Abstract
Background:
C type lectin (CTL) family is a type of calcium-dependent proteins found in vertebrates and invertebrates. The objective of this study was to perform a comparative analysis and phylogenetic inferring for understanding the similarities and differences of carbohydrate recognition domain (CRD) domain of Toxocara canis CTL and other nematodes, and similar C type lectin involved in the immune system of mouse and human as their host.
Methods:
The female T. canis was retrieved from the 2–6 months puppies (Department of Parasitology, Faculty of Veterinary Medicine, University of Tehran, 2015). To collect T. canis eggs, the worms were cultured for 5 d until they were embryonated. The hatching process was accelerated for collecting the stage 2 larvae, and the larvae were cultured for a week. A cDNA library was made from the total mRNA of T. canis infective larvae. The PCR amplification for C type lectin gene was performed and the amino acids were analyzed using the alignment method and the construction of phylogenetic tree.
Results:
The suspension sample maintained at 30 ºC for four weeks could embryonate 90%–100% of eggs. T. canis CTL gene was 657 bp in length and encoded a protein with 219 amino acids. The CTL of species of Strongylida order were closely placed in the tree, whereas the members of Ascaridida orders were located in a separate branch. High levels of similarity (36%–44%) and conservation of C type lectin from T. canis with mouse and human C type lectins. Its C type lectin showed a higher similarity with asialoglycoprotein receptor (ASGPR), macrophage lectin, dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin (DC-SIGN), MINCLE receptor of mouse and human.
Conclusion:
Analysis of CRD domain of C type lectin protein could make a better understanding of their role in the interaction of nematode parasite with their hosts.
Keywords: Nematoda, Toxocara canis, C type lectin, Phylogenetic analysis
Introduction
Toxocariasis is a cosmopolitan disease caused by Ascarid nematodes named T. canis and T. cati, which are gastrointestinal parasites of canids and felids, respectively. Embryonated ova infect paratenic hosts including human and mice, but the larvae do not mature and migrate through a soft tissue and then reside as an arrested larvae for a long time extend to years (1). In the tissue of the paratenic hosts, the larvae shed proteins, including a family of glycoproteins containing C type lectin domain, from their cuticle (2). This family has been found among both parasitic and free-living nematodes, as well as other invertebrate and vertebrate animals.
C type lectin is a family of calcium-dependent glycoproteins that their carbohydrate recognition domain (CRD) binds to mono and oligosaccharides. They recognize pathogens and involve in the cellular interactions through protein-carbohydrate interactions (3). Proteins from this family contain one or more CRD with 110–130 amino acid residues, the existence of multiple CRDs exceed the avidity of proteins to their ligands (4). Although these proteins share structural homology, they have variable amino acid sequences within the CRD. The diversity of CRD can improve the interaction and binding of lectin with different carbohydrates (5). This domain has a characteristic double-loop connected by two highly conserved disulfide bonds, which have up to four Ca++ binding sites. The proteins with C type lectin domains in mammalian as nematode hosts are a family associated with immune responses.
This family can be categorized by their functional and structural characteristics into five main classes. Class I contains Lecticans interacting with carbohydrate and protein ligands through a hyaluronan binding domain and a C type lectin domain. Four lecticans have been identified including aggrecan, versican, neurocan, and brevican that all four glycoproteins are expressed in the nervous system (6). Class II named collections consists of C type lectin and collagen domains. This subfamily contains proteins such as Lung surfactant proteins A and D (SP-A and SP-D), Mannan-binding lectin (MBL) and conglutinin involved in innate immune defense through binding pathogens carbohydrates and then aggregation, and phagocytosis (7, 8). Class III or selectins (CD62), are a subfamily of cell adhesion glycoproteins involved in the inflammation processes. There are three types of selectins including L-selectin (leucocytes), E-selectin (endothelial cells), and P-selectin (platelets). Class IV contains CD23 that is an antibody receptor found on IL4 activated B cells, activated macrophages, and eosinophils and have a role in IgE regulation (9). Class V consists C type lectins which act as receptor-mediated endocytosis, and include the asialoglycoprotein receptor (ASGPR), the macrophage mannose receptor, DC-SIGN (dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin), and the macrophage galactose-binding lectin (MGL) in myeloid cells (5).
Recently, C type lectins have been identified from parasitic worms. The function of this family involves in various biological activities, including impede host immune system by interfere host-parasite interaction (10) and other functions such as binding to host ligands (11), antibacterial function (12), and interfere with the mucin that secreted in response to the worm infection in gastrointestinal nematode infections (13). The parasite lectins from Ancylostoma ceylanicum play a role in reproduction (14). C type lectin is one of the secreted glycoproteins of the T. canis larvae (L2) with 219 amino acids.
We aimed to perform a comparative analysis and phylogenetic inferring for understanding the similarities and differences of CRD domain of T. canis CTL and other nematodes, Loa loa XP003142450, Brugia malayi XP001892052, Trichinella spiralis XP003380979, Trichuris suis KFD52311, Strongyloides ratti CEF60330, Dictyocaulus viviparus KJH47372, Ancylostoma ceylanicum AAD51335, Necator americanus AAY58318, Laxus oneistus AAX22004, Caenorhabditis elegans NP507547, Caenorhabditis brenneri EGT51156, Ancylostoma duodenale KIH65040, Nippostrongylus brasiliensis ACS37723, Heligmosomoides polygyrus ACS37721, Oesophagostomum dentatum KHJ91188, Haemonchus contortus CDJ85736, Caenorhabditis remanei XP003095271, Caenorhabditis briggsae XP002648922, Ascaris suum ADM49197, T. canis ctl 4 AAD31000, T. canis ctl 1 AAB96779, and also similar C type lectin involved in the immune system of mouse and human as their host.
Materials and Methods
In vitro culture of adult T. canis
The study was approved by Ethics Committee of faculty of Veterinary Medicine, University of Tehran.
The female T. canis was retrieved from the 2–6 months puppies following the method described by Ponce Macotela (15). Worms were isolated and then were washed with paintbrush and normal saline for three times in order to remove the debris and contamination from their surfaces. Twenty female worms were separated and transferred to 20 ml of preheated sterile RPMI 1640 (Gibco) (at the Department of Parasitology of Faculty of Veterinary Medicine, University of Tehran, 2015), the media contained penicillin (100 U/ml), streptomycin (100 μg/ml), amphotericin B (50 μg/ml) (Sigma-Aldrich Chemie GmbH, Germany). The adult female T. canis was maintained in tissue culture flasks (Sigma - Aldrich canted neck flasks, 25 cm2) in an incubator at 37 ºC and 5% carbon dioxide. To collect T. canis eggs, the worms were transferred to a new culture flask every 24 h for 5 d. The collected medium was centrifuged, then the collected eggs were washed twice with 1.0% formaldehyde, and incubated in PBS (pH: 7.2), a solution containing 1.0% formaldehyde and amphotericin B (50 μg/ml) until eggs were embryonated.
To determine the effects of different temperatures and media, eggs were divided into three batches. The groups differed in temperature. The three groups with 1% formalin were maintained at 30 °C, 27 °C, and 23 °C at 60% humidity. An inverted microscope monitored samples until the development of eggs. We counted the numbers of embryonated eggs at the end of sixth week.
In vitro culture of infective larvae
In order to induce egg hatching, the eggs were washed three times with sterile distilled water. A suspension containing 1000 eggs was mixed with sodium hypochlorite (4%–14% free chlorine) and maintained at 37 °C in an incubator while the mixture was shaking. After 20 min the outer layer of eggs was removed. Then the eggs were washed with sterile distilled water until the chlorine was unnoticeable. Then for accelerating the hatching process, the remained coated layer of eggs were mechanically destroyed using a hand-held homogenizer, then the mixture of larvae and debris was added to the Baermann apparatus for separating the motile larvae.
The collected larvae were cultured at 37 °C incubator with 5% CO2 in the medium RPMI 1640 supplemented with 1% (w/v) glucose, 100 U/ml penicillin, 100 μgr/ml streptomycin, and 50 μgr/ml amphotericin B for a week (16).
After a week, for collecting the stage 2 larvae, the media was centrifuged at 200 gr for 10 min at 4 °C, and then the larvae were maintained in −80 °C until it was used for mRNA extraction.
cDNA synthesis and C type lectin PCR amplification
The mRNA was extracted from 1000 infective larvae by following the manufacturer’s instructions (Tripure Isolation Reagent, Roche). A cDNA library was made from the mRNA of T. canis infective larvae. First, the PCR amplification was performed for cytochrome oxidase 1 gene to confirm that the cDNA made belongs to the T. canis. Then the PCR amplification for C type lectin gene was performed in a 25 μl volume containing 1 μl cDNA sample and 23 μl reaction mixture, containing two micromols of each primer (forward) 5′,<GGATCCATGATGATCGCCGC>-3′ and (reverse) 5′-, <GAATTCTTAGAGAGGTCTCT> -3′. The PCR conditions were as follows: an initial denaturing step (95 °C for 5 min) followed by 35 cycles, with each cycle consisting of denaturation at 94 °C for 45 sec, annealing at 67 °C for 45 sec, elongation at 72 °C for 45 sec, and a final extension at 72 °C for 10 min. For the detection of the PCR amplicons, 8 μl of the PCR products were separated using 1% agarose gel electrophoresis. The PCR products were purified using the quick PCR products purification kit (MBST, Iran).
The C type lectin template of T. canis was digested with BamHI and EcoRI, and consequently, the TA plasmid vector was double digested with the same restriction endonucleases. The PCR product of the C type lectin gene was cloned to TA plasmid using the rapid DNA ligation kit (Fermentase, Lithuania).
Sequence alignment and Phylogenetic analysis
The sequence chromatograms were analyzed using the Chromas software version 3.1 and compared to those registered in the GenBank, using the Basic Local Alignment Search Tool (BLAST).
The C type lectin domain sequences contain 110–130 amino acids of T. canis, and other nematodes were obtained from GenBank (https://www.ncbi.nlm.nih.gov/). The sequences were aligned using Tcoffee with Clustal W2 method, then analyzed by the CLC sequence viewer software version 6.6.2. The conserved and variable regions were evaluated by CLC software. Phylogenetic tree was constructed by MEGA 6 software package using the neighbor-joining (NJ) algorithm, and bootstrap was set on 1000 (17).
Results
In vitro culture of adult T. canis and infective larvae
T. canis adult worms were cultured for 5 d. There were significant differences between the numbers of the embryonated eggs at different temperatures (P<0.0%). In average, 90%–100% of the eggs in samples kept at 30 °C were embryonated, whereas for the second and third group cultured at 27 °C and 23 °C, only 40%–50% and 10%–20% of eggs were embryonated, respectively. Increasing in temperature caused a rise in the number of developed eggs. The suspension eggs mixed with 1% formalin and amphotericin B (50 μg/ml) at 30 °C could be fully embryonated within 6 wk without fungal or bacterial contaminations.
Electrophoresis and sequencing of CTL from Toxocara canis infective larvae
A cDNA library was derived from T. canis larvae (L2). The CTL sequence was submitted to the GenBank with the accession number of KU852582 (Fig. 1). T. canis CTL gene was 657 bp in length and encoded a protein with 219 amino acids with a molecular weight of about 24 kDa. The CTL sequence includes a signal peptide of 18 residues, and a CTL domain starting at residue 81 to 216. The sequencing result of C type lectin retrieved from the isolates of T. canis from dogs in Iran I showed few differences in amino acid sequences at position 22 and 147 with the excretory-secretory C-type lectin TES-32, isolated from United Kingdom (AAB96779) and differed in amino acid at position 56 with proteoglycan core protein, isolated from Japan (BAA31253).
Fig. 1:
Gel electrophoresis of a PCR product 657 bp segment of C type lectin gene of T. canis. From left to right: lane 1 negative control, lane 2 100-bp DNA marker, lanes 3 and 4 PCR product 657 bp segment of C type lectin gene.
Phylogenetic Analysis
The topology of tree shows four groups. In group 1, the close relationships among L. loa, T. spiralis, B. malayi, T. suis, S. ratti, A. ceylanicum, N. americanus, L. oneistus in C type lectin sequences, although the sequences in L. loa, B. malayi, T. spiralis are more similar to each other than the other members of this group.
The nearest relative to the mentioned cluster is group 2 that includes C. elegans, A. duodenale, N. brasiliensis, H. polygyrus. O. dentatum, H. contortus, C. remanei, C. briggsae, showing less relationship to other nematodes located in a separate branch. Forth cluster separated as a distinct branch includes A. suum, CTL 1, CTL 4, T. canis and C type lectin sequenced in our study. The CTL 1 sequence and C type lectin sequenced in our study located in sister branch and the most similar sequences were CTL 4 and C type lectin of A. suum (Fig. 2).
Fig. 2:
Phylogenetic tree of CTLs of parasitic and free-living nematodes. Phylogenetic tree of nematode C type lectin was constructed using the neighbor-joining (NJ) algorithm (with a bootstrap value of 1000 replicates) based on differences in the C type lectin amino acid sequences of parasitic and free-living nematodes. Species names and accession numbers place at the tips of the branches. The CTLs of free-living nematodes are marked by ●, CTLs of T. canis that retrieved from the GenBank are shown ▲ and the CTL sequenced in our study is shown by ■. :.
Similarities with mammalian C type lectins
The T. canis C type lectin sequences were used to search for proteins with C type lectin domain that involved in the immune response of mouse and human as the paratenic hosts of T. canis. The sequences were aligned using Tcoffee with Clustal W2 method, then analyzed using CLC sequence viewer software version 6.6.2. The conservation scale in this result was defined as a score from 0% to 100%.
The closest similarity to T. canis C type lectin was for macrophage lectin, asialoglycoprotein receptor, CD23, galactose and N-acetylgalactosamine-specific lectin, macrophage C type lectin, Mincle receptor, mannose-binding protein and DC-SIGN. The sequences retrieved from the GenBank and BLAST results showed 21%-31% similarity to T. canis C type lectin sequence, although if similarity between sequences is expressed based on percent positive substitutions, they would show a similarity of 36%–44% (18).
Discussion
Lectins are molecules extremely diverse in amino acid sequences. Their functions in the processes of carbohydrate recognition are influenced by their versatility. T. canis CTL contains a single CRD, whereas the CTLs of some nematodes such as A. ceylanicum, N. americanus, H. contortus, O. dentatum, C. elegans have two or more CRDs. T. canis C type lectin has been considered as an important protein in immunogenicity in host-parasite interactions (11).
The Phylogenetic results from C type lectin of nematodes revealed that the high polymorphism in this gene could relate to differences in their taxonomic positions as well as their life cycles. The most nematode C type lectin sequences registered in the GenBank databases belong to Strongylida order (A. ceylanicum AAD51335, N. americanus AAY58318, A. duodenale KIH65040, O. dentatum KHJ91188, H. contortus CDJ85736, N. brasiliensis ACS37723, H. polygyrus ACS37721, D.viviparus KJH47372). The Phylogenetic relationships based on CRD domain among different nematodes showed that the gastrointestinal nematode species of Strongylida order were closely placed in the tree, although the other member of this order, D. viviparus as a nematode living in lung were in near branches with nematodes belongs to Filarioidea (loa loa XP003142450, B. malayi XP001892052) and Trichocephalida (T. suis KFD52311, T. spiralis XP003380979). Loa loa and B. malayi as filarial nematodes were clustered with each other in a clad and T. spiralis as parasite that lives within a muscle cell was more similar to the clad mentioned. The Members of Ascaridida orders were located in a separate branch. The Phylogenetic analysis of identified parasitic nematode CTLs showed that the similarities within the species of a family are more common in comparison with distinct families.
These proteins involved in innate defense to encounter the pathogens of their environment (19). In contrast, the proteomic analysis of parasitic nematodes revealed that they have fewer proteins with C type lectin domain modified according to their life cycles, to play a role in parasite-host interface (20, 21).
For further alignment analysis, the sequences of the T. canis CTL and the proteins with C type lectin domain involved in mammalian immune responses were aligned. These results showed a high conservation at four cysteine residues forming two disulfide bonds and these residues are considered critical for the fundamental structure. Calcium binding site two is the most important residues for binding sugar. The amino acids that have a carboxylic acid group as the side chain, consist of aspartic acid and glutamic acid, are often involved in the Ca++ binding site in the CRD. The conserved motifs that bind to sugar are EPN and its substitutes QPD and WND are important motifs in the calcium binding reaction (22). These motifs determine the monosaccharide binding specificity of C type lectins, EPN binds Man/GlcNAc and QPD binds Glc/Gal. T. canis CTL has QPD motif similar to ASGPR and macrophage C type lectin, and others have EPN. T. canis CTL showed a higher similarity with ASGPR, macrophage lectin, DCSIGN, MINCLE and less similarity with MBP, although T. canis CTL is considered to bind both mannose and GalNAc monosaccharides (10), also T. canis CTL showed about 28% similarity with lecticans including bravican, aggrican, neurocan and versican specifically expressed in the nervous system (Fig. 3, 4).
Fig. 3:
Aligned amino acid sequences of T. canis, C type lectin, and C-type lectin of other nematodes. Conserved cysteine residues are highlighted in yellow. The carbohydrate recognition motif as conserved residues that bind to sugar is indicated by an A bracket. The conservation score is indicated at the bar graph for each column of the alignment
Fig. 4:
Aligned amino acid sequences of T. canis C type lectin and C type lectin proteins of immune system. Conserved cysteine residues are highlighted in yellow. The carbohydrate recognition motif as conserved residues that bind to sugar is indicated by an A bracket. The conservation score is indicated at the bar graph for each column of the alignment
It is essential for T. canis as a nematode live for a long time in the tissues such as nervous tissues, to escape from the host immune system, and CTL is one of the most glycoprotein secreted by this nematode in larval stages. Likewise, Free-living nematodes encode abundant proteins with C type lectin domain. Nematode CTLs are considered to play several functions such as tissue recognition during their migration in host tissues involving in evading from immune system and by their similarity to the host proteins such as selectins. They can interfere cell adhesion, which is important for leukocyte recruitment to the sites of inflammation and injury. Some inconsistent existence in the grouping of sequences may become resolve by identifying more C type lectin sequences within different order of nematodes.
Conclusion
The analysis of CRD domain of C type lectin protein of T. canis could expand our understanding of host-parasite interaction and immune responses in toxocariasis. It is important for T. canis larvae to escape from the host immune system and CTL has been considered as an important protein in immunogenicity of T. canis. CTL of T. canis shares similar sequence with proteins of immune system of their hosts such as mouse and human. A deep insight into phylogenetic relationships and study the sequence variability and similarity are crucial for study of sequence evolution and identification of functional regions of this protein.
Acknowledgements
This study was supported by grant number: 93016151, from Iran National Science Foundation.
Footnotes
Conflict of interest
The authors declare that there is no conflict of interest.
References
- 1.Holland CV, Smith HV. Toxocara: The Enigmatic Parasite. CABI Publishing, Wallingford: 2006; pp. 302. [Google Scholar]
- 2.Loukas A, Doedens A, Hintz M, Maizels RM. Identification of a new C-type lectin, TES-70, secreted by infective larvae of Toxocara canis, which binds to host ligands. Parasitology. 2000; 121 Pt 5:545–54. [DOI] [PubMed] [Google Scholar]
- 3.Drickamer K. C-type lectin-like domains. Curr Opin Struct Biol. 1999;9(5):585–90. [DOI] [PubMed] [Google Scholar]
- 4.Weis WI, Taylor ME, Drickamer K. The C-type lectin superfamily in the immune system. Immunol Rev. 1998;163:19–34. [DOI] [PubMed] [Google Scholar]
- 5.Cummings RD, McEver RP. C-type Lectins. In: Varki A, Cummings RD, Esko JD. (Eds), Essentials of Glycobiology. second ed Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press; 2009; Chapter 31, 465–480. [Google Scholar]
- 6.Yamaguchi Y. Lecticans: organizers of the brain extracellular matrix. Cell Mol Life Sci. 2000; 57(2):276–89. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Holmskov UL. Collectins and collectin receptors in innate immunity. APMIS Suppl. 2000, 100:1–59. [PubMed] [Google Scholar]
- 8.van de Wetering JK, van Golde LM, Batenburg JJ. Collectins: players of the innate immune system. Eur J Biochem. 2004; 271(7):1229–49. [DOI] [PubMed] [Google Scholar]
- 9.Kijimoto-Ochiai S. CD23 (the low-affinity IgE receptor) as a C-type lectin: a multidomain and multifunctional molecule. Cell Mol Life Sci. 2002; 59(4):648–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Loukas A, Maizels RM. Helminth C-type lectins and host–parasite interactions. Parasitol Today. 2000; 16(8):333–9. [DOI] [PubMed] [Google Scholar]
- 11.Loukas A, Mullin NP, Tetteh KK, et al. A novel C-type lectin secreted by a tissue-dwelling parasitic nematode. Curr Biol. 199;9(15):825–8. [DOI] [PubMed] [Google Scholar]
- 12.Mallo GV, Kurz CL, Couillault C, Pujol N, Granjeaud S, Kohara Y, Ewbank JJ. Inducible antibacterial defense system in C. elegans. Curr Biol. 2002; 12(14):1209–14. [DOI] [PubMed] [Google Scholar]
- 13.Soga K, Yamauchi J, Kawai Y, et al. Alteration of the expression profiles of acidic mucin, sialytransferase, and sulfotransferases in the intestinal epithelium of rats infected with the nematode Nippostrongylus brasiliensis. Parasitol Res. 2008;103(6):1427–34. [DOI] [PubMed] [Google Scholar]
- 14.Brown AC, Harrison LM, Kapulkin W, et al. Molecular cloning and characterization of a C-type lectin from Ancylostoma ceylanicum: evidence for a role in hookworm reproductive physiology. Mol Biochem Parasitol. 2007;151(2):141–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Ponce-Macotela M, Peralta-Abarca GE, Martínez-Gordillo MN. Giardia intestinalis and other zoonotic parasites: prevalence in dogs from the southern part of Mexico City. Vet Parasitol. 2005;131(1–2):1–4. [DOI] [PubMed] [Google Scholar]
- 16.Page AP, Richards DT, Lewis JW, Omar HM, Maizels RM. Comparison of isolates and species of Toxocara and Toxascaris by biosynthetic labelling of somatic and ES proteins from infective larvae. Parasitology. 1991;103 Pt 3:451–64. [DOI] [PubMed] [Google Scholar]
- 17.Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol. 2013;30(12):2725–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Pearson WR. An Introduction to Sequence Similarity (“Homology”) Searching. Curr Protoc Bioinformatics. 2013. Chapter 3: Unit 3.1. doi: 10.1002/0471250953.bi0301s42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Schulenburg H, Hoeppner MP, Weiner J, 3rd, Bornberg-Bauer E. Specificity of the innate immune system and diversity of C-type lectin domain (CTLD) proteins in the nematode Caenorhabditis elegans. Immunobiology. 2008; 213(3–4):237–50. [DOI] [PubMed] [Google Scholar]
- 20.Yoshida A, Nagayasu E, Horii Y, Maruyama H. A novel C-type lectin identified by EST analysis in tissue migratory larvae of Ascaris suum. Parasitol Res. 2012;110(4):1583–6. [DOI] [PubMed] [Google Scholar]
- 21.Ganji S, Jenkins JN, Wubben MJ. Molecular characterization of the reniform nematode C-type lectin gene family reveals a likely role in mitigating environmental stresses during plant parasitism. Gene. 2014; 537(2):269–78. [DOI] [PubMed] [Google Scholar]
- 22.Kong P, Wang L, Zhang H, Song X, Zhou Z, Yang J, Qiu L, Wang L, Song L. A novel C-type lectin from bay scallop Argopecten irradians (AiCTL-7) agglutinating fungi with mannose specificity. Fish Shellfish Immunol. 2011;30(3):836–44. [DOI] [PubMed] [Google Scholar]