Skip to main content
Cerebral Cortex (New York, NY) logoLink to Cerebral Cortex (New York, NY)
. 2017 May 2;28(6):1959–1979. doi: 10.1093/cercor/bhx102

Cortical nNOS/NK1 Receptor Neurons are Regulated by Cholinergic Projections From the Basal Forebrain

Rhîannan H Williams 1, Jacqueline Vazquez-DeRose 1, Alexia M Thomas 1, Juliette Piquet 2,3,4, Bruno Cauli 2,3,4, Thomas S Kilduff 1,✉
PMCID: PMC6018957  PMID: 28472227

Abstract

Cholinergic (ACh) basal forebrain (BF) neurons are active during wakefulness and rapid eye movement (REM) sleep and are involved in sleep homeostasis. We have previously shown in adult animals that cortical neurons that express neuronal nitric oxide synthase (nNOS) and the receptor for Substance P (NK1R) are activated during non-REM (NREM) sleep in proportion to homeostatic sleep drive. Here, we show that BF neurons modulate cortical nNOS/NK1R cells. In vitro optogenetic stimulation of BF terminals both activated and inhibited nNOS/NK1R neurons. Pharmacological studies revealed cholinergic responses mediated by postsynaptic activation of muscarinic receptors (mAChRs; M3R > M2/4R > M1R) and that presynaptic M3R and M2R activation reduced glutamatergic input onto nNOS/NK1R neurons whereas nicotinic receptor (nAChR)-mediated responses of nNOS/NK1R neurons were mixed. Cholinergic responses of nNOS/NK1R neurons were largely unaffected by prolonged wakefulness. ACh release, including from BF cells, appears to largely excite cortical nNOS/NK1R cells while reducing glutamatergic inputs onto these neurons. We propose that cholinergic signaling onto cortical nNOS/NK1R neurons may contribute to the regulation of cortical activity across arousal states, but that this response is likely independent of the role of these neurons in sleep homeostasis.

Keywords: acetylcholine, arousal, cortex, muscarinic, nicotinic, nitric oxide, sleep, wakefulness

Introduction

Sleep/wake and rest/activity cycles are thought to be homeostatically regulated processes throughout the animal kingdom. In mammals, slow wave activity (SWA; 0.5–4.0 Hz) recorded in the electroencephalogram (EEG) during nonrapid eye movement (NREM) sleep declines across a sleep period but increases as wakefulness is extended (Borbely 1982). EEG SWA is thus considered to be a neurophysiological index of homeostatic sleep pressure that reflects underlying neurochemical processes. The slow waves that comprise EEG SWA are thought to be generated by a corticothalamocortical loop involving intrinsic cortical and thalamic oscillators (Steriade et al. 1993; Crunelli and Hughes 2010).

We have described a population of cortical neurons with elevated activation (c-FOS immediate early gene expression) preferentially during sleep in three mammalian species (Gerashchenko et al. 2008; Pasumarthi et al. 2010; Morairty et al. 2013; Dittrich et al. 2015). In these GABAergic cortical neurons, activation is proportional to time kept awake and increases in conjunction with elevated homeostatic sleep “drive.” This rare cortical neuron population can be identified in mouse brain by coexpression of neuronal nitric oxide synthase (nNOS) and NK1R, the receptor for Substance P (Dittrich et al. 2012). These cells correspond to Type I nNOS neurons that are preferentially found in the deep layers of the cortex (Yan and Garey 1997; Smiley et al. 2000; Lee and Jeon 2005). Because cortical Type I nNOS cells are projection rather than local circuit interneurons (Tomioka et al. 2005; Higo et al. 2007; Tomioka and Rockland 2007; Higo et al. 2009), they have the capacity to have widespread influence on the cortex through a combination of GABAergic, peptidergic and nitrinergic neurotransmission. Accordingly, we have proposed that cortical nNOS/NK1R neurons may be a previously unrecognized substrate for homeostatic sleep regulation (Kilduff et al. 2011).

Due to their scarcity, little information exists regarding the electrophysiological properties of cortical nNOS/NK1R neurons or their neurochemical regulation. Unsupervised cluster analysis on a sample of interneurons expressing nNOS mRNA identified a class of cells that likely corresponds to Type I nNOS neurons (Perrenoud et al. 2012). These putative Type I nNOS cells had large somata that coexpressed somatostatin (SOM) and Neuropeptide Y, displayed adapting discharges, fired long duration action potential spikes followed by fast afterhyperpolarization (fAHP), and had significantly slower membrane time constants than other interneurons. Such cortical nNOS neurons have been reported to receive both serotonergic and cholinergic inputs (Cauli et al. 2004; Dittrich et al. 2012).

Since cortical nNOS/NK1R neurons preferentially express c-FOS during sleep, we have hypothesized that these cells are functionally inhibited during wakefulness by the wake-active monoaminergic and cholinergic cell groups and that c-FOS expression occurs during sleep partly as a consequence of disfacilitation of wake-active cell groups (Kilduff et al. 2011). Among wake-active populations, the basal forebrain (BF) cholinergic neurons have been reported to project to cortical nNOS neurons in the rat (Vaucher et al. 1997) and electrical stimulation of the rat BF increases c-FOS bilaterally in nNOS neurons, suggesting an excitatory BF projection to these cells (Kocharyan et al. 2008). Since ACh responses are highly variable across cortical layers and among GABAergic interneurons (Kawaguchi 1997; Gulledge et al. 2007), how deep layer Type I cortical nNOS/NK1R neurons are affected is unclear. Here, we show that the nNOS/NK1R cells are predominantly activated by cholinergic afferents, including those from the BF, and that this response is age-independent. We also establish that c-FOS expression in cortical nNOS/NK1R cells is elevated with increased sleep pressure in juvenile, as well as adult, mice.

Materials and Methods

Animals

All rodents were maintained under 12 h light:12 h dark conditions at 22 ± 2°C and 50 ± 25% relative humidity with food and water ad libitum and were treated in accordance with guidelines from the NIH Guide for the Care and Use of Laboratory Animals. All protocols were approved by SRI International’s Institutional Animal Care and Use Committee. C57Bl/6J mice were used for in vitro electrophysiological slice recordings (P14-23, male and female), anterograde tracer experiments (6–8 weeks old, male and female) and the sleep deprivation (SD) experiments (P19-21, male and female). Two strains were used for the optogenetic experiments: (1) > 10 week old male and female nNOS-CreER;Ai14 progeny, produced by crossing nNOS-CreER (B6;129S-Nos1tm1.1(cre/ERT2)Zjh/J; Jackson Laboratories strain #014541) and Ai14 mice (B6;129S6-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J; Jackson Laboratories strain #007914), and (2) P21-24 male and female ChAT-IRES-Cre;Ai32 progeny, produced by crossing ChAT-IRES-Cre (B6;129S6-Chattm2.1(cre)Lowl/J; Jackson Laboratories strain #006410) and Ai32 mice (B6;129S6-Gt(ROSA)26Sortm32(CAG-CAG-COP4*H134R/EYFP)Hze/J; Jackson Laboratories strain #012569). Brains from Chrna2-cre; R26tom mice, used exclusively for immunohistochemical studies, were obtained from Professor Klas Kullander, Uppsala University, Uppsala, Sweden.

Stereotaxic Injections

Neuronal Tracing

We unilaterally microinjected 50 nL of 5% biotinylated-dextran amine (BDA; D-1956, Life Technologies) in sterile 0.5 M phosphate-buffered saline (PBS) into the BF region of male and female C57Bl/6 J mice, targeting the magnocellular preoptic/ substantia innominata (MCPO/SI, AP: 0.15 mm; ML: −1.2 mm; DV: −5.6 mm) (Franklin and Paxinos 2007). Injections occurred over 5 min, pausing an additional 15 min at the injection site before the microinjector was slowly removed to prevent transport up the injection tract. Two weeks later, mice were sacrificed, perfused with 4% paraformaldehyde (PFA), and brains taken for immunohistochemistry.

Expression of Channelrhodopsin in the Mouse BF

Using the same microinjection method and injection site coordinates as in the neuronal tracing experiments, we unilaterally microinjected 100 nL of an adeno-associated viral (AAV) vector that encoded channelrhodopsin (ChR2) into the BF of male and female nNOS-CreER;Ai14 mice. This AAV-ChR2(H134R)-eYFP virus (titer: 3.39 × 1013 genomic copies/mL; construct: AAV9-hSYN-hChR2(H134R)-eYFP-WPRE-hGH; from Dr. K. Deisseroth, Stanford University) (Jackman et al. 2014) was obtained from the Penn Vector Core (University of Pennsylvania). Three weeks after AAV injections, we injected tamoxifen (75 mg/kg, i.p.) to induce Cre expression in nNOS neurons. Mice were 4–6 months old when they were sacrificed for in vitro optogenetic studies, followed by immunohistochemistry to identify viral expression within the BF and ChR2-containing fibers in the cortical recording site.

Cortical Area of Interest

For all experiments, we principally targeted layer V-VI nNOS/NK1R cells at the border of the cingulum between motor cortex 1 and cingulate cortex 2 (Bregma: 0.74–0.26 mm) (Franklin and Paxinos 2007). This region of interest was chosen because it has a relatively dense expression of nNOS/NK1R neurons and was readily identified across slices in the multiple experimental preparations used.

Sleep Deprivation of Juvenile Mice

For experiments related to sleep homeostasis, the reference point used was lights-on or ZT (Zeitgeber Time) 0, when sleep pressure is high. To determine whether activation of nNOS/NK1R cells occurs during sleep in young mice as occurs in adult rodents (Gerashchenko et al. 2008; Morairty et al. 2013), cohorts of juvenile (P19-21) mice, separated from their parents, were assigned to one of the following experimental groups (n = 3–4/group): (1) 4 h SD, (2) 4 h SD followed by 90 min recovery sleep (RS), (3) undisturbed (“UndistB”) ZT4 control, and (4) undisturbed ZT5.5 control. SD was initiated at lights on (ZT0; 6:00 am) and consisted of gentle handling and/or light cage tapping in the home cage to keep mice awake for the 4 h duration. Undisturbed mice remained in their home cage and were untouched by the experimenter; mice in the RS group were undisturbed for 90 min after the 4 h SD period.

Immunohistochemistry and Cell Counting

Juvenile Mice

Mice were given a terminal injection of SomnaSol (Henry Schein) before being transcardially perfused with PBS and heparin followed by 4% PFA. After removal of the brain, the tissue was cryprotected (30% sucrose, 0.1 M PB solution) and cut into six series of 30 μm thick coronal sections. One series of six sections from each mouse was then processed in rabbit anti-c-FOS (1:8000, sc-52, Santa Cruz Biotechnology) and goat anti-nNOS (1:3000, ab1376, abcam). The secondary antibodies used were donkey antirabbit IgG (1:1000, Jackson ImmunoResearch) and Alexa Fluor 594 affiniPure donkey antigoat IgG (1:500, Jackson ImmunoResearch). C-FOS was detected with nickel-enhanced 3,3′ diaminobenzidine tetrahydrochloride (nDAB; 10 min; SK4100, Vector Laboratories).

Tracing of BF Efferent Projections

One series of four sections from each mouse (n = 3) was then processed with nDAB (10 min; SK4100, Vector Laboratories) to detect the BDA before secondary detection using goat anti-nNOS (1:3000, ab1376, abcam), followed by donkey antigoat IgG (1:1000, Jackson ImmunoResearch) and 3,3′ diaminobenzidine tetrahydrochloride (2 min; SK4100, Vector Laboratories).

nNOS-CreER;Ai14 Mice

For nNOS cell counts, two 4% PFA-fixed brains (male, 10-week age) were prepared for histological analysis as above. One series of three sections from each mouse was processed in rabbit anti-RFP (1:3000, Rockland) and goat anti-nNOS (1:3000, ab1376, abcam). The secondary antibodies used were Alexa Fluor 594 affiniPure donkey antirabbit IgG (1:1000, Jackson ImmunoResearch) and Alexa Fluor 488 affiniPure donkey antigoat IgG (1:100, Jackson ImmunoResearch). For confirmation of ChR2 transduction in BF-injected mice, sections (250 μm) were postfixed following sacrifice for in vitro electrophysiology and coronal slices were resectioned (40 μm thick). BF sections were processed in goat anti-ChAT (1:1000, AB144, EMD Millipore) and chicken anti-GFP (detects ChR2-eYFP, 1:500, 24 h; abcam), while cingulate cortex sections anterior to the BF were processed with goat anti-nNOS (1:3000, ab1376, abcam) and chicken anti-GFP. The secondary antibodies used were donkey antigoat IgG (1:1000, Jackson ImmunoResearch) followed by streptavidin coumarin AMCA conjugate (1:500, 2 h; Jackson ImmunoResearch), and Alexa Fluor 488 affiniPure donkey antichicken IgG (for GFP; 1:500, 1 h; Jackson ImmunoResearch).

Chrna2-Cre; R26tom Mice

Two 4% PFA-fixed brains, one female 3-week juvenile and one female 18-week adult (gift from Professor Kullander, Uppsala University) (Leao et al. 2012; Perry et al. 2015), were prepared for histological analysis as above. One series of six sections from each mouse was processed in rabbit anti-RFP (1:3000, Rockland) and goat anti-nNOS (1:3000, ab1376, abcam). The secondary antibodies used were Alexa Fluor 594 affiniPure donkey antirabbit IgG (1:1000, Jackson ImmunoResearch) and Alexa Fluor 488 affiniPure donkey antigoat IgG (1:100, Jackson ImmunoResearch).

Postrecording Verification of Cell Phenotype

To confirm that cells recorded from WT, nNOS-CreER;Ai14 and ChAT-Cre;Ai32 mice in the pharmacological and optogenetic experiments were layer V-VI nNOS/NK1R neurons, brain slices were postfixed in 4% PFA, resectioned, and processed for immunohistochemical markers as above. For neurobiotin staining, the secondary streptavidin, Alexa Fluor 594 conjugate (1:250, 1 h; ThermoFisher Scientific) was used. For cells collected for scRT-PCR, slices were postfixed in 4% PFA before processing for biocytin and nNOS. Thick sections (250 μm) were incubated overnight in goat anti-nNOS (1:1000, abcam) and then Alexa Fluor 594 affiniPure donkey antigoat IgG (1:1000, 2 h; Jackson ImmunoResearch) with streptavidin-conjugated fluorescein (DTAF; for biocytin; 1:500, 2 h; Jackson ImmunoResearch). Sections were mounted using Pro-Long Diamond antifade mountant with DAPI (P36966, ThermoFisher Scientific) and images captured using A1 confocal laser microscope system (Nikon) and NIS-elements software (Nikon).

Cell Counts and Tracing

Excluding images from thick sections, all other images were taken on Leica CTR 5000 microscope and superimposed in Adobe Photoshop. The region counted matched the cortical area of interest. The number of nNOS neurons and the number of nNOS cells colocalizing with either c-FOS or RFP in Layer V-VI of the region of interest were counted in 4–6 hemispheres per mouse. The percentage of colocalized nNOS cells per mouse was calculated and the grouped data expressed as mean ± SEM. Specificity of the RFP reporter for nNOS neurons was assessed by counting the number of neurons costained for RFP and nNOS as a percentage of the total RFP cell count. Transduction efficiency was calculated by counting the number of neurons costained for RFP and nNOS as a percentage of the total nNOS cell count.

Antibody Characterization

The specificity of the primary goat antineuronal nitric oxide antibody (nNOS, abcam) was tested by comparing colocalization with the previously characterized rabbit anti-nNOS (Invitrogen). There was 100% overlap between the antibodies. The specificity of the primary antibody for red fluorescent protein (RFP, Rockland) was indicated by the selective coexpression with nNOS in nNOS-CreER;Ai14 mice. All other primary antibodies were taken from the JCN antibody database (http://onlinelibrary.wiley.com/journal/10.1002/(ISSN)1096-9861/homepage/jcn_antibody_database.htm). Specificity of all secondary antibodies was confirmed by omitting the primary antibodies and analyzing the brain tissue for immunoreactivity. None of the secondary antibodies used in negative primary controls demonstrated immunoreactivity above background levels.

In Vitro Electrophysiology

Coronal brain slices (250 μm) were prepared in ice-cold, oxygenated (95% O2, 5% CO2) sucrose-based artificial cerebral spinal fluid (aCSF) containing (in mM): 250 sucrose, 2.5 KCl, 1.24 NaH2PO4, 10 MgCl2, 10 glucose, 26 NaHCO3, 0.5 CaCl2 (305 mOsm/L). Slices were incubated in aCSF containing (in mM): 124 NaCl, 2.5 KCl, 1.24 NaH2PO4, 1.3 MgCl2, 10 glucose, 26 NaHCO3, 2.5 CaCl2 (300 mOsm/L) at 37°C for 15 min. Thereafter, slices were maintained and recorded at 22°C with aCSF flow rate of ~1 mL/min.

For voltage- and current-clamp recordings, the pipette solution contained (in mM): 130 K-gluconate, two KCl, three MgCl2, two MgATP, 0.2 Na2GTP, 10 HEPES, 0.2 EGTA (290 mOsm/L, pH 7.3). To enable visualization of patched cells during recording, 0.1% Lucifer Yellow was included in the pipette solution as well as 0.01% neurobiotin (NB) to facilitate post hoc identification of patched cells. All recordings were acquired with a MultiClamp 700 A amplifier, Digidata 1322 A digitizer interface and pClamp nine software (Molecular Devices). Voltage-clamp data were sampled at 7 kHz and filtered at 3 kHZ; current-clamp data were sampled at 20–25 kHZ and filtered at 10 kHz. Changes in input resistance (Rin) were monitored across the experiments by injecting hyperpolarizing steps (−20 pA or −40 pA) periodically by switching from voltage-clamp mode and recording in current-clamp mode. Voltage-clamp recordings were then concatenated to remove breaks. Series resistance varied from 10–60 MΩ and was monitored during voltage-clamp recordings. Any neurons deviating >10% in series resistance over time were excluded from analysis; the bridge balance was maintained and monitored during current-clamp recordings. Membrane potential measurements were not corrected for the theoretical liquid junction potential of −15 mV between pipette solution and bath solution. The reference electrode was a Ag/AgCl– pellet.

Recordings of Cortical nNOS/NK1R Neurons From WT Mice

Layer V-VI nNOS/NK1R neurons were identified following a brief bath application of substance P-conjugated tetramethylrhodamine (SP-TMR, 50 nM), a fluorescent ligand for the NK1R receptor (Dittrich et al. 2012). Following a 20 min washout period, internalization of receptor-bound fluorescent ligand enabled visualization of nNOS/NK1R cells for patch-clamp recording.

Recordings of Cortical nNOS Neurons From nNOS-CreER;Ai14 Mice and Photostimulation of BF Afferents

Cortical nNOS neurons in adult nNOS-CreER;Ai14 mice were identified on the basis of their anatomical location and expression of the fluorescent tdTomato marker. For current-clamp recordings, nNOS neurons were recorded at their resting membrane potential (RMP) and any deviations in membrane potential (Vm) due to photostimulation were determined.

Photostimulation of Cholinergic Afferents onto Cortical nNOS/NK1R Neurons

For optogenetic experiments, the photostimulation protocol to activate ChR2 in BF terminals was a 5 ms pulse at 1 Hz. ChR2-expressing BF neurons, axons, and terminals were activated by full-field 470 nm light pulses via a blue-light-emitting diode (Lumencor Spectra light engine, Lumencor). This light source was coupled to the epifluorescence light path of an upright Leica DM LFSA microscope (Leica Microsystems, Germany). When light was applied through a 40x objective, a 1 mm wide beam with ~10 mW/mm2 power density was produced that had minimal tissue heating effects as we previously reported (Williams et al. 2014). Photostimulation was repeated in the presence of glutamatergic (CNQX, 7 μM; AP-5 100 μM) and GABAergic (2-HS, 5 μM; BIC, 10 μM) blockers. Application of glutamate blockers alone removed all sEPSC activity; muscarinic antagonist (atropine, AT, 5 μM) was then tested in nNOS cells that responded to photostimulation. Temporal fidelity was calculated as the percentage of light-evoked EPSCs (oEPSCs; Vh was −60 mV) concordant with blue-light application. Due to variability in baseline membrane potential and action potential threshold, cells were injected with current to hold the baseline value around −61 mV between cells for pharmacological applications in current-clamp recordings.

Recordings of Cholinergic BF Neurons From ChAT-IRES-Cre;Ai32 Mice

Cholinergic neurons of the BF (MCPO/SI) were identified by eYFP fluorescence. Both voltage-clamp and current-clamp protocols were used to assess the temporal fidelity of ChR2 expression by applying 0.25–100 Hz pulse trains (5 ms pulse width; 20 s photostimulation period every 40 s, repeated for three trials) from a blue-light-emitting diode (470 nm light, Lumencor Spectra Light Engine). These data provide an insight into the efficiency of optogenetic stimulation of cholinergic cell bodies and thus the ability to drive terminal ACh release in the cortex (Fig. S1D).

Recording From nNOS/NK1R Clls in Juvenile Mice Subjected to Sleep Deprivation

To determine whether prolonged wakefulness affected the response of cortical nNOS/NK1R neurons to carbachol (CCh) application (see Results), juvenile mice (male and female, P14-23) were sleep deprived from ZT0 for 4 h as described above before being sacrificed for in vitro electrophysiology.

Electrophysiological Properties of nNOS/NK1R Cells

To study the basic electrophysiological properties of nNOS/NK1R neurons labeled with SP-TMR or tdTomato, we recorded a 2 s baseline before injecting a hyperpolarizing pulse (1 s, −40 pA increments) to assess the presence of a hyperpolarization-activated cation current (Ih), and rebound depolarization. These were calculated by measuring the deviations in Vm toward the end of current injection relative to the start of current injection (Ih) or the rebound Vm level 70 ms after the end of current injection relative to baseline. Spike ratio was calculated by counting the number of spikes in the 500 ms before injection of a −80 pA hyperpolarizing pulse divided by the number of spikes within the first 500 ms after the end of the pulse. In addition, depolarizing pulses (1 s, +40 pA increments) were used to assess spike frequency, the Vm for first spiking activity, and afterhyperpolarization (AHP). AHP was measured on a single spike per cell at the Vm for first spiking activity. AHP calculated was the medium AHP (mAHP), measured as the initial deflection (within ~20 ms of spike termination) past baseline Vm relative to the action potential firing threshold (Lape and Nistri 2000; Matthews et al. 2009). Since SOM-containing neurons are known to have a fast AHP (fAHP) and concomitant afterdepolarization (ADP) (Karagiannis et al. 2009), these parameters were also measured if present.

Cytoplasm Harvest and Single-Cell Reverse Transcription/Polymerase Chain Reaction

At the end of whole-cell recordings that lasted less than 20 min, the cytoplasmic content was aspirated into the recording pipette. The content of the pipette was expelled into a test tube and RT was performed in a final volume of 10 μl as described previously (Lambolez et al. 1992). The single-cell reverse transcription/polymerase chain reaction (scRT-PCR) protocol was designed to probe simultaneously for the expression of acetylcholine receptor mRNAs and mRNAs encoding well-established markers of cortical Type I NOS interneurons (Ascoli et al. 2008; Karagiannis et al. 2009; Dittrich et al. 2012). Acetylcholine receptors assessed included the alpha and beta nicotinic receptor (nAChR) subunits nAChRa2, nAChRa3, nAChRa4, nAChRa5, nAChRa6, nAChRa7, nAChRb2, nAChRb3, and nAChRb4 and the muscarinic receptor (mAChR) subtypes mAChR1, mAChR2, mAChR3, mAChR4, and mAChR5. Neuronal markers included the two isoforms of Glutamic Acid Decarboxylase (GAD65 and GAD67), Somatostatin (SOM), Neuropeptide Y (NPY), the neuronal isoform of Nitric Oxide Synthase (nNOS), and the substance P receptor (NK1R). The SOM intron (SOM int) was also included as an indicator of the presence of genomic DNA that can occur when the nucleus is harvested (Hill et al. 2007). A two-step amplification was performed essentially as described (Cauli et al. 1997; Cabezas et al. 2013) using the primer pairs listed in Table 1. All primer pairs were designed to span introns except those for mAChR1, mAChR2, mAChR3, mAChR4, mAChR5 and the SOM intron. A 10 μL of each individual PCR product were run on a 2% agarose gel stained with ethidium bromide using ФX174 digested by HaeIII as a molecular weight marker. The RT-PCR protocol was tested on 1 ng of total RNA purified from mouse whole brain. All amplicons detected were the sizes predicted from published sequences (Table 1). In 13 cells analyzed, six contained a positive result for the SOM intron and were excluded from the mAChR dataset to avoid false positives.

Table 1.

PCR primers used to amplify GABA interneuron markers and cholinergic receptor mRNAs

Genes accession # First PCR primers Size (bp) Second PCR nested primers Size (bp)
GAD65 NM_008078 Sense, 99: CCAAAAGTTCACGGGCGG 375 Sense, 219: CACCTGCGACCAAAAACCCT Cabezas et al. (2013) 248
Antisense, 454: TCCTCCAGATTTTGCGGTTG Cabezas et al. (2013) Antisense, 447: GATTTTGCGGTTGGTCTGCC Cabezas et al. (2013)
GAD67 NM_008077 Sense, 529: TACGGGGTTCGCACAGGTC Cabezas et al. (2013) 598 Sense, 801: CCCAGAAGTGAAGACAAAAGGC Cabezas et al. (2013) 255
Antisense, 1109: CCCAGGCAGCATCCACAT Cabezas et al. (2013) Antisense, 1034: AATGCTCCGTAAACAGTCGTGC Cabezas et al. (2013)
SOM NM_009 215 Sense, 43: ATCGTCCTGGCTTTGGGC Cauli et al. (1997) 208 Sense, 75: GCCCTCGGACCCCAGACT Gallopin et al. (2006) 146
Antisense, 231: GCCTCATCTCGTCCTGCTCA Cauli et al. (1997) Antisense, 203: GCAAATCCTCGGGCTCCA
NPY NM_023456 Sense, 16: CGAATGGGGCTGTGTGGA Cabezas et al. (2013) 294 Sense, 38: CCCTCGCTCTATCTCTGCTCGT Cabezas et al. (2013) 220
Antisense, 286: AAGTTTCATTTCCCATCACCACAT Cabezas et al. (2013) Antisense, 236: GCGTTTTCTGTGCTTTCCTTCA Cabezas et al. (2013)
nNOS NM_008712 Sense, 3009: GCAAAGTCCTAAATCCAGCCGA 416 Sense, 3034: ACCATCTTCGTGCGTCTCCA 334
Antisense, 3403: TGCCCCATTTCCATTCCTCATA Antisense, 3346: GCTTCTCTTTCTCATTGGTGGC
NK1R NM_009313 Sense, 30: TCTCTTCCCCAACACCTCCA 449 Sense, 123: CATCGTGGTGACTTCCGTGG 294
Antisense, 459: GGAGAGCCAGGACCCAGATG Antisense, 397: TGAAGAGGGTGGATGATGGC
SOM intron X51468 Sense, 8: CTGTCCCCCTTACGAATCCC Cabezas et al. (2013) 240 Sense, 16: CTTACGAATCCCCCAGCCTT Cabezas et al. (2013) 182
Antisense, 228: CCAGCACCAGGGATAGAGCC Cabezas et al. (2013) Antisense, 178:TTGAAAGCCAGGGAGGAACT Cabezas et al. (2013)
nAchRa2 NM_144803 Sense, 1153: ATGGATGCTGAAGAAAGGGAGG 369 Sense, 1177: ACAGAGGAAGAGGAGGAGGAGG 304
Antisense, 1502: GAACGGAGGGAGGAAGAGCC Antisense, 1459: CGATAATGAACAGCCAGAGGAA
nAchRa3 NM_145129 Sense, 49: ATGCTGATGCTGGTGCTGAT 453 Sense, 162: CGTGTCCCATCCTGTCATCA 219
Antisense, 480: AAACGGGAAGTAGGTCACATCG Antisense, 361: TCGGCGTTGTTGTAAAGCAC
nAchRa4 NM_015730 Sense, 139: TTCTCTGGCTACAACAAGTGGTCT 288 Sense, 182: CAGATGTGGTCCTTGTCCGC 174
Antisense, 406: TTTGGTTAGGTGGGTGACTGC Antisense, 336: GTTCAGATGGGATGCGGATG
nAchRa5 NM_176844 Sense, 205: TGGTTGAAGCAGGAATGGATAG 369 Sense, 205: TGGTTGAAGCAGGAATGGATAG 208
Antisense, 552: GATTTCCCATTCTCCATTGTCA Antisense, 392: TGTAGTTTGCTGGCTGCGTCC
nAchRa6 NM_021369 Sense, 36: CGGTTTATGTCTGTGGCTATGTG 467 Sense,127: GCTCACTACAACCGCTTCATCC 232
Antisense, 481: CAAACGGGAAGAAGGTGATGTC Antisense,337: TGTCAGGCTTCCAGATGTTGTC
nAchRa7 NM_007390 Sense, 353: CAGATGAACGCTTTGATGCC 408 Sense, 409: CATTGCCAGTATCTCCCTCCA 319
Antisense,740: GCAAGAATACCAGCAAAGCCA Antisense, 707: GCACACAAGGAATGAGCAGGT
nAchRb2 NM_009602 Sense, 56: TGTGTTCAGGGGTTTTGGGTA 444 Sense, 210: GCACGAGCGGGAGCAGAT 290
Antisense, 480: GCTGGTCAAATGGGAAGTGC Antisense, 480: GCTGGTCAAATGGGAAGTGC
nAchRb3 NM_173212 Sense, 105: AGACGCACTCCTCAGACATTTG 550 Sense, 140: AGAAATGTGTCCGCCCTGTG 484
Antisense, 635: GTTGCCCTTCATCCCCTTTG Antisense, 600: TCCCACTCTCCGTTATCAAAAAAG
nAchRb4 NM_148944 Sense, 13: CCCCTGCTCCTCGTCTCTCT 356 Sense, 13: CCCCTGCTCCTCGTCTCTCT 325
Antisense, 349: GTCCCATCGGCATTGTTGTA Antisense, 318: CAGGCAACCAGACTCGCTTT
mAchR1 NM_001112697 Sense, 818: GCTGGAAAGAAGAAGAGGAAGAGG 482 Sense, 927: TGAGGCACAGGCACCCAC 298
Antisense, 1281: CAACAGCAGGCGGAAAGTG Antisense, 1204: GTAGCAAAGCCAGTAGCCCAG
mAchR2 NM_203491 Sense, 800: GGGACGGTGGGACTGAAAAC 316 Sense, 825: TCAGGGGGAGGAGAAAGAAAG 252
Antisense, 1095: GGCTGCTTGGTCATCTTCACA Antisense, 1054: TTCTGCTTTTCATCACCATTCTG
mAchR3 NM_033269 Sense, 811: GGGACAGAAGCGGAAGCAGA 332 Sense, 838: GTCCACCCCACAGGCAGTTC 192
Antisense, 1121: TTGGTAGAGTTGAGGATGGTGC Antisense, 1010: GGCAGCAGCATCGTTGTTAT
mAchR4 NM_007699 Sense, 897: TGCCACCCAGAACACCAA 432 Sense, 984: GCAGCCACGAACCCTCAA 267
Antisense, 1308: TAGCAGAGCCAGTAGCCGATG Antisense, 1230: TTGTAGGGTGTCCAGGTGAGG
mAchR5 NM_205783 Sense, 705: TGTGGCAGAAGTCAAGAAGAGAAA 363 Sense, 807: CTCCTGGTCATCCTCCCGTA 227
Antisense, 1044: TAGTCATTGTTTTCAGTCCGAGGG Antisense, 1010: TTTCCTTGGTCTCTTGGGTATTGA

Note: Position 1, first base of the start codon.

Chemicals

4-DAMP (M1/3 R antagonist, 10 μM), VU025535 (VU; M1R antagonist, 5 μM), PD102807 (PD; M4R antagonist, 500 nM), bicuculline methobromide (BIC; GABAAR antagonist, 10 μM), 2-hydroxysaclofen (2-HS; GABABR antagonist, 5 μM), DL-AP-5 (AP-5; NMDA-R antagonist, 100 μM), and CNQX disodium salt (CNQX; AMPA/KA receptor antagonist, 7 μM) were from Tocris. Tetrodotoxin (TTX; 1 μM) and AF-DX116 (AFDX; M2R antagonist, 2 μM) were from abcam. Neurobiotin was from Vector Laboratories. All other chemicals were from Sigma-Aldrich.

Data Analyses and Statistics

We analyzed patch-clamp recording data using Clampfit 9 (Molecular Devices) and synaptic events using MiniAnalysis (Synaptosoft). The nonparametric Kolmogorov–Smirnov test (K-S test; MiniAnalysis) was used to quantify the effects of pharmacological treatments on sEPSC and mEPSC frequency for each cell; a neuron was defined as responsive to intervention if P < 0.05. Sample traces were generated with Igor Pro v6 (WaveMetrics) and graphs with Prism 5 (GraphPad). Neurons that demonstrated a high firing rate that obscured Vm measurements were analyzed with Minianalysis (Synaptosoft) to find baseline Vm. For other cells, Vm was taken in 30 s bins for a minimum period of 4 min prior to intervention. These data were then used to calculate the average baseline Vm or RMP. The effects of interventions on Vm were compared to this average baseline and the delta calculated. A dose–response curve to CCh was calculated as a percentage of the maximal response of the inward current to 5, 50, and 100 μM CCh bath application (in TTX 1 μM) and transformed into a log scale and fit with a nonlinear Boltzmann sigmoidal curve in Prism 5 (GraphPad). For voltage-clamp analyses, cells were included if the peak current was greater than the mean ± 2*SD of the preceding baseline value. The baseline for all cells tested was −0.9 ± 0.4 pA (mean ± SD). Unless otherwise stated, data are presented as mean ± SEM with n = number of cells per group (represented in parenthesis for figures). We compared group means from the same cells using paired t-tests or one-way ANOVA followed by Bonferroni or Dunnett’s post hoc tests; changes over time were analyzed by repeated measures (RM)-ANOVA or two-way ANOVA followed by the Bonferroni post hoc test; different groups of cells were then compared using unpaired t-tests. A statistical significance threshold of P < 0.05 was used.

Results

The BF Projects to Contralateral Cortical nNOS/NK1R Cells in the Mouse

Previous studies in rat showed that cholinergic BF neurons project to cortical NOS-containing cells (Vaucher et al. 1997) and that electrical stimulation of the BF evokes c-FOS bilaterally in NOS cells (Kocharyan et al. 2008). We examined whether a BF projection was also present in C57/BL6 mice by injecting the anterograde tracer BDA into the BF region, targeting the magnocellular preoptic/substantia innominata (MCPO/SI) region (Fig. 1Ai–iii). To avoid contamination from the injection tract, we assessed innervation of the cortex contralateral to the injection site, with particular focus on the deep layers where Type I cortical nNOS/NK1R cells are principally located. BDA-stained fibers impinged on nNOS-immunoreactive cell bodies and dendritic fields within the cortical region of interest, suggesting direct innervation of cortical nNOS neurons by the BF (Fig. 1Aiii). These observations are consistent with recent data demonstrating chemogenetic tracing of cholinergic BF neurons to the cingulate cortex (Anaclet et al. 2015; Chen et al. 2016).

Figure 1.

Figure 1.

Identification of a BF cholinergic projection to cortical nNOS neurons in mice. (A) (i) schematic of the tracer experiments in which (ii) 5% BDA (lower panel, black) was injected into the BF [scale bar = 250 μm] and revealed (iii) a BDA-labeled BF fiber projection (black) in close proximity to a cortical nNOS cell visualized with 3,3′ diaminobenzidine tetrahydrochloride [brown; scale bar = 25 μm]. (B) (i) Schematic of the experimental design in which RFP-labeled cortical nNOS neurons from nNOS-CreER;Ai14 mice are recorded in vitro while ChR2-eYFP-containing terminals projecting from the BF are illuminated. (ii) Coronal section demonstrating BF injection of ChR2-eYFP to target neurons of the MCPO/SI [scale bar = 250 μm]. (iii) Colocalization (white arrowheads) between eYFP-labeled ChR2-eYFP (green) and cholinergic ChAT-labeled neurons (magenta) in the BF indicates that some ChAT cells express ChR2. Single-labeled ChAT cells (magenta) are denoted by clear arrowheads [scale bar = 25 μm]. (iv) Confirmation that cortical cells in nNOS-CreER; Ai14 mice that coexpress red fluorescent protein (RFP) and nNOS are in close proximity to ChR2-eYFP fibers from the BF [scale bar = 25 μm]. (v) Colocalization between RFP neurons (magenta) and nNOS-labeled neurons (green) in the cingulate cortex of nNOS-CreER; Ai14 mice [scale bar = 25 μm]. (vi) Transduction efficiency and specificity of RFP to nNOS neurons within the cingulate cortex. (C) Current-clamp responses of cortical nNOS-RFP cells to repeated blue-light (470 nm) stimulation (5 ms pulse width, 1 Hz). (D) To isolate putative acetylcholine release caused by light-evoked terminal stimulation, we applied either glutamatergic (“Glu”: CNQX,7 μM; AP-5, 100 μM) and GABAergic (“GABA”: 2-HS, 5 μM; BIC, 10 μM) blockers, or the mAChR antagonist atropine (AT, 5 μM) , or all compounds before blue-light illumination. (i) Examples of current-clamp responses of cortical nNOS cells either excited or inhibited by blue-light stimulation of BF afferents (5 ms pulse width, 1 Hz). Dotted line indicates truncation of action potentials at −20 mV. (ii) When light stimulation was applied to cortical nNOS/NK1R cells from mice not expressing ChR2, no effect was seen. (E) The change in Vm of nNOS-RFP neurons with blue-light illumination in the absence (control) and presence of blockers. Data were separated into cells showing either an overall depolarization (i) or hyperpolarization (ii) response. Blue vertical bars in C, D, and E indicate photostimulation. RFP, red fluorescent protein (***P < 0.001; **P < 0.01; *P < 0.05; n.s., nonsignificant; one-way ANOVA).

Stimulation of BF Terminals Excites Cortical nNOS/NK1R Neurons

To evaluate the functionality of the putative cholinergic BF projection suggested in Figure 1Aiii, we injected AAV9-hSYN-hChR2(H134R)-eYFP-WPRE-hGH into the MCPO/SI region of nNOS-CreER;Ai14 mice (Fig. 1Bi–ii) followed by tamoxifen injection (75 mg/kg, i.p.) three weeks later. We confirmed ChR2 expression in cholinergic neurons (Fig. 1Biii) and BF innervation of the cortex (Fig. 1Biv). The specificity of RFP reporter expression in nNOS neurons in nNOS-CreER:Ai14 mice (Fig. 1Bv) was 85 ± 6% in the cingulate cortex with a transduction efficiency of 60 ± 22% (Fig. 1Bvi; n = 2 mice). Within the deep layers where nNOS cells were recorded, the specificity and transduction efficiency were 91 ± 5% and 63 ± 21%, respectively.

In nNOS-CreER:Ai14 mice, we optogenetically stimulated the ChR2-expressing BF terminals on cortical nNOS/NK1R neurons contralateral to the BF injection site (Fig. 1C). Blue-light stimulation (5 ms pulse width at 1 Hz) evoked immediately observable membrane deflections and/or action potentials in some nNOS/NK1R neurons (n = 11 of 28, Fig. 1C). A proportion of cells demonstrated a delayed response to optical stimulation (>3 min; n = 18 of 28, 64%; Fig. 1Di). Since ChR2 expression from the BF may include glutamatergic and GABAergic cells (Gritti et al. 2003; Hur and Zaborszky 2005; Henny and Jones 2008; Brown and McKenna 2015) as well as cholinergic BF cells, the nNOS/NK1R neurons that responded to illumination were analyzed further.

To isolate the contribution of putative cholinergic BF ChR2 terminals, we repeated the stimulation paradigm in the presence of blockers for glutamate (CNQX, 7 μM and AP-5, 100 μM) and GABA receptors (2-HS, 5 μM; BIC, 10 μM), the mAChR antagonist atropine (AT; 5 μM), or both (Fig. 1Di). Under control conditions, blue-light stimulation (5 ms pulse width, 1 Hz) evoked either significant membrane depolarization (2.63 ± 0.14 mV, n = 10, one-way ANOVA, P < 0.001; change in Vm averaged between peak response at 4−6 min vs. baseline Vm = −0.09 ± 0.04 mV; Fig. 1Ei) or hyperpolarization (−3.60 ± 0.20 mV, n = 8, one-way ANOVA, P < 0.001; change in Vm averaged between peak response at 4−6 min vs. baseline Vm = 0.1 ± 0.20 mV; Fig. 1Eii) in cortical nNOS neurons. When stimulation was repeated in the presence of glutamate/GABA blockers, the depolarization response was comparable (3.01 ± 0.19 mV, n = 5, one-way ANOVA, P < 0.001) while the inhibitory response was largely blocked (−0.41 ± 0.16 mV, n = 4, one-way ANOVA, P < 0.001). When repeated in the presence of AT and glutamate/GABA blockers, no significant change in Vm occurred in cells either previously depolarized or hyperpolarized by light stimulation (0.22 ± 0.03 mV, n = 7; one-way ANOVA, P > 0.05; change in Vm averaged between 4 − 6 min; and −0.75 ± 0.25 mV, n = 5; one-way ANOVA, P > 0.05). These results suggest that the light-evoked inhibitory responses are largely glutamatergic/GABAergic in origin while depolarization responses contain an AT-sensitive component. The latter conclusion is supported by data showing that cells that were significantly depolarized by light stimulation had reduced responses in the presence of AT alone (1.04 ± 0.29 mV, n = 6; one-way ANOVA, P < 0.01; change in Vm averaged between 4.5 and 6.5 min compared to baseline). We also observed changes in current and firing frequency to blue-light stimulation that were also differentially sensitive to AT, glutamate and GABA antagonists (Fig. S1). There were no changes in firing rate or membrane deflections recorded in response to photostimulation in brain slices taken from mice that were not injected with ChR2 (Vm = −0.17 ± 0.15 mV, n = 3; Fig. 1Dii and Ei).

Together, these data suggest that cortical nNOS neurons receive BF innervation, that photostimulation of these afferents can excite or inhibit nNOS neurons, and that a proportion of this innervation may be cholinergic.

Electrical Characteristics of Cortical nNOS/NK1R Neurons Identified by SP-TMR

Type I nNOS cells within the cortex express multiple neurotransmitter markers (Tricoire and Vitalis 2012) that have previously been used to identify subsets of cortical interneurons based on their electrophysiological characteristics (Kawaguchi and Kubota 1996; Ascoli et al. 2008). Based on several attributes of nNOS-expressing neurons described in the mouse barrel cortex, the sleep-active nNOS neurons have been suggested to correspond to the Adapt-SOM class of neurons (Perrenoud et al. 2012). To clarify their identity, we determined the electrical properties of the nNOS neurons in juvenile (P14-23) mice rather than adult brains because of impaired visualization of nNOS cells due to autofluorescence in slices from adult brains.

In juvenile male and female C57Bl/6 J mice, nNOS/NK1R neurons were identified in vitro by application of the NK1R ligand SP-TMR and confirmed by postrecording immunohistochemistry (Fig. 2A). The nNOS/NK1R neurons recorded in the cortical region of interest were randomly sampled for electrophysiological characterization (Fig. 2B) as summarized in Table 2. A proportion of the nNOS/NK1R neurons analyzed were found to exhibit characteristics previously attributed to SOM-containing neurons and Type I nNOS neurons (Fanselow et al. 2008; Perrenoud et al. 2012), namely, fAHP (−7.70 ± 0.73 mV, n = 7 of 30), mAHP (−10.83 ± 0.42 mV, n = 30), and ADP (2.30 ± 0.61 mV, n = 7 of 30). In adult male nNOS-CreER;Ai14 mice examined by optogenetic stimulation of BF terminals, nNOS/NK1R neurons exhibited electrical characteristics similar to those of juvenile C57Bl/6 J mice (P14-23; Fig. 2B,C), and did not differ significantly in any parameter tested (one-way ANOVA, P > 0.05).

Figure 2.

Figure 2.

(A) Schematic illustration of the cortical region studied. Identification of cortical nNOS/NK1R cells following internalization of SP-TMR under (i) fluorescent and (ii) DIC illumination. Inclusion of (iii) Lucifer yellow (shown here after pipette withdrawal) and (iv) Neurobiotin within the intracellular solution allowed visualization of the patched cell during recording and after postimmunohistochemical processing. (v) Confirmation that a patched cell was a Type I nNOS/NK1R neuron [scale bar = 25 μm]. (B) Response of SP-TMR-identified cortical nNOS/NK1R neurons to hyperpolarizing (left) and depolarizing (right) current injections in slices from juvenile mice. Electrophysiological characteristics measured included afterhyperpolarization (fast and medium, fAHP and mAHP, respectively) and afterdepolarization (ADP; right panel inset). Spike ratio (sR) was quantified as the ratio B/A indicated by the shaded areas in the hyperpolarizing current injection trace; spike adaptation was quantified as the S/E ratio denoted by the shaded areas in depolarizing current injection trace. (C) Example of an nNOS/NK1R cell recorded from an adult mouse brain slice showing electrophysiological properties comparable to those of juvenile mice illustrated in B.

Table 2.

Electrophysiological characteristics of cortical nNOS/NK1R neurons

Property
Rebound depolarization (sR) −2.86 ± 0.83 mV (n = 31)
Resting membrane potential (RMP) −47.71 ± 1.63 mv (n = 36)
Percent of quiescent cells at RMP 42% (n = 13 of 31)
Firing frequency at RMP 4.16 ± 0.52 Hz (n = 19)
Action potential threshold −44.86 ± 0.84 mV (n = 26)
Ih magnitude 2.46 ± 0.59 mV (n = 31)
Spike ratio 1.26 ± 0.23 (n = 16)
Response to current Injection (+80 pA) 5.80 ± 0.57 Hz (n = 28)
mAHP −10.83 ± 0.42 mV (n = 30)
fAHP −7.70 ± 0.73 mV (n = 7 of 30)
ADP −2.30 ± 0.61 mV (n = 7 of 30)
Input resistance 601.7 ± 35.30 MΩ (n = 36)
Cell capacitance 66.61 ± 4.25 pF (n = 33)

Carbachol Evokes Diverse Responses in nNOS/NK1R Neurons

To determine which cholinergic mechanisms were involved in the response of nNOS/NK1R neurons to optogenetic stimulation of BF terminals, we bath applied the cholinomimetic carbachol (CCh; 50 μM) and recorded from SP-TMR-identified nNOS/NK1R cells in coronal mouse brain sections (P14-23). The responses to CCh were predominately biphasic in both voltage-clamp and current-clamp (Fig. 3A). In voltage-clamp, there was often a brief outward current (4.89 ± 0.56 pA, n = 12; one-way ANOVA, P < 0.05) followed by a much larger inward current (−16.51 ± 2.48 pA, n = 16; one-way ANOVA, P < 0.0001; compared to baseline −0.6 ± 0.59 pA). These current changes corresponded with Vm hyperpolarization (−2.24 ± 0.57 mV, n = 6; one-way ANOVA, P < 0.0001) and depolarization (9.19 ± 1.86 mV, n = 8; one-way ANOVA, P < 0.0001), respectively. A range of CCh concentrations (5, 50, and 100 μM) was tested and the ~half-maximal current response, based on the inward current response (+TTXI), was determined to be ~55 μM (Fig. 3B; R2 = 0.91; n = 5); hence, 50 μM was used in subsequent studies.

Figure 3.

Figure 3.

Whole-cell patch-clamp recordings from cortical nNOS/NK1R neurons and their responses to bath-applied carbachol (CCh). (A) The voltage-clamp response to CCh (50 μM, gray bar above trace) is mixed, resulting in outward and inward currents that result in hyperpolarization and depolarization of the membrane potential (Vm), respectively (insets below trace). (B) Dose–response curve, based on the inward current response under TTX (+TTXI), shows that the concentration of CCh used (50 μM) is approximately the half-maximal dose. (C) (i-ii) CCh application results in oscillatory activity of the Vm of different nNOS neurons. The firing frequency (60 s bins) of each cell is shown below its recording trace. (D) Isolation of the postsynaptic effect under TTX (1 μM) reveals that CCh predominantly depolarizes nNOS/NK1R cells caused by a large inward (CChi) current and Vm depolarization (CChd; inset below trace). (E) In some cells, CCh evokes an outward (CCho) current and Vm hyperpolarization (CChh). (F) Summary of the current changes evoked by CCh. (G) Summary of the Vm changes induced by CCh. (H) Voltage-clamp recording in the presence of TTX (1 μM), glutamatergic (CNQX,7 μM; AP-5, 100 μM) and GABAergic (2-HS, 5 μM; BIC, 10 μM) blockers, and 0 Ca2+/ 3.3 Mg2+-containing aCSF [top black bar] demonstrates that CCh application [lower gray bar] evokes a postsynaptic response of an inward (top trace) or mixed outward then inward current (bottom trace). (I) Quantification of the postsynaptic responses to CCh application in the presence of TTX, glutamatergic and GABAergic blockers, and 0 Ca2+/ 3.3 Mg2+-containing aCSF (***P < 0.001; **P < 0.01; *P < 0.05; n.s., nonsignificant; one-way ANOVA; the break in the trace in H is from switching between recording modes for >10 s).

Upon further examination, Vm and current changes showed oscillatory-type activity (Fig. 3C), suggesting competing inhibitory and excitatory drives. Since multiple cell types in the cortex might respond to CCh application and indirectly alter nNOS/NK1R neuron activity, we repeated the experiments in the presence of the Na+-channel blocker TTX (1 μM) to prevent postsynaptic effects from action potential-evoked release of other neurotransmitters. In the presence of TTX, the predominant response was an inward current in 71% of nNOS/NK1R cells (−16.18 ± 3.21 pA; n = 39; one-way ANOVA, P < 0.0001; Fig. 3D; compared to baseline −1.34 ± 0.46 pA); the remaining 29% of nNOS/NK1R neurons exhibited an outward current (7.91 ± 2.09 pA; n = 16; one-way ANOVA, P < 0.01; Fig. 3E). Concordant with the effect of CCh in voltage-clamp (Fig. 3F), current-clamp recordings in TTX indicated that 73% of nNOS/NK1R cells were excited by CCh (Vm depolarization of 6.62 ± 1.46 mV, n = 29; one-way ANOVA, P < 0.0001). The remaining 27% of cells were inhibited by CCh (−2.44 ± 0.43 mV; n = 11; one-way ANOVA, P < 0.0001; Fig. 3G). Lastly, to confirm a postsynaptic response, we repeated CCh application in the presence of TTX, blockers for both glutamate (CNQX, 7 μM and AP-5, 100 μM) and GABA (BIC, 10 μM and 2-HS, 5 μM), and 0 Ca2+/3.3 Mg2+-containing aCSF (Fig. 3H). Under these conditions, inhibitory responses evoked were +5.05 ± 2.18 pA (n = 2 of 11) and −1.49 mV (n = 1 of 5); excitatory responses were −10.03 ± 1.35 pA (n = 9 of 11) and +3.05 ± 0.26 mV (n = 4 of 5). Thus, the responses evoked by CCh were comparable to those in the presence of TTX alone (Fig. 3I vs. 3F and 3G).

Cholinergic Effects on Cortical nNOS/NK1R Cells are Partly Mediated by Postsynaptic Muscarinic Receptors

As indicated above, CCh has multiple effects on nNOS/NK1R neuron excitability. Since CCh can bind both nAChRs and mAChRs, we examined which receptors mediated the direct responses by applying CCh in the presence of mAChR antagonists and TTX. Due to the absence of reagents to distinguish between the M3R and the M5R (Eglen and Nahorski 2000; Wess 2004), we did not test for the presence of M5R.

First, to confirm the presence of postsynaptic mAChRs on cortical nNOS/NK1R neurons, we bath applied muscarine (10 μM; nonselective mAChR agonist) in the presence of TTX (1 μM). Both inhibitory (outward I: 4.92 ± 0.99 pA; n = 5; P < 0.01; hyperpolarization: −2.44 ± 0.52 mV; n = 4; P < 0.01) and excitatory (inward I: −4.65 ± 2.36 pA; n = 3; P < 0.05; depolarization: 3.08 ± 0.87 mV; n = 4; P < 0.001) responses were recorded from nNOS/NK1R neurons (Fig. 4A). Second, we confirmed that no significant desensitization in the CCh-mediated response occurred after repeated applications of CCh (Fig. 4B).

Figure 4.

Figure 4.

Pharmacological isolation of the mAChR subtypes in TTX reveals a predominant role for M4 and M3 mAChRs. (A) In TTX, application of the nonselective mAChR agonist, muscarine (10 μM) in voltage and current-clamp configurations, supports a role for mAChRs on nNOS/NK1R neurons. (B) Repetitive application of CCh does not result in reduction in the magnitude of responses between applications. (C) In TTX, CCh-evoked changes in current are reduced by AT (1, 5, and 50 μM), as are (D) CCh-mediated changes in membrane potential (Vm). (E) Current and (F) Vm changes in the absence and presence of the M1R antagonist VU025535 (5 μM) demonstrates that the CCh response is not significantly affected by blocking M1Rs. (G, H) Blockade of both M1R and M3R by 4-DAMP (10 μM) eliminates the excitatory response of CCh. (I, J) Application of the M4R antagonist PD102807 (500 nM) significantly reduces the CCh-evoked inhibitory responses; these responses are eliminated by the M2R/M4R antagonist AFDX-116 (2 μM) (***P < 0.001; **P < 0.01; *P < 0.05; n.s., nonsignificant).

To evaluate the possible involvement of postsynaptic mAChRs, we bath applied CCh in the presence of the nonselective mAChR antagonist atropine (AT; 1, 5, and 50 μM). Fig. 4C,D illustrates that AT reduced the CCh-mediated currents to varying degrees at each AT concentration tested (outward I: one-way ANOVA, P < 0.0001; inward I: one-way ANOVA, P < 0.0001). AT 5 μM (AT5) consistently reduced CCh-evoked responses (before TTXo: 3.00 ± 0.47 pA, n = 7 vs. with AT5: −2.22 ± 1.01 pA, n = 3, P < 0.001; before TTXi: −7.24 ± 1.16 pA, n = 18 vs. with AT5: −0.93 ± 1.05 pA, n = 4, P < 0.05). CCh-evoked changes in membrane potential were reduced across all AT concentrations used (hyperpolarization: one-way ANOVA, P < 0.01; depolarization: one-way ANOVA, P < 0.01), although hyperpolarization was significantly reduced only in 5 μM and 50 μM AT (before TTXh: −2.94 ± 0.71 mV, n = 6 vs. with AT5: 0.78 ± 0.74 mV, n = 2 or with AT50: 0.73 ± 0.75 mV, n = 4, P < 0.05 and P < 0.01, respectively) and depolarizations in AT50 (before TTXd: 4.10 ± 1.13 mV, n = 11 vs. with AT50: 0.21 ± 0.39 mV, n = 8, P < 0.01). Although off target effects are possible at the AT50 concentration, the CCh-evoked responses were sensitive to the lower concentrations of AT and thus support a role for mAChRs on cortical nNOS/NK1R cells.

To address mAChR-mediated excitatory effects of CCh on nNOS/NK1R cells, we utilized antagonists for the Gq-coupled M1R and M3R (Fig. 4E–H). Application of the M1R antagonist VU025535 (5 μM) did not significantly affect the inward current compared to baseline (CCh alone: −8.45 ± 1.45 pA vs. CCh and VU: −10.48 ± 2.18 pA, n = 4; one-way ANOVA, P > 0.05) or reduce the CCh-mediated postsynaptic Vm depolarization (CCh alone: 18.66 ± 7.65 mV vs. CCh and VU: 6.37 ± 3.73 mV, n = 4; paired t-test, P = 0.09; Fig. 4E,F). In contrast, application of the mixed M1/3 R antagonist 4-DAMP (10 μM) significantly blocked CCh-evoked Vm depolarization (CCh alone: 5.15 ± 2.3 mV vs. CCh and 4-DAMP: 0.48 ± 0.39 mV; n = 6; one-way ANOVA, P < 0.05), and the current direction was reversed (CCh alone: −9.57 ± 3.08 pA vs. CCh and 4-DAMP: 6.67 ± 1.79 pA; n = 8; one-way ANOVA, P < 0.001). This reversal was mirrored by Vm hyperpolarization in 66% of cells previously excited by CCh (−1.22 ± 0.51 mV; n = 4; P < 0.01; Fig. 4G,H). These data suggest that M3Rs are preferentially expressed on the postsynaptic membrane of nNOS/NK1R cells.

To determine which mAChRs were responsible for the CCh-mediated postsynaptic inhibition on nNOS/NK1R cortical neurons, we utilized antagonists for the Gi/o-coupled M2R and M4R (Fig. 4I,J). Application of the M4R antagonist PD102807 (500 nM) significantly reduced the outward current evoked by CCh (CCh alone: 4.74 ± 0.63 pA vs. CCh and PD: 1.77 ± 1.03 pA; n = 4; P < 0.05; Fig. 4I) as well as Vm hyperpolarization (CCh alone: −2.05 ± 0.4 mV vs. CCh and PD: −0.15 ± 0.40 mV; n = 4; P < 0.01; Fig. 4J). When repeated with the addition of the M2R antagonist AFDX-116 (2 μM), the residual CCh-evoked outward current and Vm hyperpolarization was eliminated (0.23 ± 0.23 pA, n = 3 and 0.00 ± 0.00 mV, n = 4). These data suggest that nNOS/NK1R cells also express functional postsynaptic M2Rs and M4Rs.

Next, we performed scRT-PCR after whole-cell patch-clamp recordings (Fig. 5A). The results from 13 cells identified with SP-TMR support the pharmacological findings that M1R, M3R and M4R are the predominant mAChR subtypes expressed on cortical nNOS/NK1R neurons (Fig. 5B).

Figure 5.

Figure 5.

scRT-PCR from nNOS/NK1R cells confirm multiple mAChR subtypes. (A) Left: Confocal image of a SP-TMR-identified cortical nNOS/NK1R neuron sampled for scRT-PCR (scale bar = 60 μm). Middle: scRT-PCR confirms cell contents were from a GABAergic interneuron that expressed Somatostatin (SOM), Neuropeptide Y (NPY), nNOS and NK1R. Right: scRT-PCR indicates that this cell expressed the M1, M3, M4, and M5 mAChR receptor subtypes. (B) Proportion of neurons expressing each transcript in the nNOS cell population sampled (n = 7). To eliminate potential false positives for the mAChRs, only cells negative for the somatostatin intron (SOM int) were included in the analysis (Ф, molecular weight marker).

mAChR-Mediated Regulation of Glutamatergic Input to Cortical nNOS/NK1R Cells

As indicated by the oscillatory changes in current and Vm in nNOS/NK1R neurons (Fig. 3C), CCh likely affects network activity to indirectly regulate these neurons. Therefore, we determined whether these indirect responses were due to changes in presynaptic glutamatergic input (Fig. 6). We found that CCh application increased sEPSC frequency (+749 ± 17%, RM-ANOVA, P < 0.001; K-S test, P < 0.01; n = 12; Fig. 6A). Since sEPSC activity may be driven by CCh-induced action potentials elsewhere in the slice, we also examined mEPSCs by repeating the experiment in the presence of TTX (1 μM). Under TTX, CCh significantly reduced mEPSC activity compared to baseline (60.53 ± 0.85%, n = 26; RM-ANOVA, P < 0.0001; K-S test, P < 0.01; Fig. 6B). Overall, there was no significant change in the amplitude of sEPSCs (K-S test, P > 0.06, n = 10 of 12 cells) or mEPSCs (K-S test, P > 0.09, n = 14 of 21 cells) with CCh application. Cells that showed amplitude changes in sEPSCs (16% of cells recorded) and mEPSCs (36% of cells recorded) had an increased number of low amplitude events compared to baseline conditions (K-S test, P < 0.02, n = 2 of 12 cells and K-S test, P < 0.03, n = 8 of 22 cells, respectively).

Figure 6.

Figure 6.

CCh affects presynaptic glutamate release onto cortical nNOS/NK1R cells. (A) CCh increases spontaneous excitatory postsynaptic currents (sEPSCs). (B) However, CCh reduces miniature EPSCs (mEPSCs). (C–E) Pharmacological antagonism at different mAChRs reveals CCh-decreased mEPSCs are predominantly mediated by M3Rs. (F) Muscarine, a nonselective mAChR agonist, reduces mEPSCs similarly to CCh. (G) Pharmacological blockade of mAChRs with atropine (at all concentrations) blocks the presynaptic reduction in mEPSCs. AFDX, AFDX-116; AT, atropine; C, Control; CCh, carbachol; M, muscarine; PD, PD102807; VU, VU025535; W, washout (***P < 0.001; **P < 0.01; *P < 0.05; n.s., nonsignificant).

To determine the type of cholinergic presynaptic receptors mediating the reduction in glutamatergic input by CCh, we examined the effect of mAChR antagonists on mEPSCs. CCh reduced mEPSC frequency in 75% of cells tested in the presence of the M1R antagonist VU025535 (5 μM; 59.20 ± 1.57%, RM-ANOVA, P < 0.0001; K-S test, P < 0.01; n = 3 of four cells; Fig. 6C) or the M4R antagonist PD102807 (500 nM; 70.72 ± 4.31%, RM-ANOVA, P < 0.001; K-S test, P < 0.002; n = 3 of four cells; Fig. 6E). In 25% of cells, VU025535 and PD102807 blocked the CCh-induced reduction of mEPSCs (K-S test, P = 0.50, n = 1 of four cells; and K-S test, P = 0.80, n = 1 of four cells, respectively), while application of the M4 antagonist PD with the M2 antagonist AFDX-116 (2 μM) blocked the effect of CCh in 75% of cells (83.25 ± 5.13%, P < 0.05; K-S test, P < 0.04, n = 4; Fig. 6E). These data suggest M1R and M4R are not the main contributors to the presynaptic reduction in glutamatergic tone onto nNOS/NK1R neurons by CCh. Conversely, independent preapplication of the M1/M3 antagonist 4-DAMP (10 μM; 116.3 ± 7.63%, RM-ANOVA, P > 0.20; K-S test, P > 0.16, n = 3; Fig. 6D) or AT (1, 5, 50 μM; K-S test, P > 0.18, n = 18; Fig. 6G) each blocked the reduction in frequency of mEPSCs. In addition, both 4-DAMP and AT50 presynaptic blockade resulted in an increase in mEPSC activity in some cells (K-S test, P < 0.01, n = 2 of five cells and K-S test, P < 0.01, n = 2 of six cells, respectively). We found that any change in amplitude of mEPSCs by CCh was unaffected in the presence of the different mAChR antagonists tested (+AT1, 5, or 50: 101.7 ± 1.81%, n = 4, 92.48 ± 1.79%, n = 4, and 97.38 ± 1.92%, n = 6 respectively; +VU: 93.26 ± 1.29%, n = 4; +4-DAMP: 101.1 ± 2.81%, n = 5; PD: 93.17 ± 1.02%, ++AFDX: 94.46 ± 1.30%, n = 4; all results compared to baseline mEPSC amplitude). The application of muscarine (10 μM), a nonselective mAChR agonist, similarly decreased mEPSCs onto cortical nNOS/NK1R neurons (52.07 ± 1.20%, n = 7; RM-ANOVA, P < 0.0001; K-S test, P < 0.05; Fig. 6F). Together, these data indicate that presynaptic M3Rs, with contribution from M2Rs, mediate CCh-induced inhibition of glutamatergic input onto cortical nNOS/NK1R cells.

nAChRs Also Contribute to Cholinergic Effects on Cortical nNOS/NK1R Cells

Since CCh also activates nAChRs, we examined whether nAChR activation contributed to CCh-evoked responses on nNOS/NK1R cells. Due to the fast desensitization kinetics of nAChR, a single application of nicotine (NIC, nAChR agonist; 5 μM) per slice was studied. When we applied NIC with TTX, the predominant electrical response was an outward current (4.30 ± 0.67 pA, n = 8; paired t-test, P = 0.0004; Fig. 7A,B) although, in two cells, NIC application caused an inward current (−19.99 ± 14.62 pA; Fig. 7B). In current clamp, NIC evoked Vm hyperpolarization (−2.34 ± 0.74 mV, n = 7; paired t-test, P = 0.02) or depolarization (2.83 ± 0.81.mV, n = 4; paired t-test, P = 0.04; Fig. 7C). We also confirmed a postsynaptic response by applying NIC in the presence of TTX, blockers for both glutamate (CNQX, 7 μM and AP-5, 100 μM) and GABA (BIC, 10 μM and 2-HS, 5 μM), and 0 Ca2+/ 3.3 Mg2+-containing aCSF (Fig. 7C,D). Under these conditions, excitatory responses were −14.97 ± 4.71 pA (n = 3 of 4, one-way ANOVA, P < 0.05) and +7.41 ± 0.12 mV (n = 2) with one cell showing an initial inhibitory response (+4.59 pA and −3.43 mV). This contrasted with the previously acquired results, suggesting NIC actions may be more complex on cortical nNOS/NK1R neurons. CCh modulation of mEPSCs was confirmed to be a mAChR-dependent mechanism since application of NIC had no effect on either mEPSC frequency (104.4 ± 5.79%, RM-ANOVA, P = 0.07; K-S test, P < 0.04; n = 9 of nine cells; Fig. 7E) or amplitude (K-S test, P > 0.16; n = 9 of nine cells; data not shown).

Figure 7.

Figure 7.

CCh affects nNOS/NK1R excitability via nAChRs. (A) Voltage-clamp recording of an outward response to nicotine (NIC, 5 μM; gray bar) in TTX (1 μM). (B) NIC evoked both outward and inward currents (left column) and membrane potential (Vm) hyperpolarization or depolarization (right column). (C) Voltage-clamp recording in the presence of TTX (1 μM), glutamatergic (CNQX,7 μM; AP-5, 100 μM) and GABAergic (2-HS, 5 μM; BIC, 10 μM) blockers in 0 Ca2+/3.3 Mg2+-containing aCSF [top black bar] demonstrates that NIC application [lower gray bar] evokes a postsynaptic response of either an inward (top trace) or a mixed outward then inward current (bottom trace). (D) Quantification of the postsynaptic responses to NIC application in the presence of TTX, glutamatergic and GABAergic blockers in 0 Ca2+/3.3 Mg2+-containing aCSF. (E) NIC does not reduce glutamatergic mEPSCs as CCh does, suggesting that nAChRs do not have a major role in this CCh effect. (F) scRT-PCR results confirming cell contents analyzed are from a GABAergic SOM/NPY/nNOS/NK1R interneuron which expresses mRNAs for the nAChRβ2 subunit. (G) Proportion of nNOS cells expressing each transcript in the population sampled (n = 13). (H) Quantification of cortical nNOS/NK1R cells and Chrna2-containing cortical neurons indicate extremely low colocalization (n = 2 mice), supporting the scRT-PCR results indicating low expression levels of nAChRα2 subunit mRNA in nNOS/NK1R neurons (***P < 0.001; **P < 0.01; *P < 0.05; n.s., nonsignificant; break in trace in A is from switching between recording modes for >10 s).

We performed scRT-PCR on the cytoplasm taken from patched cortical nNOS/NK1R neurons, identified with SP-TMR, to determine nAChR expression. Results indicated that the nAChR beta2 subunit was the predominant subunit in these cells (Fig. 7F,G), indicating that nAChRs on cortical nNOS/NK1R cells are mainly of the non-α7 subtype (i.e., dihydro-beta-erythroidine (DHbetaE)-sensitive).

Since cortical nNOS neurons share some similarities with stratum oriens-lacunosum moleculare (OLM) interneurons which are known to express the nAChR α2 subunit and this subunit has been found in deep cortical layers (Leao et al. 2012), we determined whether α2 expression exists on cortical nNOS/NK1R neurons using a Chrna2 reporter mouse and immunohistochemistry for nNOS. Chrna2-cre mice express tdTomato reporter under control of the nAChR α2 subunit promoter. We found only one nNOS neuron that colocalized with a Chrna2-cre; R26tom-identified cell in all sections counted (total nNOS cells: 8.19 ± 0.70, total Chrna2-cre; R26tom cells: 41.19 ± 1.34; Fig. 7H). These data support the scRT-PCR analysis which indicated that expression of the nAChR α2 subunit is low in cortical nNOS/NK1R neurons.

Juvenile Mice Increase c-FOS Expression in nNOS/NK1R Neurons During RS After Sleep Deprivation

As indicated above, the extensive autofluorescence in the adult mouse brain limits the use of SP-TMR to identify cortical nNOS cells for cellular electrophysiological studies to young animals. On the other hand, activation of nNOS/NK1R neurons during sleep has been described in three species of adult rodents (Gerashchenko et al. 2008; Pasumarthi et al. 2010; Morairty et al. 2013; Dittrich et al. 2015) but has not previously been examined in juvenile animals. Therefore, we measured c-FOS expression in nNOS/NK1R cells within the same cortical region of young mice that was targeted for electrophysiological recordings (Fig. 8A,B). Juvenile (P19-21) mice subjected to 4 h SD starting at ZT0 demonstrated little c-FOS colocalization in cortical nNOS/NK1R cells (4 h SD: 2.12 ± 0.84%, n = 4). However, young mice given a 90 min sleep opportunity following the 4 h SD demonstrated a significantly increased proportion of cFOS/nNOS neurons (17.63 ± 1.41%, n = 4; one-way ANOVA with Bonferroni posttest, P < 0.001). This increased colocalization was a reflection of the sleep opportunity following extended wakefulness because undisturbed (“undistB”) mice, time-matched for both groups (Fig. 8B), did not show significant c-FOS/nNOS (ZT4:1.67 ± 1.04%, n = 3; ZT5.5:3.33 ± 3.33%, n = 3). These data demonstrate a role for cortical nNOS/NK1R cells as cellular markers of sleep homeostasis in juvenile (P19-21) as well as adult mice and support the rationale for the in vitro neurophysiological studies of cortical nNOS/NK1R neurons.

Figure 8.

Figure 8.

Sleep deprivation in juvenile mice and the effect on cortical nNOS/NK1R neuronal responsiveness to CCh. (A) c-FOS (magenta) expression in a cortical nNOS neuron (green) from a young mouse (P21) during a RS opportunity following 4 h sleep deprivation (SD). (B) Quantification of nNOS/NK1R cells expressing c-FOS in young mice (P19-21) that were either left undisturbed (“UndistB”), subjected to 4 h SD, or provided a 90 min RS opportunity after 4 h SD. (C) The effect of CCh bath application (50 μM) on current and (D) membrane potential (Vm) of SP-TMR-identified cortical nNOS/NK1R neurons in brain slices from juvenile mice previously exposed to 4 h SD. No significant differences were seen when compared to undisturbed controls (see Fig. 3F,G). (E) CCh significantly increases spontaneous excitatory postsynaptic currents (sEPSCs) in a similar manner to undisturbed mice, although the magnitude and duration of the response is blunted. Compare to Fig. 6A. (F) CCh reduces miniature EPSCs (mEPSCs) in brain slices from 4 h SD mice similarly to undisturbed controls but, again, the duration of the response is blunted. Compare to Fig. 6B. (G) Basal glutamatergic tone (frequency and amplitude of events) differs significantly between undisturbed (“UndistB”) and SD mice for both sEPSCs and (H) mEPSCs. These differences may account for the ceiling effect of CCh recorded on sEPSCs and a floor effect on mEPSCs. Application of TTX significantly reduced the amplitude of events in both undisturbed and SD mice whereas it increased and decreased their frequency in undisturbed and SD mice, respectively. Scale bar in A = 25 μm (BL, baseline; ***P < 0.001; **P < 0.01; *P < 0.05; n.s., nonsignificant).

Sleep Deprivation Does Not Affect the Type of Response of Cortical nNOS/NK1R Neurons to CCh Application But Does Affect Glutamatergic Input

Cholinergic release from the BF to the cortex is highest during waking and REM sleep (Jasper and Tessier 1971; Vazquez and Baghdoyan 2001) yet cortical nNOS/NK1R neurons show low c-FOS expression during these states (Morairty et al. 2013). To determine whether the BF cholinergic pathway is related to the hypothesized role of cortical nNOS/NK1R neurons in sleep homeostasis, we determined the response of nNOS/NK1R neurons to CCh application in mice (P14-23) that had been sleep deprived for 4 h prior to sacrifice.

We found that the voltage-clamp and current-clamp responses to CCh (50 μM) application were unaffected by prior wake history, with a predominant response of an inward current (CCh alone: −10.01 ± 1.99 pA; n = 9; CCh in TTX: −8.38 ± 1.82 pA; n = 8; Fig. 8C) and depolarization (CCh alone: 6.29 ± 1.18 mV; n = 9; CCh in TTX: 4.03 ± 0.79 mV; n = 7; Fig. 8D) comparable to CCh responses in undisturbed mice (Fig. 3F,G). Next, we measured the effect of SD on glutamatergic input. With 4 h SD, we found that CCh application increased sEPSCs onto cortical nNOS/NK1R cells (+327.5 ± 26.46 %, RM-ANOVA, P < 0.001; K-S test, P < 0.05; n = 6; Fig. 8E), similar to the CCh effect recorded in brain slices from undisturbed mice (+749 ± 16.99 %, RM-ANOVA, P < 0.001; K-S test, P < 0.01; n = 12). Nevertheless, the CCh-mediated effects on the glutamatergic inputs were blunted in magnitude and duration. In the presence of TTX (1 μM), the reduction in mEPSCs by CCh from baseline was also observed (71.08 ± 4.19 %, RM-ANOVA, P < 0.001; K-S test, P < 0.04; n = 4; Fig. 8F) and was comparable to the CCh response of undisturbed mice.

Since the effect of CCh sEPSCs could indicate altered composition of membrane receptors, we next measured the basal levels of glutamatergic tone prior to any CCh application. We found that SD increased the number of sEPSCs onto cortical nNOS/NK1R cells (undistB: 0.25 ± 0.03 Hz, n = 5; SD: 0.55 ± 0.04 Hz, n = 4; one-way ANOVA, P < 0.001; Fig. 8G, left panel), although the amplitude was decreased (undistB: 8.10 ± 0.13 pA, n = 5; SD: 6.30 ± 0.11 pA, n = 4; one-way ANOVA, P < 0.001; Fig. 8G, right panel). In TTX (1 μM), SD decreased mEPSCs relative to control levels (undistB: 0.46 ± 0.03 Hz, n = 5; SD: 0.33 ± 0.03 Hz, n = 7; one-way ANOVA, P < 0.05; Fig. 8H, left panel) but the amplitude was not significantly different (undistB: 6.10 ± 0.09 pA, n = 5; SD: 5.77 ± 0.11 pA, n = 4; one-way ANOVA, P > 0.05; Fig. 8H, right panel). In addition, the application of TTX significantly increased the number of glutamatergic events and decreased the amplitude of such events in undisturbed mice (frequency: +∆0.21 ± 0.00 Hz, n = 5, one-way ANOVA, P < 0.001; amplitude: −∆2.00 ± 0.04 pA, n = 5, one-way ANOVA, P < 0.001). In contrast, TTX significantly reduced both the number and amplitude of glutamatergic events in SD mice (frequency: −∆0.22 ± 0.01 Hz, n = 4 vs. 7, one-way ANOVA, P < 0.001; amplitude: −∆0.53 ± 0.00 pA, n = 4 vs. 5, one-way ANOVA, P < 0.01). These data suggest that extended wakefulness alters the glutamatergic tone, whereby there is more action potential-driven release of glutamate yet the spontaneous release of glutamate is actually reduced. Therefore, we suggest that the type of response of cortical nNOS/NK1R neurons to BF cholinergic innervation is not directly dependent on waking history, but that cortical network activity can modify the magnitude of the response to cholinergic stimulation.

Electrical Response of nNOS/NK1R Cells to CCh is Not Affected by Time of Day

To further assess whether prior sleep/wake history of the mouse from which slices were taken could affect the cholinergic responses on nNOS/NK1R neurons, we plotted the responses according to time of day. We found that the magnitude and direction of response to CCh bath application did not differ between slices taken at the beginning of the light cycle, when sleep pressure is typically high, and slices prepared just before lights off, when sleep pressure is low (Fig. 9A). Furthermore, there was no regional localization of the cortical nNOS cells recorded in this study that (i) responded to optogenetic stimulation of cholinergic terminals, (ii) displayed either excitatory or inhibitory responses to bath application of CCh, or (iii) colocalized with c-FOS following sleep opportunity after sleep deprivation. Fig. 9B summarizes the locations of the cortical nNOS neurons examined in this study.

Figure 9.

Figure 9.

CCh responses on nNOS/NK1R cells do not appear to be affected by time of day, age of mouse or cortical region. (A) Time course suggests the CCh-mediated effect on current is not affected by time of day or time of sacrifice (red arrows). (B) Schematic indicating localization of some of the cortical nNOS/NK1R cells used for this study. No discernible pattern relative to the response to cholinergic stimulation or colocalization with c-FOS was found. (C) Schematic summarizing the receptors involved in mediating cholinergic responses from putative BF projections onto cortical nNOS/NK1R cells.

Discussion

Projections from the BF to the cortex (Shute and Lewis 1967; Eckenstein et al. 1988; Jimenez-Capdeville et al. 1997; Henny and Jones 2008) are strongly implicated in cortical arousal and sleep/wake (Semba 1991; Brown et al. 2012). BF cholinergic neurons, located in the MCPO/SI, project throughout the cortex and mAChRs and nAChRs are densely expressed on cortical neurons. Multiple studies have demonstrated that the presence of different ACh ionotropic and metabotropic receptors across cortical layers enables ACh to be either excitatory or inhibitory, presumably depending upon the activity state of cortical cells and input from GABAergic interneurons (Kawaguchi 1997; Gulledge et al. 2007). The maximal firing state of cholinergic BF cells is a bursting pattern that is associated with cortical activation and which occurs during active wake and paradoxical sleep, states that are correlated with EEG gamma and theta activity (Lee et al. 2005). Accordingly, BF and cortical ACh levels vary across sleep/wake states (Jasper and Tessier 1971; Marrosu et al. 1995; Vazquez and Baghdoyan 2001). Optogenetic activation of BF cholinergic cells during NREM sleep promotes transitions to wakefulness (Han et al. 2014; Irmak and de Lecea 2014) while chemogenetic activation of BF ChAT cells decreases EEG delta power (Anaclet et al. 2015; Chen et al. 2016), supporting the concept that cortical ACh release from the BF promotes arousal. In contrast, cortical nNOS/NK1R cells, located in layer V-VI, express c-FOS during sleep and the percentage of c-FOS-positive nNOS/NK1R neurons directly correlates with NREM sleep time, NREM bout duration and EEG δ power during NREM sleep (Morairty et al. 2013). Consequently, we investigated the effects of cholinergic afferents on cortical nNOS/NK1R cells in the present study.

Electrophysiological Characterization of Cortical nNOS/NK1R Neurons

The electrophysiological characteristics of cortical nNOS/NK1R neurons were comparable in juvenile and adult mice. For example, we found that nNOS/NK1R neurons had Rin, cell capacitance, RMP and steady-state frequency values that were in concordance with previous reports (Dittrich et al. 2012; Perrenoud et al. 2012, 2013). Further pharmacological isolation of specific currents generated in cortical nNOS/NK1R neurons would help characterize the underlying features of these cells and may enable better insight into possible mechanisms of electrical modulation of these neurons.

BF Cholinergic Projection to Cortical nNOS/NK1R Neurons

Since cholinergic innervation spans layer V-VI and projects to nNOS-containing cells in the rat (Vaucher et al. 1997) and since BF stimulation increases c-FOS in nNOS cells (Kocharyan et al. 2008), we investigated the effects of BF-derived ACh on nNOS/NK1R cortical neurons. We found BF anterograde-labeled fibers close to the dendritic field and cell bodies of deep layer nNOS/NK1R neurons located near the cingulum within the cingulate cortex. Moreover, we found that some of these projections are contralateral which may permit bihemispheric control by the BF, potentially via modulation of these neurons, to mediate cortical desynchronization and arousal. A contralateral BF projection to cortical nNOS neurons was previously suggested based on BF stimulation in the rat (Kocharyan et al. 2008). Here, we provide anatomical evidence from the mouse brain to support this observation. Our optogenetic data suggests a functional cholinergic component to the basalocortical projection onto cortical nNOS/NK1R neurons, and our pharmacological assessments demonstrate cholinergic input generally excites nNOS/NK1R neurons.

Response of Cortical nNOS/NK1R Neurons to Cholinomimetics

We observed that the CCh evoked biphasic responses in nNOS/NK1R cells characterized by oscillatory behavior of both Vm and firing rate, and outward followed by inward currents. The predominant direct response to CCh application was depolarization of nNOS/NK1R cells (~71% of cells recorded). This response was mediated primarily by postsynaptic M3Rs and some nAChRs.

Activation of nAChRs on nNOS/NK1R neurons by NIC mainly evoked an outward current and hyperpolarization. However, the inhibitory response was largely abolished in the presence of TTX, blockers for both glutamate (CNQX, 7 μM and AP-5, 100 μM) and GABA (BIC, 10 μM and 2-HS, 5 μM), and 0 Ca2+/ 3.3 Mg2+-containing aCSF. The mechanism behind this inhibitory response is currently unclear and warrants further investigation, but may involve a Ca2+-dependent K+ conductance (Wong and Gallagher 1989). The occurrence of both ionotropic and metabotropic mechanisms may facilitate temporal control of nNOS/NK1R neurons in response to waking history via cholinergic signaling. Some SOM-containing interneurons are excited by CCh and the mAChR agonist muscarine (Kawaguchi 1997; Gulledge et al. 2007; Fanselow et al. 2008). Since the nNOS/NK1R cells are a subset of the SOM interneurons (Kubota et al. 2011), these results are directly relevant to those presented here.

Neurons that demonstrated CCh-induced inhibition (~29% of cells recorded) were found to predominantly express functional postsynaptic M4R, with possibly some contribution from M2R. The scRT-PCR analysis supported our pharmacological findings that the main receptor subtypes on cortical nNOS/NK1R neurons are M1R, M3R, M4R, and the nAChR beta4 subunit. Although the M2R was suggested by our pharmacological studies as possibly contributing to the inhibitory postsynaptic mAChR response, scRT-PCR did not detect any cells that expressed M2R. This discrepancy may be due to a lack of antagonist specificity against M2R relative to M4R, or may be a result of the limited number of cells sampled for scRT-PCR. Thus, although our data for M2R expression on cortical nNOS neurons may be inconclusive, other mAChRs are clearly more abundantly expressed. In addition, the detection of M1R mRNA in the absence of an effect of the M1R antagonist may be due to presynaptic localization of M1R in nNOS cells. The effects of presynaptic receptors are hardly observable with somatodendritic recordings. Addressing this point with immunohistochemistry is beyond the scope of the present study but would be of interest. Alternatively, it may be that the M1R mRNAs are not efficiently translated in these cells. M1R- and M3R-mediated cholinergic modulation is a major source of excitatory input to cortical SOM interneurons (Munoz et al. 2017), which are a superset of cortical nNOS/NK1R cells. scRT-PCR also indicated the presence of the M5R which we did not address with pharmacological tools.

Since nicotinic and muscarinic receptors appear in brain development as early as E10-E13 (Abreu-Villaca et al. 2011), their expression in juvenile mice can be expected to resemble that in adult mice. Indeed, bath application of CCh onto cortical nNOS/NK1R cells from adult mice evoked responses comparable to those observed in juvenile brain slices (Fig. S2). Although our scRT-PCR data report mRNA rather than protein expression, the pharmacological results presented herein indicate that most of these mRNA transcripts are translated into receptor proteins that are expressed on the cell membrane. This combined molecular/pharmacological approach to determine receptor expression has been used in other studies (Porter et al. 1999; Gallopin et al. 2006; Ferezou et al. 2007; Hill et al. 2007).

Isolation of the mEPSCs demonstrated that CCh evoked a reduction in glutamatergic input (~40% decrease) onto nNOS/NK1R cells, which was attributable to presynaptic M3R and some M2R. M2R has been classified as a presynaptic autoreceptor to decrease synaptic release (Thiele 2013). In addition, there is increasing evidence for a role of M3R to presynaptically regulate neural excitability (Grillner et al. 1999; Shen and Johnson 2000; Li et al. 2004). These data suggest a role for M3Rs and M2Rs to presynaptically regulate the excitability of cortical nNOS/NK1R cells, in addition to the postsynaptic effects we observed.

Functional Significance of Cholinergic Modulation of Cortical nNOS/NK1R Neurons

Given the role of cholinergic BF signaling in cortical desynchronization (Metherate et al. 1992; Metherate and Ashe 1993; Chen et al. 2016), we found the excitatory effect of cholinomimetics on cortical nNOS/NK1R neurons to be paradoxical since our previous studies indicated that Fos expression in these neurons is related to prior sleep/wake history (Dittrich et al. 2015). To address this paradox, we evaluated whether Fos induction in cortical nNOS/NK1R cells was age-dependent by determining c-FOS/nNOS expression in mice age-matched to those used in the in vitro pharmacology studies (Fig. 8B), and also evaluated whether the CCh response measured in juvenile mice in vitro was modified by extended periods of wakefulness in vivo prior to brain slice preparation (Figs 8C–H). As described in adult rodents (Gerashchenko et al. 2008; Pasumarthi et al. 2010; Morairty et al. 2013; Dittrich et al. 2015), we found that c-FOS/nNOS coexpression in young mice increased following a RS opportunity after a period of extended wakefulness. However, the proportion of c-FOS/nNOS coexpression was lower than in adults (18% vs. published reports of 60–80%), which may reflect the immature age at which these mice were studied. Juvenile mice respond to a 4 h homeostatic sleep challenge with increased sleep (sleep time and number of bouts) but there is considerable inter-individual variability in SWA following acute sleep deprivation until P42 (Nelson et al. 2013). Since we did not record SWA in the current study, it is possible that the lower c-FOS/nNOS expression in young mice may reflect this inter-individual variability. In juvenile brain slices prepared following 4 h SD, nNOS/NK1R neurons demonstrated responsiveness to CCh application that was similar to undisturbed mice. However, there was a change in glutamatergic tone onto these cells that may indicate network reorganization with prolonged wakefulness (Fig. 8G,H). Along with the absence of a diurnal variation of the CCh response (Fig. 9A), these results suggest that cholinergic modulation of cortical nNOS/NK1R cells is largely independent of sleep homeostasis (Kalinchuk et al. 2015) and age (Fig. S2).

In summary (Fig. 9C), our results demonstrate that BF neurons send projections to deep layer cortical nNOS/NK1R neurons, and that there is a cholinergic component to this connectivity. In addition, we show that cortical nNOS/NK1R neurons have a mixed response to cholinergic inputs, with excitation predominating. Notably, ACh mechanisms reduce glutamatergic input onto cortical nNOS/NK1R cells which, in turn, may prevent the NMDA-R dependent synaptic scaling of NO production previously found in neuronal cultures (Rameau et al. 2007). Under conditions of sleep deprivation, the increase in glutamatergic tone may downregulate nNOS production despite cholinergic responses remaining intact (Rameau et al. 2007).

Perspective

We hypothesize that a fine balance of BF cholinergic signaling, nNOS/NK1R neuron activity, and cortical synchronization involving other neurotransmitter systems orchestrate the regulation of sleep homeostasis (Jimenez-Capdeville et al. 1997). However, homeostatic sleep regulation is unlikely to be the exclusive function of the neural pathway from the BF cholinergic cells to cortical nNOS/NK1R neurons. To test this hypothesis, future studies will require in vivo characterization of the electrical activity of cortical nNOS/NK1R neurons relative to sleep/wake state and acetylcholine release to delineate the physiological relevance of this connection. Determination of whether the response of cortical nNOS/NK1R neurons to cholinergic stimulation is altered after a period of RS following extended wakefulness when these neurons show elevated c-FOS expression will also be of interest. Lastly, future efforts should evaluate GABAergic tone onto the cortical nNOS/NK1R cells, which may be modified by cholinergic input and sleep deprivation. Such studies will be necessary to fully understand the network dynamics that govern cortical states and sleep homeostasis.

Supplementary Material

Supplementary data is available at Cerebral Cortex online.

Funding

This work was supported by the National Institutes of Health (grant numbers R01HL059658, R01NS077408, R21NS087550, R01NS082876, R21NS083639 and R21NS085757) and by the Agence Nationale de la Recherche (grant number ANR 2011 MALZ 003 01, BC and JP).

Supplementary Material

Supplementary Data

Notes

The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. Conflict of Interest: None declared.

References

  1. Abreu-Villaca Y, Filgueiras CC, Manhaes AC. 2011. Developmental aspects of the cholinergic system. Behav Brain Res. 221:367–378. [DOI] [PubMed] [Google Scholar]
  2. Anaclet C, Pedersen NP, Ferrari LL, Venner A, Bass CE, Arrigoni E, Fuller PM. 2015. Basal forebrain control of wakefulness and cortical rhythms. Nat Commun. 6:8744. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Ascoli GA, Alonso-Nanclares L, Anderson SA, Barrionuevo G, Benavides-Piccione R, Burkhalter A, Buzsaki G, Cauli B, Defelipe J, Fairen A, et al. 2008. Petilla terminology: nomenclature of features of GABAergic interneurons of the cerebral cortex. Nat Rev Neurosci. 9:557–568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Borbely AA. 1982. A two process model of sleep regulation. Hum Neurobiol. 1:195–204. [PubMed] [Google Scholar]
  5. Brown RE, Basheer R, McKenna JT, Strecker RE, McCarley RW. 2012. Control of sleep and wakefulness. Physiol Rev. 92:1087–1187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Brown RE, McKenna JT. 2015. Turning a negative into a positive: ascending GABAergic control of cortical activation and arousal. Front Neurol. 6:135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cabezas C, Irinopoulou T, Cauli B, Poncer JC. 2013. Molecular and functional characterization of GAD67-expressing, newborn granule cells in mouse dentate gyrus. Front Neural Circuits. 7:60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cauli B, Audinat E, Lambolez B, Angulo MC, Ropert N, Tsuzuki K, Hestrin S, Rossier J. 1997. Molecular and physiological diversity of cortical nonpyramidal cells. J Neurosci. 17:3894–3906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cauli B, Tong XK, Rancillac A, Serluca N, Lambolez B, Rossier J, Hamel E. 2004. Cortical GABA interneurons in neurovascular coupling: relays for subcortical vasoactive pathways. J Neurosci. 24:8940–8949. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chen L, Yin D, Wang TX, Guo W, Dong H, Xu Q, Luo YJ, Cherasse Y, Lazarus M, Qiu ZL, et al. 2016. Basal forebrain cholinergic neurons primarily contribute to inhibition of electroencephalogram delta activity, rather than inducing behavioral wakefulness in mice. Neuropsychopharmacology. 8:2133–2146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Crunelli V, Hughes SW. 2010. The slow (<1 Hz) rhythm of non-REM sleep: a dialogue between three cardinal oscillators. Nat Neurosci. 13:9–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dittrich L, Heiss JE, Warrier DR, Perez XA, Quik M, Kilduff TS. 2012. Cortical nNOS neurons co-express the NK1R receptor and are depolarized by Substance P in multiple mammalian species. Front Neural Circuits. 6:31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dittrich L, Morairty SR, Warrier DR, Kilduff TS. 2015. Homeostatic sleep pressure is the primary factor for activation of cortical nNOS/NK1R neurons. Neuropsychopharmacology. 40:632–639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Eckenstein FP, Baughman RW, Quinn J. 1988. An anatomical study of cholinergic innervation in rat cerebral cortex. Neuroscience. 25:457–474. [DOI] [PubMed] [Google Scholar]
  15. Eglen RM, Nahorski SR. 2000. The muscarinic M(5) receptor: a silent or emerging subtype? Br J Pharmacol. 130:13–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Fanselow EE, Richardson KA, Connors BW. 2008. Selective, state-dependent activation of somatostatin-expressing inhibitory interneurons in mouse neocortex. J Neurophysiol. 100:2640–2652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Ferezou I, Hill EL, Cauli B, Gibelin N, Kaneko T, Rossier J, Lambolez B. 2007. Extensive overlap of mu-opioid and nicotinic sensitivity in cortical interneurons. Cereb Cortex. 17:1948–1957. [DOI] [PubMed] [Google Scholar]
  18. Franklin KBJ, Paxinos G. 2007. The Mouse Brain In Stereotaxic Coordinates. Amsterdam: Elsevier. [Google Scholar]
  19. Gallopin T, Geoffroy H, Rossier J, Lambolez B. 2006. Cortical sources of CRF, NKB, and CCK and their effects on pyramidal cells in the neocortex. Cereb Cortex. 16:1440–1452. [DOI] [PubMed] [Google Scholar]
  20. Gerashchenko D, Wisor JP, Burns D, Reh RK, Shiromani PJ, Sakurai T, de la Iglesia HO, Kilduff TS. 2008. Identification of a population of sleep-active cerebral cortex neurons. Proc Natl Acad Sci U S A. 105:10227–10232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Grillner P, Bonci A, Svensson TH, Bernardi G, Mercuri NB. 1999. Presynaptic muscarinic (M3) receptors reduce excitatory transmission in dopamine neurons of the rat mesencephalon. Neuroscience. 91:557–565. [DOI] [PubMed] [Google Scholar]
  22. Gritti I, Manns ID, Mainville L, Jones BE. 2003. Parvalbumin, calbindin, or calretinin in cortically projecting and GABAergic, cholinergic, or glutamatergic basal forebrain neurons of the rat. J Comp Neurol. 458:11–31. [DOI] [PubMed] [Google Scholar]
  23. Gulledge AT, Park SB, Kawaguchi Y, Stuart GJ. 2007. Heterogeneity of phasic cholinergic signaling in neocortical neurons. J Neurophysiol. 97:2215–2229. [DOI] [PubMed] [Google Scholar]
  24. Han Y, Shi YF, Xi W, Zhou R, Tan ZB, Wang H, Li XM, Chen Z, Feng G, Luo M, et al. 2014. Selective activation of cholinergic basal forebrain neurons induces immediate sleep-wake transitions. Curr Biol. 24:693–698. [DOI] [PubMed] [Google Scholar]
  25. Henny P, Jones BE. 2008. Projections from basal forebrain to prefrontal cortex comprise cholinergic, GABAergic and glutamatergic inputs to pyramidal cells or interneurons. Eur J Neurosci. 27:654–670. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Higo S, Akashi K, Sakimura K, Tamamaki N. 2009. Subtypes of GABAergic neurons project axons in the neocortex. Front Neuroanat. 3:25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Higo S, Udaka N, Tamamaki N. 2007. Long-range GABAergic projection neurons in the cat neocortex. J Comp Neurol. 503:421–431. [DOI] [PubMed] [Google Scholar]
  28. Hill EL, Gallopin T, Ferezou I, Cauli B, Rossier J, Schweitzer P, Lambolez B. 2007. Functional CB1 receptors are broadly expressed in neocortical GABAergic and glutamatergic neurons. J Neurophysiol. 97:2580–2589. [DOI] [PubMed] [Google Scholar]
  29. Hur EE, Zaborszky L. 2005. Vglut2 afferents to the medial prefrontal and primary somatosensory cortices: a combined retrograde tracing in situ hybridization study [corrected]. J Comp Neurol. 483:351–373. [DOI] [PubMed] [Google Scholar]
  30. Irmak SO, de Lecea L. 2014. Basal forebrain cholinergic modulation of sleep transitions. Sleep. 37:1941–1951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Jackman SL, Beneduce BM, Drew IR, Regehr WG. 2014. Achieving high-frequency optical control of synaptic transmission. J Neurosci. 34:7704–7714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Jasper HH, Tessier J. 1971. Acetylcholine liberation from cerebral cortex during paradoxical (REM) sleep. Science. 172:601–602. [DOI] [PubMed] [Google Scholar]
  33. Jimenez-Capdeville ME, Dykes RW, Myasnikov AA. 1997. Differential control of cortical activity by the basal forebrain in rats: a role for both cholinergic and inhibitory influences. J Comp Neurol. 381:53–67. [PubMed] [Google Scholar]
  34. Kalinchuk AV, Porkka-Heiskanen T, McCarley RW, Basheer R. 2015. Cholinergic neurons of the basal forebrain mediate biochemical and electrophysiological mechanisms underlying sleep homeostasis. Eur J Neurosci. 41:182–195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Karagiannis A, Gallopin T, David C, Battaglia D, Geoffroy H, Rossier J, Hillman EM, Staiger JF, Cauli B. 2009. Classification of NPY-expressing neocortical interneurons. J Neurosci. 29:3642–3659. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Kawaguchi Y. 1997. Selective cholinergic modulation of cortical GABAergic cell subtypes. J Neurophysiol. 78:1743–1747. [DOI] [PubMed] [Google Scholar]
  37. Kawaguchi Y, Kubota Y. 1996. Physiological and morphological identification of somatostatin- or vasoactive intestinal polypeptide-containing cells among GABAergic cell subtypes in rat frontal cortex. J Neurosci. 16:2701–2715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Kilduff TS, Cauli B, Gerashchenko D. 2011. Activation of cortical interneurons during sleep: an anatomical link to homeostatic sleep regulation? Trends Neurosci. 34:10–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Kocharyan A, Fernandes P, Tong XK, Vaucher E, Hamel E. 2008. Specific subtypes of cortical GABA interneurons contribute to the neurovascular coupling response to basal forebrain stimulation. J Cereb Blood Flow Metab. 28:221–231. [DOI] [PubMed] [Google Scholar]
  40. Kubota Y, Shigematsu N, Karube F, Sekigawa A, Kato S, Yamaguchi N, Hirai Y, Morishima M, Kawaguchi Y. 2011. Selective coexpression of multiple chemical markers defines discrete populations of neocortical GABAergic neurons. Cereb Cortex. 21:1803–1817. [DOI] [PubMed] [Google Scholar]
  41. Lambolez B, Audinat E, Bochet P, Crepel F, Rossier J. 1992. AMPA receptor subunits expressed by single Purkinje cells. Neuron. 9:247–258. [DOI] [PubMed] [Google Scholar]
  42. Lape R, Nistri A. 2000. Current and voltage clamp studies of the spike medium afterhyperpolarization of hypoglossal motoneurons in a rat brain stem slice preparation. J Neurophysiol. 83:2987–2995. [DOI] [PubMed] [Google Scholar]
  43. Leao RN, Mikulovic S, Leao KE, Munguba H, Gezelius H, Enjin A, Patra K, Eriksson A, Loew LM, Tort AB, et al. 2012. OLM interneurons differentially modulate CA3 and entorhinal inputs to hippocampal CA1 neurons. Nat Neurosci. 15:1524–1530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Lee JE, Jeon CJ. 2005. Immunocytochemical localization of nitric oxide synthase-containing neurons in mouse and rabbit visual cortex and co-localization with calcium-binding proteins. Mol Cells. 19:408–417. [PubMed] [Google Scholar]
  45. Lee MG, Hassani OK, Alonso A, Jones BE. 2005. Cholinergic basal forebrain neurons burst with theta during waking and paradoxical sleep. J Neurosci. 25:4365–4369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Li F, Endo T, Isa T. 2004. Presynaptic muscarinic acetylcholine receptors suppress GABAergic synaptic transmission in the intermediate grey layer of mouse superior colliculus. Eur J Neurosci. 20:2079–2088. [DOI] [PubMed] [Google Scholar]
  47. Marrosu F, Portas C, Mascia MS, Casu MA, Fa M, Giagheddu M, Imperato A, Gessa GL. 1995. Microdialysis measurement of cortical and hippocampal acetylcholine release during sleep-wake cycle in freely moving cats. Brain Res. 671:329–332. [DOI] [PubMed] [Google Scholar]
  48. Matthews EA, Linardakis JM, Disterhoft JF. 2009. The fast and slow afterhyperpolarizations are differentially modulated in hippocampal neurons by aging and learning. J Neurosci. 29:4750–4755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Metherate R, Ashe JH. 1993. Ionic flux contributions to neocortical slow waves and nucleus basalis-mediated activation: whole-cell recordings in vivo. J Neurosci. 13:5312–5323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Metherate R, Cox CL, Ashe JH. 1992. Cellular bases of neocortical activation: modulation of neural oscillations by the nucleus basalis and endogenous acetylcholine. J Neurosci. 12:4701–4711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Morairty SR, Dittrich L, Pasumarthi RK, Valladao D, Heiss JE, Gerashchenko D, Kilduff TS. 2013. A role for cortical nNOS/NK1R neurons in coupling homeostatic sleep drive to EEG slow wave activity. Proc Natl Acad Sci USA. 110:20272–20277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Munoz W, Tremblay R, Levenstein D, Rudy B. 2017. Layer-specific modulation of neocortical dendritic inhibition during active wakefulness. Science. 355:954–959. [DOI] [PubMed] [Google Scholar]
  53. Nelson AB, Faraguna U, Zoltan JT, Tononi G, Cirelli C. 2013. Sleep patterns and homeostatic mechanisms in adolescent mice. Brain Sci. 3:318–343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Pasumarthi RK, Gerashchenko D, Kilduff TS. 2010. Further characterization of sleep-active neuronal nitric oxide synthase neurons in the mouse brain. Neuroscience. 169:149–157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Perrenoud Q, Geoffroy H, Gauthier B, Rancillac A, Alfonsi F, Kessaris N, Rossier J, Vitalis T, Gallopin T. 2012. Characterization of Type I and Type II nNOS-expressing interneurons in the barrel cortex of mouse. Front Neural Circuits. 6:36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Perrenoud Q, Rossier J, Geoffroy H, Vitalis T, Gallopin T. 2013. Diversity of GABAergic interneurons in layer VIa and VIb of mouse barrel cortex. Cereb Cortex. 23:423–441. [DOI] [PubMed] [Google Scholar]
  57. Perry S, Gezelius H, Larhammar M, Hilscher MM, Lamotte d’Incamps B, Leao KE, Kullander K. 2015. Firing properties of Renshaw cells defined by Chrna2 are modulated by hyperpolarizing and small conductance ion currents Ih and ISK. Eur J Neurosci. 41:889–900. [DOI] [PubMed] [Google Scholar]
  58. Porter JT, Cauli B, Tsuzuki K, Lambolez B, Rossier J, Audinat E. 1999. Selective excitation of subtypes of neocortical interneurons by nicotinic receptors. J Neurosci. 19:5228–5235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Rameau GA, Tukey DS, Garcin-Hosfield ED, Titcombe RF, Misra C, Khatri L, Getzoff ED, Ziff EB. 2007. Biphasic coupling of neuronal nitric oxide synthase phosphorylation to the NMDA receptor regulates AMPA receptor trafficking and neuronal cell death. J Neurosci. 27:3445–3455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Semba K. 1991. The cholinergic basal forebrain: a critical role in cortical arousal. Adv Exp Med Biol. 295:197–218. [DOI] [PubMed] [Google Scholar]
  61. Shen KZ, Johnson SW. 2000. Presynaptic dopamine D2 and muscarine M3 receptors inhibit excitatory and inhibitory transmission to rat subthalamic neurones in vitro. J Physiol. 525(Pt 2):331–341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Shute CC, Lewis PR. 1967. The ascending cholinergic reticular system: neocortical, olfactory and subcortical projections. Brain. 90:497–520. [DOI] [PubMed] [Google Scholar]
  63. Smiley JF, McGinnis JP, Javitt DC. 2000. Nitric oxide synthase interneurons in the monkey cerebral cortex are subsets of the somatostatin, neuropeptide Y, and calbindin cells. Brain Res. 863:205–212. [DOI] [PubMed] [Google Scholar]
  64. Steriade M, McCormick DA, Sejnowski TJ. 1993. Thalamocortical oscillations in the sleeping and aroused brain. Science. 262:679–685. [DOI] [PubMed] [Google Scholar]
  65. Thiele A. 2013. Muscarinic signaling in the brain. Annu Rev Neurosci. 36:271–294. [DOI] [PubMed] [Google Scholar]
  66. Tomioka R, Okamoto K, Furuta T, Fujiyama F, Iwasato T, Yanagawa Y, Obata K, Kaneko T, Tamamaki N. 2005. Demonstration of long-range GABAergic connections distributed throughout the mouse neocortex. Eur J Neurosci. 21:1587–1600. [DOI] [PubMed] [Google Scholar]
  67. Tomioka R, Rockland KS. 2007. Long-distance corticocortical GABAergic neurons in the adult monkey white and gray matter. J Comp Neurol. 505:526–538. [DOI] [PubMed] [Google Scholar]
  68. Tricoire L, Vitalis T. 2012. Neuronal nitric oxide synthase expressing neurons: a journey from birth to neuronal circuits. Front Neural Circuits. 6:82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Vaucher E, Linville D, Hamel E. 1997. Cholinergic basal forebrain projections to nitric oxide synthase-containing neurons in the rat cerebral cortex. Neuroscience. 79:827–836. [DOI] [PubMed] [Google Scholar]
  70. Vazquez J, Baghdoyan HA. 2001. Basal forebrain acetylcholine release during REM sleep is significantly greater than during waking. Am J Physiol Regul Integr Comp Physiol. 280:R598–R601. [DOI] [PubMed] [Google Scholar]
  71. Wess J. 2004. Muscarinic acetylcholine receptor knockout mice: novel phenotypes and clinical implications. Annu Rev Pharmacol Toxicol. 44:423–450. [DOI] [PubMed] [Google Scholar]
  72. Williams RH, Chee MJ, Kroeger D, Ferrari LL, Maratos-Flier E, Scammell TE, Arrigoni E. 2014. Optogenetic-mediated release of histamine reveals distal and autoregulatory mechanisms for controlling arousal. J Neurosci. 34:6023–6029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Wong LA, Gallagher JP. 1989. A direct nicotinic receptor-mediated inhibition recorded intracellularly in vitro. Nature. 341:439–442. [DOI] [PubMed] [Google Scholar]
  74. Yan XX, Garey LJ. 1997. Morphological diversity of nitric oxide synthesising neurons in mammalian cerebral cortex. J Hirnforsch. 38:165–172. [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Data

Articles from Cerebral Cortex (New York, NY) are provided here courtesy of Oxford University Press

RESOURCES