCTGA
AAAGCTAAGGGGTGGGAGAA
471 NM 204381
CD105 Fwd
Rev
ACGGATGACACCATGGAAAT
ATGAGGAAGGCTCCAAAGGT
704 AY702002
PPARγ Fwd
Rev
GGATTCATGACACGGGAGTT
GCGTTGAACTTCACAGCAAA
92 NM_001001460.1
aP2 Fwd
Rev
GAGTTTGATGAGACCACAGCAGA
ATAACAGTCTCTTTGCCATCCCA
312 AF432507
RUNX2 Fwd
Rev
CAGGCATGTCACTGGGTATG
TATGGAGTGCTGCTGGTCTG
115 NM_204128.1
SPP1 Fwd
Rev
AGCCACCACACACACAGGTA
TGAAGCCAGGTCATTCTGTG
87 M59182.1
BGLAP Fwd
Rev
CGCAGTGCTAAAGCCTTCAT
CTCAGCTCACACACCTCTCG
140 NM_205387.1
SOX9 Fwd
Rev
CTCAAGGGCTACGACTGGAC
GTACTGGTCAGCCAGCTTCC
141 NM_204281.1
COL2A1 Fwd
Rev
AAGGGTGATCGTGGTGAGAC
TCGCCTCTGTCTCCTTGTTT
107 AY046949.1
ACAN Fwd
Rev
ACTCCCGACACAACATCACA
TGCGCTAGTTCAACATCTGG
101 NM_204955.2
PouV Fwd
Rev
TACATGCCACCTTTCCACAA
CAGTGGCTGCTGTTGTTCAT
80 NM_001309372.1
Nanog Fwd
Rev
TTGGAAAAGGTGGAACAAGC
GGTGCTCTGGAAGCTGTAGG
140 NM_001146142.1
Sox2 Fwd
Rev
GCCCTGCAGTACAACTCCAT
CCTTGCTGGGAGTACGACAT
83 NM_205188.2
SCX Fwd
Rev
TCCAGCTACATCTCCCACCT
GCTGGGAGTTCTCGGAGTC
145 NM_204253.1
MKX Fwd
Rev
GTTGGGCTTTGCGAATAAAA
ACGAGTCATCACTGCTCACG
81 XM_019616306.1
TNMD Fwd
Rev
CGGCGAGAAGAAGAAAATTG
CTCCAGGATCTCCTCAGTGC
91 XM_003208349.3
THBS4 Fwd
Rev
ATGCTCAGATTGACCCCAAC
CCCTCGAAGTCAACACCATT
121 XM_019610190.1
COL1A1 Fwd
Rev
CTGAAGAAGGCTCTGCTGCT
CATGCTCCAGTGTGACTCGT
116 XM_015273228.1
TNC Fwd
Rev
GCCCATGGAGTTCAACATCT
TGTAGCCGCAGCACTTATTG
136 NM_205456.4
DCN Fwd
Rev
CAACACCAAAAAGGCAACCT
CTGCAGAGCGTTCATGGATA
107 NM_001030747.2
ELN Fwd
Rev
TGGCTATAGATTGCCCTTCG
CCAACACCTGTCCCAGTAGG
99 NM_001293107.1

2.5. MSC Marker Analysis

MSC surface markers, including CD90, CD105, and CD44, were examined as previously described [36]. Hematopoietic cell marker CD45 was also examined to exclude the contamination of hematopoietic cells. Briefly, a total of 10 μL amplified DNA fragments were electrophoresed on a 1.5% agarose gel to detect PCR products for each marker.

2.6. Multidifferentiation Potential

We investigated the multipotency of P3 turkey tendon-derived cells based on the method of Pittenger et al. [37] and Scharstuhl et al. [38] with minor modifications.

2.6.1. Osteogenic Differentiation

Tendon-derived cells were cultured in complete medium in a six-well plate at a density of 4 × 103 cells/cm2. Osteogenesis was tested by inducing the cells in osteogenic differentiation medium (Gibco; StemPro® Osteogenesis Differentiation Kit) for 3 weeks. Control groups were cultured in basal complete media. The medium was refreshed every 3–4 days. To assess osteogenesis, calcium nodules were stained with Alizarin Red S after 21 days, and the osteogenic lineage-specific gene expressions (RUNX2, SPP1, and BGLAP) were assessed using qRT-PCR. Alizarin Red S staining was conducted by washing the cells with PBS, then fixed with 70% ethanol for 10 min, and incubated with 0.5% Alizarin Red S (pH 4.1; Sigma-Aldrich) for 30 min. Images of stained cells were obtained using a light microscope (BH2, Olympus).

2.6.2. Adipogenic Differentiation

Tendon-derived cells were cultured in complete medium in a six-well plate at a density of 4 × 103 cells/cm2. When cells reached 100% confluence, adipogenesis was induced by replacing basal medium with adipogenic differentiation medium (Gibco; StemPro Adipogenesis Differentiation Kit). After three weeks, the gene expression of adipogenic markers (PPARγ, aP2) and the accumulation of lipid droplets were assessed by qRT-PCR and Oil red-O (Sigma-Aldrich) staining, respectively. Cells cultured in basal complete medium only served as control. Fresh medium was fed to cultures every 3–4 days. Oil red-O staining was completed. Cells were washed two times with dH2O; filtered 0.3% Oil red-O solution was added and incubated for 15 min after fixed with 70% ethanol for 20 s. Cultures were washed with PBS three times, hematoxylin was added, and cells were incubated for 30 s. Images of stained cells were viewed using a light microscope (BH2, Olympus).

2.6.3. Chondrogenic Differentiation

Micromass culture was used for inducing chondrogenesis. Briefly, 5 μL droplets of cell solution were seeded in the center of 24-well plates after resuspending cells in chondrogenic differentiation medium (Gibco; StemPro Chondrogenesis Differentiation Kit) at 1.6 × 107 cells/mL. After incubating for 2 hours, a 500 μL chondrogenic differentiation medium (Gibco; StemPro Chondrogenesis Differentiation Kit) was added. Cultures were fed every 2–3 days. After 21 days of culture, the micromass was rinsed with PBS and fixed in 4% paraformaldehyde for 30 min. The micromass was then stained with 1% Alcian blue solution to evaluate glycosaminoglycan synthesis. The gene expressions of COL2A1, SOX9, and ACAN were assessed using qRT-PCR as described above.

3. Data Analysis

All data are presented as mean ± standard deviation. Comparison of two groups was done using two-tailed, unpaired Student's t-test, and the comparison of multiple groups was done using one-way factorial analysis of variance (ANOVA) followed by comparison of individual means with Tukey's test. Statistical analyses were performed with SPSS statistical software (version 17.0, SPSS Inc., Chicago, IL). P < 0.05 was regarded as statistically significant.

4. Results

4.1. Clonogenicity and Proliferation of Tendon-Derived Cells

The clonogenic capacity of tendon-derived cells was assessed using CFU assay. After 10 days, cells isolated from tendon formed adherent cell colonies (Figure 1(a)). The optimal cell seeding density was determined by plating cells isolated from turkey tendon at several densities. We found that at 5000 cells/cm2, the colonies were indistinguishable. The number of colonies was significantly higher when plating at 500 cells/cm2 compared to that at 50 cells/cm2 (198 ± 15.7 colonies versus 39 ± 1.5 colonies, n = 3, P < 0.01) (Figure 1(b)). Approximately 4% of tendon-derived nucleated cells were able to form colonies. The proliferation profile of tendon-derived cells was assessed by counting viable cells for 12 days at a 2-day interval using Trypan blue exclusion method. The cells demonstrated a more than 25-fold increase with time up to day 12, indicating that the tendon-derived cells possessed high proliferative capability (Figure 1(c)).

Figure 1.

Figure 1

(a) Colony-forming unit assay of tendon-derived cells after 10 days of culture at 50, 500, and 5000 cells/cm2. (b) Number of cell colonies when tendon-derived cells were plated at 50 or 500 cells/cm2. n = 3, ∗P < 0.01. (c) Graph showing the proliferative over time of tendon-derived cells at P3. The results shown here were mean ± standard deviation of three wells for each time point. The experiment was performed independently in two turkeys.

4.2. Cell Morphology of Tendon-Derived Cells

Spindle-shaped and polygonal cells were both found at P0. At P1, cells demonstrated spindle-shaped fibroblastic morphology. The majority of cells at P3 retained fibroblast-like morphology Figure 2(a)).

Figure 2.

Figure 2

(a) Photomicrographs show different cell morphologies at different passages. At P0, spindle-shaped and polygonal cells were observed, and P1 cells demonstrated spindle-shaped fibroblastic morphology. At P3, homogeneous fibroblast-like cells were observed. Scale bars: 200 μm. (b) Phenotype of tendon-derived cells. RT-PCR was performed using total RNA extracted from P3 cells. The right column shows the results with total RNA from TDSCs. Total RNA extracted from turkey white blood cells was used as a control (left column). (c) Gene expression analysis of embryonic stem cell markers PouV, Nanog, and Sox2 at different cell passages. ∗P < 0.05 as compared to P3 cells.

4.3. Phenotype of Tendon-Derived Cells

The expression of MSC phenotypic markers was evaluated using RT-PCR (Figure 2(b)). Our results showed that the tendon-derived cells expressed surface antigens CD44, CD90, and CD105, but not CD45, thus indicating the mesenchymal lineage origin of these cells.

4.4. Expression of PouV, Nanog, and Sox2 Transcription Factors

The gene expression of PouV, Nanog, and Sox2 was detected up to passage 10. P8 cells expressed higher levels of Sox2 (P = 0.011) than did P3 cells. No significant difference was found in the mRNA expression of PouV (P = 0.792) or Nanog (P = 0.136) between different passages (Figure 2(c)).

4.5. Expression of Tenogenic Markers

The gene expression level of tendon-related markers was examined by qRT-PCR. The isolated turkey TDSCs had high mRNA expression level of MKX, COL1A1, TNC, and ELN (Figure 3).

Figure 3.

Figure 3

Scatter plot showing the mRNA expression of eight tendon-related genes in turkey TDSCs. The horizontal bar represents the mean cycle threshold (Ct) value of each gene. GAPDH serves as endogenous control. SCX: scleraxis; MKX: mohawk; TNMD: tenomodulin; THBS4: thrombospondin-4; TNC: tenascin C; COL1A1: collagen type I; DCN: decorin; ELN: elastin.

4.6. Osteogenic Differentiation Potential

After 21 days of osteogenic induction, Alizarin Red S assay demonstrated that induction cultures had calcium nodules (Figure 4(a)), which were absent in the basal cultures (Figure 4(b)). The mRNA expression level of RUNX2 (P = 0.0028), SPP1 (P ≤ 0.001), and BGLAP (P = 0.011) was also upregulated after 21 days of incubation in osteogenic medium (Figure 4(c)).

Figure 4.

Figure 4

Osteogenic induction evaluated with Alizarin red S staining after 21 days in osteogenic media (a) or basal (b) media. Calcium nodules were seen in osteogenic medium (a), but not in basal medium (B). Scale bars: 200 μm; inset, 100 μm. (c) Graph showing the osteogenic gene (RUNX2, SPP1, and BGLAP) expression compared between osteogenic medium and its respective basal cultures. The level of expression of each target gene was normalized to GAPDH. ∗∗P < 0.01 and ∗P < 0.05. RUNX2: runt-related transcription factor 2; SPP1: osteopontin; BGLAP: osteocalcin.

4.7. Adipogenic Differentiation Potential

Oil red-O staining showed lipid droplet accumulation within the cells upon adipogenic induction for 3 weeks (Figure 5(a)). This was absent in the control group (Figure 5(b)). The gene expression level of aP2 (P ≤ 0.001) was significantly upregulated, whereas there was a trend of increased expression of PPARγ (P = 0.075) after adipogenic differentiation for 21 days (Figure 5(c)).

Figure 5.

Figure 5

Adipogenic potential was determined by Oil red-O staining with hematoxylin counterstaining after culturing for 21 days in adipogenic media (a) or basal (b) media. Cytoplasmic lipid droplets were seen in adipogenic medium (a), but not in basal medium (b). Scale bars: 100 μm; inset, 50 μm. (c) Adipogenic gene (PPARγ and aP2) expression compared between osteogenic medium and its respective basal cultures. The level of expression of each target gene was normalized to GAPDH. ∗P < 0.01. aP2: adipocyte-binding protein 2; PPARγ: peroxisome proliferator-activated receptor.

4.8. Chondrogenic Differentiation Potential

After 21 days of chondrogenic induction, there was glycosaminoglycan deposition found in micromass by Alcian blue staining (Figure 6(a)). There was increased gene expression of COL2A1 (P = 0.03), whereas expression of SOX9 showed a trend (P = 0.071) to increase after chondrogenic induction for 3 weeks (Figure 6(c)). The ethidium bromine gel showed a thick band for induction culture and no ACAN expression for basal culture (Figure 6(b)).

Figure 6.

Figure 6

(a) Chondrogenic potential was evaluated by Alcian blue staining of proteoglycan in micromass pellets after culturing in chondrogenic medium for 21 days. Scale bars: 50 μm. (b) Ethidium bromine gel of ACAN showed no expression of ACAN products for basal cultures. (c) Chondrogenic gene (SOX9 and COL2A1) expression compared between chondrogenic medium and its respective basal cultures. The level of expression of each target gene was normalized to GAPDH. ∗P < 0.05. SOX9: sex-determining region Y-box9; COL2A1: collagen type II; ACAN: Aggrecan.

5. Discussion

This study demonstrated that turkey flexor tendon harbors a population of cells that has stem cell characteristics. Using methods previously described [23, 24, 35], we have isolated for the first time multipotent cells from the turkey flexor tendon. The cells were plastic adherent, possessed high proliferative potential, and were able to form colonies and have multilineage potential. When plating at 500 cells/cm2, about 4% of nucleated cells formed adherent cell colonies. These findings corresponded well with previous studies that have shown plating cells at low density allowing the selective expansion of stem cells from tendon [23, 35]. Furthermore, the percentage of stem cells was comparable to that shown in previous studies [26, 35]. Bi et al. [26] showed that about 3% to 4% of cells derived from mouse patellar tendons and human hamstring tendons were TDSCs. Rui et al. [35] showed that rat flexor tendons contained approximately 1% to 2% of TDSCs. In contrast, the percentage of MSCs residing in the adult bone marrow is less than 0.01% [15, 37, 39]. Therefore, tendon could be an alternative tissue for providing sources of MSCs.

Our group has recently compared the turkey flexor tendon to commonly used animal models and human hands [40]. It was found that turkey flexor tendon has more similarities to human than canine and chicken in terms of structure, function, and mechanical properties. Previous assumptions were made that since turkey leg tendons mineralize, their flexor tendons would mineralize likewise and thus would not make an ideal flexor tendon model [41–43]. However, we have determined that the tendon in the digit is not calcified, which is essential for flexor tendon research. Given that the 3rd digit of the turkey has the most suitable scale for experimentation [33] and zone II flexor tendon injuries are difficult to repair [6, 44], we focused our evaluation of the biological potential of these tendons.

The TDSCs isolated from turkey tendon were positive for MSC markers CD44, CD90, and CD105, while lacking expression of CD45 (a marker of all hematopoietic cells) [45]. These phenotypic profiles fulfilled the requirements proposed by the International Society for Cellular Therapy (ISCT) for defining MSCs [46]. Similarly, surface antigens CD44 and CD90 were also seen in mouse and human TDSCs [26] and in rat TDSCs [35]. Currently, there are no known turkey protein antibodies for CD44, CD90, CD105, and CD45 available; we attempted to use rat anti-mouse monoclonal antibodies to examine the phenotype of cells by flow cytometry, but we did not observe species cross-reactions. In addition, turkey TDSCs exhibited high mRNA expression of tenogenic markers, including MKX, COL1A1, TNC, and ELN. MKX is essential for tendon differentiation and collagen fibril maturation [47]. COL1A1, TNC, and ELN are regarded as major markers of the tendon extracellular matrix [48]. The gene expression of embryonic stem cell markers, including PouV, Nanog, and Sox2 in TDSCs, were also evaluated. PouV is a homologue of Oct4 in mammals and plays a key role in regulating chicken embryonic stem cell stemness [49]. Nanog and Sox2 are also involved in the maintenance of stemness in undifferentiated embryonic stem cells [50, 51]. Our results showed that the expression of PouV, Nanog, and Sox2 were detected in turkey TDSCs up to 10 passages in vitro without significantly reduced expression. This was comparable with previous studies that gene expressions of PouV, Nanog, and Sox2 can be detected up to passage 8 in chicken BMSCs [36]. This is further indication that TDSCs maintain stem characteristics. The increased Sox2 expression in P8 cells could be postulated as a result of the enrichment of stem cells with in vitro expansion while preserving their stemness. It has been suggested that current methods are incapable of isolating pure TDSCs at the early passage stage [52]. With the passage increased, the population of stem cells increased relative to the non-stem-cell population. Moreover, TDSCs from rat patellar tendons demonstrated higher clonogenicity with in vitro passaging [53], indicating that cell subculture might lead to increased expression of Sox2 which is critical for MSC self-renewal capacity [54].

To characterize the multipotency of the turkey TDSCs, we differentiated the tendon-derived cells for osteogenesis, chondrogenesis, and adipogenesis and found that tendon-derived cells had multilineage capacity. Further, we evaluated the gene expression of lineage-specific markers for trilineage differentiation. Differentiation of TDSCs into osteogenic lineage was confirmed by matrix mineralization and significant upregulation of bone markers SPP1, RUNX2, and BGLAP. Furthermore, adipogenic differentiation was shown by Oil red-O staining of lipid droplets within cells and by increases in aP2 gene expression, which is a late marker for adipocyte [55] but not PPARγ, which induced early during adipocyte differentiation [56]. The chondrogenic potential of TDSCs was demonstrated by synthesis of proteoglycans using Alcian blue stain analysis. The expression of COL2A1 and ACAN (major cartilage extracellular matrix components) [57] was upregulated but not SOX9, an early marker for chondrogenesis [58] in micromass cultures. Our findings regarding expression of PPARγ and SOX9 were different from previous studies by Rui et al. [35] who found an upregulation of PPARγ and SOX9 in rat TDSCs after adipogenic and chondrogenic induction, respectively. However, the negative feedback mechanisms as well as different species might account for the differences.

In conclusion, we have for the first time isolated and shown that TDSCs from turkey exhibit clonogenicity, MSC marker expression, and multilineage differentiation potential. The successful isolation of tendon-derived stem cells from turkey should prove to be an important model system for future research in tendon tissue engineering in terms of structure, function, and biology.

Acknowledgments

The study was funded by Obaid grant through Mayo Development Funds and Mayo Center for Biomedical Discovery Pilot Grant.

Conflicts of Interest

The authors declare that they have no conflict of interest.

Authors' Contributions

Qian Liu designed the study, performed the experiments, analyzed the data, and contributed to the writing and preparation of the manuscript. Yaxi Zhu helped perform the experiment (DNA electrophoresis) and analyzed the data. Anne Gingery, Peter C. Amadio, Steven L. Moran, and Chunfeng Zhao designed the experiments, analyzed the data, and contributed to the preparation of the manuscript. All authors have read and approved the final submitted manuscript.

References

  • 1.Clayton R. A. E., Court-Brown C. M. The epidemiology of musculoskeletal tendinous and ligamentous injuries. Injury. 2008;39(12):1338–1344. doi: 10.1016/j.injury.2008.06.021. [DOI] [PubMed] [Google Scholar]
  • 2.Jarvinen M. Epidemiology of tendon injuries in sports. Clinics in Sports Medicine. 1992;11(3):493–504. [PubMed] [Google Scholar]
  • 3.Praemer A., Furner S., Rice D. P., American Academy of Orthopaedic Surgeons . Musculoskeletal Conditions in the United States. 1st. Park Ridge, IL, USA: American Academy of Orthopaedic Surgeons; 1992. [Google Scholar]
  • 4.de Jong J. P., Nguyen J. T., Sonnema A. J. M., Nguyen E. C., Amadio P. C., Moran S. L. The incidence of acute traumatic tendon injuries in the hand and wrist: a 10-year population-based study. Clinics in Orthopedic Surgery. 2014;6(2):196–202. doi: 10.4055/cios.2014.6.2.196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Kelsey J. L. Upper Extremity Disorders: Frequency, Impact, and Cost. Churchill Livingstone; 1997. [Google Scholar]
  • 6.Rosberg H. E., Carlsson K. S., Hojgard S., Lindgren B., Lundborg G., Dahlin L. B. What determines the costs of repair and rehabilitation of flexor tendon injuries in zone II? A multiple regression analysis of data from southern Sweden. Journal of Hand Surgery (European Volume) 2003;28(2):106–112. doi: 10.1016/S0266-7681(02)00352-2. [DOI] [PubMed] [Google Scholar]
  • 7.Seiler J. G., III Flexor tendon repair. Journal of the American Society for Surgery of the Hand. 2001;1(3):177–191. doi: 10.1053/jssh.2001.26283. [DOI] [Google Scholar]
  • 8.Strickland J. W. Development of flexor tendon surgery: twenty-five years of progress. The Journal of Hand Surgery. 2000;25A(2):214–235. doi: 10.1053/jhsu.2000.jhsu25a0214. [DOI] [PubMed] [Google Scholar]
  • 9.Evans R. B. Managing the injured tendon: current concepts. Journal of Hand Therapy. 2012;25(2):173–189. doi: 10.1016/j.jht.2011.10.004. [DOI] [PubMed] [Google Scholar]
  • 10.Harris S. B., Harris D., Foster A. J., Elliot D. The aetiology of acute rupture of flexor tendon repairs in zones 1 and 2 of the fingers during early mobilization. Journal of Hand Surgery (European Volume) 1999;24(3):275–280. doi: 10.1054/JHSB.1998.0212. [DOI] [PubMed] [Google Scholar]
  • 11.Chong A. K. S., Ang A. D., Goh J. C. H., et al. Bone marrow-derived mesenchymal stem cells influence early tendon-healing in a rabbit Achilles tendon model. The Journal of Bone & Joint Surgery. 2007;89(1):74–81. doi: 10.2106/JBJS.E.01396. [DOI] [PubMed] [Google Scholar]
  • 12.Godwin E. E., Young N. J., Dudhia J., Beamish I. C., Smith R. K. W. Implantation of bone marrow-derived mesenchymal stem cells demonstrates improved outcome in horses with overstrain injury of the superficial digital flexor tendon. Equine Veterinary Journal. 2012;44(1):25–32. doi: 10.1111/j.2042-3306.2011.00363.x. [DOI] [PubMed] [Google Scholar]
  • 13.Hayashi M., Zhao C., An K. N., Amadio P. C. The effects of growth and differentiation factor 5 on bone marrow stromal cell transplants in an in vitro tendon healing model. The Journal of Hand Surgery (European Volume) 2011;36(4):271–279. doi: 10.1177/1753193410394521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Zhao C., Chieh H. F., Bakri K., et al. The effects of bone marrow stromal cell transplants on tendon healing in vitro. Medical Engineering & Physics. 2009;31(10):1271–1275. doi: 10.1016/j.medengphy.2009.08.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kobolak J., Dinnyes A., Memic A., Khademhosseini A., Mobasheri A. Mesenchymal stem cells: identification, phenotypic characterization, biological properties and potential for regenerative medicine through biomaterial micro-engineering of their niche. Methods. 2016;99:62–68. doi: 10.1016/j.ymeth.2015.09.016. [DOI] [PubMed] [Google Scholar]
  • 16.De Bari C., Dell'Accio F., Tylzanowski P., Luyten F. P. Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis & Rheumatism. 2001;44(8):1928–1942. doi: 10.1002/1529-0131(200108)44:8<1928::AID-ART331>3.0.CO;2-P. [DOI] [PubMed] [Google Scholar]
  • 17.Erices A., Conget P., Minguell J. J. Mesenchymal progenitor cells in human umbilical cord blood. British Journal of Haematology. 2000;109(1):235–242. doi: 10.1046/j.1365-2141.2000.01986.x. [DOI] [PubMed] [Google Scholar]
  • 18.Zuk P. A., Zhu M., Mizuno H., et al. Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Engineering. 2001;7(2):211–228. doi: 10.1089/107632701300062859. [DOI] [PubMed] [Google Scholar]
  • 19.Dowthwaite G. P., Bishop J. C., Redman S. N., et al. The surface of articular cartilage contains a progenitor cell population. Journal of Cell Science. 2004;117(6):889–897. doi: 10.1242/jcs.00912. [DOI] [PubMed] [Google Scholar]
  • 20.De Bari C., Dell'Accio F., Luyten F. P. Human periosteum-derived cells maintain phenotypic stability and chondrogenic potential throughout expansion regardless of donor age. Arthritis and Rheumatism. 2001;44(1):85–95. doi: 10.1002/1529-0131(200101)44:1<85::AID-ANR12>3.0.CO;2-6. [DOI] [PubMed] [Google Scholar]
  • 21.Filomeno P., Dayan V., Touriño C. Stem cell research and clinical development in tendon repair. Muscle, Ligaments and Tendons Journal. 2012;2(3):204–211. [PMC free article] [PubMed] [Google Scholar]
  • 22.Bunnell B. A., Flaat M., Gagliardi C., Patel B., Ripoll C. Adipose-derived stem cells: isolation, expansion and differentiation. Methods. 2008;45(2):115–120. doi: 10.1016/j.ymeth.2008.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Komatsu I., Wang J. H.-C., Iwasaki K., Shimizu T., Okano T. The effect of tendon stem/progenitor cell (TSC) sheet on the early tendon healing in a rat Achilles tendon injury model. Acta Biomaterialia. 2016;42:136–146. doi: 10.1016/j.actbio.2016.06.026. [DOI] [PubMed] [Google Scholar]
  • 24.Lui P. P. Y., Wong O. T., Lee Y. W. Application of tendon-derived stem cell sheet for the promotion of graft healing in anterior cruciate ligament reconstruction. The American Journal of Sports Medicine. 2014;42(3):681–689. doi: 10.1177/0363546513517539. [DOI] [PubMed] [Google Scholar]
  • 25.Ni M., Lui P. P. Y., Rui Y. F., et al. Tendon-derived stem cells (TDSCs) promote tendon repair in a rat patellar tendon window defect model. Journal of Orthopaedic Research. 2012;30(4):613–619. doi: 10.1002/jor.21559. [DOI] [PubMed] [Google Scholar]
  • 26.Bi Y., Ehirchiou D., Kilts T. M., et al. Identification of tendon stem/progenitor cells and the role of the extracellular matrix in their niche. Nature Medicine. 2007;13(10):1219–1227. doi: 10.1038/nm1630. [DOI] [PubMed] [Google Scholar]
  • 27.Rui Y. F., Lui P. P. Y., Lee Y. W., Chan K. M. Higher BMP receptor expression and BMP-2-induced osteogenic differentiation in tendon-derived stem cells compared with bone-marrow-derived mesenchymal stem cells. International Orthopaedics. 2012;36(5):1099–1107. doi: 10.1007/s00264-011-1417-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Tan Q., Lui P. P. Y., Rui Y. F., Wong Y. M. Comparison of potentials of stem cells isolated from tendon and bone marrow for musculoskeletal tissue engineering. Tissue Engineering Part A. 2012;18(7-8):840–851. doi: 10.1089/ten.tea.2011.0362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Guo J., Chan K. M., Zhang J. F., Li G. Tendon-derived stem cells undergo spontaneous tenogenic differentiation. Experimental Cell Research. 2016;341(1):1–7. doi: 10.1016/j.yexcr.2016.01.007. [DOI] [PubMed] [Google Scholar]
  • 30.Gelberman R. H., Khabie V., Cahill C. J. The revascularization of healing flexor tendons in the digital sheath. A vascular injection study in dogs. The Journal of Bone & Joint Surgery. 1991;73(6):868–881. doi: 10.2106/00004623-199173060-00009. [DOI] [PubMed] [Google Scholar]
  • 31.Manske P. R., Lesker P. A. Comparative nutrient pathways to the flexor profundus tendons in zone II of various experimental animals. Journal of Surgical Research. 1983;34(1):83–93. doi: 10.1016/0022-4804(83)90024-0. [DOI] [PubMed] [Google Scholar]
  • 32.Gelberman R. H., Manske P. R., Vande Berg J. S., Lesker P. A., Akeson W. H. Flexor tendon repair in vitro: a comparative histologic study of the rabbit, chicken, dog, and monkey. Journal of Orthopaedic Research. 1984;2(1):39–48. doi: 10.1002/jor.1100020107. [DOI] [PubMed] [Google Scholar]
  • 33.Farkas L. G., Thomson H. G., Martin R., Farkas L. G. Some practical notes on the anatomy of the chicken toe for surgeon investigators. Plastic and Reconstructive Surgery. 1974;54(4):452–458. doi: 10.1097/00006534-197410000-00010. [DOI] [PubMed] [Google Scholar]
  • 34.Kadar A., de Sousa G., Peyre L., Wortham H., Doumenq P., Rahmani R. Evidence of in vitro metabolic interaction effects of a chlorfenvinphos, ethion and linuron mixture on human hepatic detoxification rates. Chemosphere. 2017;181:666–674. doi: 10.1016/j.chemosphere.2017.04.116. [DOI] [PubMed] [Google Scholar]
  • 35.Rui Y.-F., Lui P. P. Y., Li G., Fu S. C., Lee Y. W., Chan K. M. Isolation and characterization of multipotent rat tendon-derived stem cells. Tissue Engineering Part A. 2010;16(5):1549–1558. doi: 10.1089/ten.tea.2009.0529. [DOI] [PubMed] [Google Scholar]
  • 36.Khatri M., O’Brien T. D., Sharma J. M. Isolation and differentiation of chicken mesenchymal stem cells from bone marrow. Stem Cells and Development. 2009;18(10):1485–1492. doi: 10.1089/scd.2008.0223. [DOI] [PubMed] [Google Scholar]
  • 37.Pittenger M. F., Mackay A. M., Beck S. C., et al. Multilineage potential of adult human mesenchymal stem cells. Science. 1999;284(5411):143–147. doi: 10.1126/science.284.5411.143. [DOI] [PubMed] [Google Scholar]
  • 38.Scharstuhl A., Schewe B., Benz K., Gaissmaier C., Buhring H. J., Stoop R. Chondrogenic potential of human adult mesenchymal stem cells is independent of age or osteoarthritis etiology. Stem Cells. 2007;25(12):3244–3251. doi: 10.1634/stemcells.2007-0300. [DOI] [PubMed] [Google Scholar]
  • 39.Gronthos S., Zannettino A. C., Hay S. J., et al. Molecular and cellular characterisation of highly purified stromal stem cells derived from human bone marrow. Journal of Cell Science. 2003;116(9):1827–1835. doi: 10.1242/jcs.00369. [DOI] [PubMed] [Google Scholar]
  • 40.Kadar A., Thoreson A. R., Reisdorf R. L., Amadio P. C., Moran S. L., Zhao C. Turkey model for flexor tendon research: in vitro comparison of human, canine, turkey, and chicken tendons. Journal of Surgical Research. 2017;216:46–55. doi: 10.1016/j.jss.2017.03.035. [DOI] [PubMed] [Google Scholar]
  • 41.Bigi A., Ripamonti A., Koch M. H. J., Roveri N. Calcified turkey leg tendon as structural model for bone mineralization. International Journal of Biological Macromolecules. 1988;10(5):282–286. doi: 10.1016/0141-8130(88)90005-0. [DOI] [Google Scholar]
  • 42.Fratzl P., Fratzl-Zelman N., Klaushofer K. Collagen packing and mineralization: an X-ray scattering investigation of turkey leg tendon. Biophysical Journal. 1993;64(1):260–266. doi: 10.1016/S0006-3495(93)81362-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Kerns J. G., Buckley K., Churchwell J., Parker A. W., Matousek P., Goodship A. E. Is the collagen primed for mineralization in specific regions of the turkey tendon? An investigation of the protein–mineral interface using Raman spectroscopy. Analytical Chemistry. 2016;88(3):1559–1563. doi: 10.1021/acs.analchem.5b00406. [DOI] [PubMed] [Google Scholar]
  • 44.Karlander L. E., Berggren M., Larsson M., Soderberg G., Nylander G. Improved results in zone 2 flexor tendon injuries with a modified technique of immediate controlled mobilization. Journal of Hand Surgery (European Volume) 1993;18(1):26–30. doi: 10.1016/0266-7681(93)90189-M. [DOI] [PubMed] [Google Scholar]
  • 45.Kolf C. M., Cho E., Tuan R. S. Mesenchymal stromal cells. Biology of adult mesenchymal stem cells: regulation of niche, self-renewal and differentiation. Arthritis Research & Therapy. 2007;9(1):p. 204. doi: 10.1186/ar2116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Dominici M., Le Blanc K., Mueller I., et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy. 2006;8(4):315–317. doi: 10.1080/14653240600855905. [DOI] [PubMed] [Google Scholar]
  • 47.Liu H., Zhu S., Zhang C., et al. Crucial transcription factors in tendon development and differentiation: their potential for tendon regeneration. Cell and Tissue Research. 2014;356(2):287–298. doi: 10.1007/s00441-014-1834-8. [DOI] [PubMed] [Google Scholar]
  • 48.Ni M., Rui Y. F., Tan Q., et al. Engineered scaffold-free tendon tissue produced by tendon-derived stem cells. Biomaterials. 2013;34(8):2024–2037. doi: 10.1016/j.biomaterials.2012.11.046. [DOI] [PubMed] [Google Scholar]
  • 49.Lavial F., Acloque H., Bertocchini F., et al. The Oct4 homologue PouV and Nanog regulate pluripotency in chicken embryonic stem cells. Development. 2007;134(19):3549–3563. doi: 10.1242/dev.006569. [DOI] [PubMed] [Google Scholar]
  • 50.Avilion A. A., Nicolis S. K., Pevny L. H., Perez L., Vivian N., Lovell-Badge R. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes & Development. 2003;17(1):126–140. doi: 10.1101/gad.224503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Chambers I., Colby D., Robertson M., et al. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell. 2003;113(5):643–655. doi: 10.1016/S0092-8674(03)00392-1. [DOI] [PubMed] [Google Scholar]
  • 52.Zhang J., Wang J. H.-C. Characterization of differential properties of rabbit tendon stem cells and tenocytes. BMC Musculoskeletal Disorders. 2010;11(1):p. 10. doi: 10.1186/1471-2474-11-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Tan Q., Lui P. P. Y., Rui Y. F. Effect of in vitro passaging on the stem cell-related properties of tendon-derived stem cells-implications in tissue engineering. Stem Cells and Development. 2012;21(5):790–800. doi: 10.1089/scd.2011.0160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Yoon D. S., Choi Y., Jang Y., et al. SIRT1 directly regulates SOX2 to maintain self-renewal and multipotency in bone marrow-derived mesenchymal stem cells. Stem Cells. 2014;32(12):3219–3231. doi: 10.1002/stem.1811. [DOI] [PubMed] [Google Scholar]
  • 55.Gregoire F. M., Smas C. M., Sul H. S. Understanding adipocyte differentiation. Physiological Reviews. 1998;78(3):783–809. doi: 10.1152/physrev.1998.78.3.783. [DOI] [PubMed] [Google Scholar]
  • 56.Chawla A., Schwarz E. J., Dimaculangan D. D., Lazar M. A. Peroxisome proliferator-activated receptor (PPAR) gamma: adipose-predominant expression and induction early in adipocyte differentiation. Endocrinology. 1994;135(2):798–800. doi: 10.1210/endo.135.2.8033830. [DOI] [PubMed] [Google Scholar]
  • 57.Djouad F., Mrugala D., Noel D., Jorgensen C. Engineered mesenchymal stem cells for cartilage repair. Regenerative Medicine. 2006;1(4):529–537. doi: 10.2217/17460751.1.4.529. [DOI] [PubMed] [Google Scholar]
  • 58.Lefebvre V., De Crombrugghe B. Toward understanding SOX9 function in chondrocyte differentiation. Matrix Biology. 1998;16(9):529–540. doi: 10.1016/S0945-053X(98)90065-8. [DOI] [PubMed] [Google Scholar]

Articles from Stem Cells International are provided here courtesy of Wiley

RESOURCES