Skip to main content
Brain logoLink to Brain
. 2018 May 3;141(7):2194–2212. doi: 10.1093/brain/awy117

Tau reduction in the presence of amyloid-β prevents tau pathology and neuronal death in vivo

Sarah L DeVos 1, Bianca T Corjuc 1, Caitlin Commins 1, Simon Dujardin 1, Riley N Bannon 1, Diana Corjuc 1, Benjamin D Moore 1, Rachel E Bennett 1, Mehdi Jorfi 2, Jose A Gonzales 1, Patrick M Dooley 1, Allyson D Roe 1, Rose Pitstick 2, Daniel Irimia 3, Matthew P Frosch 1,4, George A Carlson 3, Bradley T Hyman 1,✉
PMCID: PMC6022692  PMID: 29733334

In vivo tau reduction strategies thus far have been studied in the absence of Aβ deposition. DeVos et al. suppress human tau in mice that develop both Aβ and tau pathologies. Lowering human tau expression reduces neurofibrillary tangles and prevents neuronal loss equally effectively in the presence of Aβ plaques.

Keywords: Alzheimer’s disease, tau, amyloid-beta, transgenic model, neurofibrillary tangles

Abstract

Several studies have now supported the use of a tau lowering agent as a possible therapy in the treatment of tauopathy disorders, including Alzheimer’s disease. In human Alzheimer’s disease, however, concurrent amyloid-β deposition appears to synergize and accelerate tau pathological changes. Thus far, tau reduction strategies that have been tested in vivo have been examined in the setting of tau pathology without confounding amyloid-β deposition. To determine whether reducing total human tau expression in a transgenic model where there is concurrent amyloid-β plaque formation can still reduce tau pathology and protect against neuronal loss, we have taken advantage of the regulatable tau transgene in APP/PS1 × rTg4510 mice. These mice develop both neurofibrillary tangles as well as amyloid-β plaques throughout the cortex and hippocampus. By suppressing human tau expression for 6 months in the APP/PS1 × rTg4510 mice using doxycycline, AT8 tau pathology, bioactivity, and astrogliosis were reduced, though importantly to a lesser extent than lowering tau in the rTg4510 alone mice. Based on non-denaturing gels and proteinase K digestions, the remaining tau aggregates in the presence of amyloid-β exhibit a longer-lived aggregate conformation. Nonetheless, lowering the expression of the human tau transgene was sufficient to equally ameliorate thioflavin-S positive tangles and prevent neuronal loss equally well in both the APP/PS1 × rTg4510 mice and the rTg4510 cohort. Together, these results suggest that, although amyloid-β stabilizes tau aggregates, lowering total tau levels is still an effective strategy for the treatment of tau pathology and neuronal loss even in the presence of amyloid-β deposition.

Introduction

Alzheimer’s disease is the most common neurodegenerative disease, pathologically defined by two hallmarks: intraneuronal neurofibrillary tangles, composed of hyperphosphorylated tau, and extracellular plaques, which result from the accumulation of the amyloid-β peptide (Hyman et al., 1984; Braak and Braak, 1991). While both pathological hallmarks are required for the development of Alzheimer’s disease, the close correlation between tau deposition with cognitive decline (Arriagada et al., 1992; Nelson et al., 2012), in addition to genetic evidence that mutations in the tau gene (MAPT) alone can result in widespread neurodegeneration (Buee and Delacourte, 1999), highlights the importance of tau pathology in the pathogenesis of the disease.

One therapy proposed for Alzheimer’s disease is reducing total tau levels. Lowering endogenous tau in mice either genetically (Ittner et al., 2010; Vossel et al., 2010; Roberson et al., 2011; Li et al., 2014) or with a drug post-development (DeVos et al., 2013) is well tolerated with a minor Parkinson’s phenotype (Lei et al., 2012), though this appears to vary based on the background strain of the mouse (van Hummel et al., 2016). This endogenous mouse tau reduction is also protective against several amyloid-β induced deficits, such as hyperexcitability and cognitive decline (Roberson et al., 2007, 2011; Ittner et al., 2010; Vossel et al., 2010; Leroy et al., 2012). The lowering of human tau has been performed using a genetic model as well as with exogenously applied tools, such as siRNA and antisense oligonucleotides. In all scenarios, neuronal loss was prevented while tau pathology was able to be both prevented and reversed (Santacruz et al., 2005; Xu et al., 2014; DeVos et al., 2017).

However, all reports of human tau reduction have been in pure tauopathy models. While this mimics what may happen in diseases where tau is the lone pathological species, such as FTDP-17, these models do not reflect the micro-environment in the brain of Alzheimer’s disease. To address this gap, we used a newly characterized mouse model (Bennett et al., 2017) generated from a cross between the regulatable rTg4510 tauopathy line, which overexpresses a mutant form of human tau (Santacruz et al., 2005), and the APP/PS1 amyloid-β depositing mice (Jankowsky et al., 2004). This APP × rTg4510 line develops tau pathology and amyloid-β plaques in an age-dependent manner that has an accelerated tau pathology phenotype as compared to tau-alone expressing rTg4510 mice (Bennett et al., 2017). Using this model, which has both pathological hallmarks of Alzheimer’s disease, we sought to evaluate a tau reducing strategy by taking advantage of the regulatable mutant human tau transgene. By genetically lowering human tau in the context of amyloid-β plaques, we assessed (i) whether lowering human tau in an Alzheimer’s disease murine model is capable of reducing tau pathology and protecting against neuronal loss; and (ii) whether a tau reduction therapy is equally efficacious with and without concurrent amyloid-β deposition.

Materials and methods

Animals

All animal experiments were performed in accordance with the Massachusetts General Hospital’s (MGH) and McLaughlin Research Institute’s Institutional Animal Care and Use Committees. The mice were housed under a 12-h light/dark cycle and were given food and water ad libitum. B6.Cg-Tg(APPswe,PSEN1dE9)85Dbo/Mmjax mice (APP/PS1) obtained from Jackson Laboratory were crossed to the B6.Cg-Tg(Camk2a-tTA)1/Mmay tet transactivator (tTA) strain, which expresses tTA from the CamKIIα-tTA transgene in the murine forebrain (Mayford et al., 1996). B6.CK-tTA,APP/PS1 double transgenic males were crossed with dams from the tetracycline-responsive element line FVB-Tg(tetO-MAPT*P301L)4510/Kha/Jlws (rTg4510). The resulting cross produced mice with the experimental genotype (termed APP × rTg4510). Genotyping was performed pre-weaning using previously described protocols (Jankowsky et al., 2001, 2004; Santacruz et al., 2005). For the study herein, the following genotypes were studied: (i) APP × rTg4510 mice that carry the APP/PS1 array, the CamkIIα-tTA transactivator, and the rTg4510 tau responder transgene; (ii) rTg4510 mice that have both the CamkIIα-tTA and the rTg4510 tau transgenes; (iii) APP/PS1 only mice; and (iv) non-transgenic CamkIIα-tTA only mice.

At 6 months, half of the mice were placed on a doxycycline (DOX) diet, whereby mice received chow containing 200 mg/kg DOX (Fisher Scientific) ad libitum for 6 months to suppress the CamkIIα-tTA-driven human tau transgene expression, until the point of collection (Santacruz et al., 2005). The remaining mice received standard chow.

Immediately prior to euthanasia, mice were anaesthetized with 3–5% isoflurane for CSF collection. CSF was drawn through the cisterna magna and immediately frozen on dry ice (Barten et al., 2011). Five mice did not give adequate CSF volumes for enzyme-linked immunosorbent assay (ELISA) analysis (n = 2 naïve non-transgenic, n = 1 naïve rTg4510, n = 1 DOX rTg4510, n = 1 DOX APP × rTg4510). For tissue collection, mice were anaesthetized with isoflurane and perfused using chilled phosphate-buffered saline (PBS). The brain was removed and weighed. The left hemisphere was post-fixed in 4% paraformaldehyde (Electron Microscopy Sciences) and transferred to 30% sucrose 24 h later. The right hemisphere was microdissected into cortex and hippocampus and snap frozen on dry ice. All frozen tissue was stored at −80°C.

Human tissue selection

Human tissue samples from parahippocampal gyrus or frontal cortex were obtained from the Neuropathology Core of the Massachusetts Alzheimer’s Disease Research Center at MassGeneral Institute for Neurodegenerative Disease (Table 1). Brains were coronally sliced at the time of autopsy, flash frozen between metal plates on dry ice, and stored at −80°C. A 1-cm square of grey matter was dissected out and immediately homogenized. Cases had been formerly assessed by an MGH neuropathologist to generate a neuropathological diagnosis in addition to a neuritic plaque scoring system, developed by the Consortium to Establish a Registry for Alzheimer’s disease (CERAD; Morris et al., 1989). All cases also received a tau Braak rating based on the location of neurofibrillary tau tangles as seen with a total tau immunostain.

Table 1.

Human case demographics

Case Age Sex PMI Neuropathology diagnosis Braak/Braak CERAD ADNC Neuritic plaques Study
A B C
1471 >90 F 12 FTLD-U IV A possible n/a 2 1 None PK
1510 73 M 22 Mild AD III A possible n/a 2 1 None PK
1605 >90 M 24 CAA III A possible n/a 2 1 None PK
1783 65 M 21 ALS III 0 0 2 0 None PK
2109 71 F 4 FTLD-Tau IV 0 1 2 0 Sparse PK
1042 85 M 10 AD III B probable n/a 2 2 Frequent PK
1055 >90 F 16 AD IV C definite n/a 2 3 Frequent PK
1316 73 M 18 AD/PD III C definite n/a 2 3 Frequent PK
1403 63 F 16 AD IV C definite n/a 2 3 Frequent PK
1515 84 M 6 CAA III B probable n/a 2 2 Frequent PK
1712 87 F 12 AD IV B probable 2 2 2 Frequent PK
1722 >90 F 8 Control I A possible 1 1 1 Sparse SEC
1965 76 F 48 Control I A possible 1 1 1 Sparse SEC
1746 60 M 24 AD VI C definite 3 3 3 Moderate SEC
1966 84 F 15 AD VI C definite 3 3 3 Frequent SEC

ALS = amyotrophic lateral sclerosis; AD = Alzheimer’s disease; ADNC = Alzheimer’s disease Neuropathologic Change; CAA = cerebral amyloid-angiopathy; CERAD = Consortium to Establish a Registry for Alzheimer’s disease; FTLD-Tau = frontotemporal lobar dementia with tau-positive inclusions; FTLD-U = frontotemporal lobal dementia with ubiquitin-positive inclusions; n/a = not available; PD = Parkinson’s disease; PK = proteinase K; PMI = post-mortem interval; SEC = size exclusion chromatography.

Quantitative real-time PCR

All mRNA analyses were done using quantitative real-time RT-PCR (qRT-PCR). Total RNA was extracted from the frontal cortex using the QIAGEN RNeasy® Kit. Messenger RNA was reverse transcribed and amplified using the EXPRESS One-Step SuperScript® qRT-PCR Universal Kit (Invitrogen) with TaqMan™ probe technology. All qRT-PCRs were run and analysed on the CFX96 Touch Real-Time PCR Detection System (Bio-Rad). Total human and mouse tau expression levels were normalized to mouse glyceraldehyde 3-phosphate dehydrogenase (Gapdh) mRNA levels. Relative expression levels were generated using the ΔΔCt method. Primer/probe sequences: Human total tau (MAPT): Forward 5'-AGAAGCAGGCATTGGAGAC-3'; Reverse 5'-TCTTCGTTTTACCATCAGCC-3'; Probe 5'-/56-FAM/ACGGGACTGGAAGCGATGACAAAA/MGBNFQ/-3′, Mouse total tau (Mapt): Forward 5′-GAACCACCAAAATCCGGAGA-3′; Reverse 5′-CTCTTACTAGCTGATGGTGAC-3’; Probe 5'-/56-FAM/CCAAGAAGG TGG CAG TGG TCC/MGBNFQ/-3′, GAPDH: Forward 5′–TGCCCCCATGTTGTGATG-3′; Reverse 3′-TGTGGTCATGAGCCCTTCC-3′; Probe 5′/56-FAM/AATGCATCCTGCACCACCAACTGCTT/MGBNFQ/3′ (Thermo Fisher Scientific).

Preparation of brain homogenate

Thawed mouse or human cortex was placed in 500 µl of PBS + protease inhibitor (Roche) in a 2 ml glass dounce homogenizer and dounce homogenized with 30 up/down strokes on ice by hand. The lysate was centrifuged at 3000g for 10 min at 4°C and supernatant collected and aliquoted so that no sample was frozen/thawed more than three times. A bicinchoninic acid assay (Thermo Scientific Pierce) was performed to determine protein concentration.

SDS-PAGE and western blot

For total tau analysis, 5–10 µg of total protein per well was loaded on 4–12% Bis-Tris SDS-PAGE gels (Invitrogen) and run in MES buffer (Invitrogen). Proteins were transferred to Immobilon PVDF membrane (EMD Millipore) and incubated overnight at 4°C with anti-mouse HT7 total tau antibody (amino acid 159-163) (1:1000, Thermo Fisher Scientific) and anti-rabbit GAPDH antibody (1:2000, Abcam) in 1:1 Odyssey blocking buffer:distilled water. Blots were washed three times for 10 min in Tris-buffered saline + 0.25% Tween (TBS-T), incubated with infrared secondary anti-mouse 800 and anti-rabbit 680 (1:2000, Licor) antibodies in blocking buffer, washed three times for 10 min TBS-T, and imaged on an Odyssey Infrared Imaging System (Licor). Three carry-over samples were used for normalization across blots. Blots were converted to greyscale and densitometry analysis was performed in ImageJ (NIH v1.51 n).

ELISAs

ELISAs were performed using 3000g PBS soluble cortex homogenates or CSF. The Invitrogen total tau and pS396 tau ELISAs (Invitrogen) were run following the manufacturer’s instructions. Plates were developed using the Wallac plate reader (Perkin Elmer) at 450 nm. For the Meso Scale Diagnostics total tau and pT231 tau multiplex ELISA (Meso Scale Diagnostics), the manufacturer’s protocol was followed. Plates were developed using the MESO QuickPlex SQ 120 Plate Reader (Meso Scale Diagnostics). To analyse amyloid-β peptide 1-42 (amyloid-β1-42) in cortical homogenates, the human/rat amyloid-β42 ELISA kit (Wako) was used that measures amyloid-β(x-42) peptides. Plates were developed using the Wallac plate reader (Perkin Elmer). For all ELISAs, samples were fit to an eight-point standard curve. All ELISA values were adjusted for protein concentration values to determine the amount of analyte per weight of tissue (volume for CSF).

Semi-denaturing detergent agarose gel electrophoresis

Semi-denaturing detergent agarose gel electrophoresis (SDD-AGE) blots were carried out as previously described with minor modifications (Halfmann and Lindquist, 2008; Sanders et al., 2014). Agarose (1.5%) was dissolved in buffer G (20 mM Tris-Base, 200 mM glycine) and 0.02% SDS added. Lysate (15 µg) was incubated with 0.02% SDS sample buffer for 7 min at room temperature prior to loading. The SDD-AGE was run using Laemmli buffer (Buffer G + 0.1% SDS) at 30 V for 16 h at 4°C. The transfer was performed using capillary action using 20 pieces of thick Whatman® paper (GB 005) and eight pieces of medium high absorbent Whatman® paper (GB 003) to Immobilon PVDF (Millipore) membrane at 4°C for 24 h using TBS. Following transfer, the membrane was blocked in 5% non-fat dry milk TBS-T for 1 h and probed for total tau (anti-rabbit polyclonal; 1:4000; Abcam) overnight at 4°C in 5% non-fat dry milk TBS-T. The membrane was washed three times with TBS-T, probed with a HRP-conjugated goat anti-rabbit IgG secondary antibody (1:4000; Thermo Fisher) for 1.5 h at room temperature in 5% non-fat dry milk TBS-T, washed three times in TBS-T, and detected using chemiluminescent HRP substrate (Thermo Fisher) and film (GE Healthcare). To quantify, the low and high molecular weight portions of the blot were quantified separately using ImageJ. Previous reports of high and low molecular weight tau run on SDD-AGE show an accumulation of low molecular weight tau at the bottom of the gel with smears of high molecular weight tau oligomers at the top (Yanamandra et al., 2013; Sanders et al., 2014; Takeda et al., 2016; DeVos et al., 2017). For full lane analysis, 13 equal size bins were generated to span all samples and densitometry analysis for each bin of each sample was performed using the ImageJ gel quantification tool. For per cent tau quantification, the densitometry value for each bin was divided by the sum of all 13 densitometry values for each sample.

Proteinase K digestion

Proteinase K digestion was carried out as previously described with minor modifications (Falcon et al., 2015). Lysate was diluted in proteinase K buffer (50 mM Tris-HCL pH 8.0, 1 mM CaCl2, 3 mM DTT, and 2 M urea) and proteinase K (Thermo Fisher Scientific) added to the appropriate concentration (0–100 µg/ml). Samples were incubated in proteinase K/proteinase K buffer for 30 min at room temperature. The digestion was halted with 5 mM phenylmethylsulfonyl fluoride (Sigma-Aldrich). NuPAGE® LDS Sample Buffer (4× concentration) (Invitrogen) and 10× NuPAGE® Sample Reducing Agent (Invitrogen) was added to 5 µg of digested lysate and boiled for 10 min at 95°C and run on 4–12% Bis-Tris SDS-PAGE gels (Invitrogen) in MES buffer (Invitrogen) and transferred to PVDF membrane. Blots were incubated with total tau antibody (anti-rabbit polyclonal, 1:2000, Abcam) overnight at 4°C. Blots were washed three times for 10 min with TBS-T and incubated with secondary anti-rabbit 680 (1:1000) for 1.5 h at room temperature and imaged on the Licor imaging system (Odyssey). For quantification, images were converted to greyscale in ImageJ. Using the gel quantification densitometry tool, the full lane of tau was quantified as well as tau fragments <14 kDa for mouse and >28 kDa for human lysate, both of which had been identified a priori based on the proteinase K dose escalation blots. The <14 kDa and >28 kDa band intensity was divided by the total tau intensity.

Size-exclusion chromatography

PBS-soluble brain lysates from the frontal cortex of two control and two Alzheimer’s disease cases (Table 1) were separated by size-exclusion chromatography (SEC) on single Superdex200 10/300GL columns (GE Healthcare) in PBS at a flow rate of 0.5 ml/min, with an AKTA purifier 10 (GE Healthcare). Each brain lysate was diluted to the same concentration and filtered through a 0.2 µm membrane filter before loading onto the SEC column. Each fraction encompassed 500 µl and based on our previous work (Takeda et al., 2015) and molecular weight markers run through the SEC, Fraction 2 contains high molecular weight tau and Fraction 14 contains low molecular weight tau.

Immunohistochemistry

Half mouse brains were cut coronally into 40 µm sections with a freezing sliding microtome. All sections were stored in glycerol cryoprotectant solution (30% glycerol in PBS) at −20°C. All immunohistochemistry staining—for tau and amyloid-β—for all mice was done at the same time and imaged together to reduce staining batch variability. Six coronal sections 400 -µm apart were washed three times for 15 min with TBS and incubated with 0.3% hydrogen peroxide for 10 min at room temperature. Sections were blocked in 3% non-fat dry milk in TBS and 0.25% Triton™ X-100 (TBS-X), followed by incubation at 4°C overnight in 1% non-fat dry milk TBS-X with either biotinylated anti-mouse AT8 antibody (1:500; Thermo Fisher Scientific), which recognizes phosphorylated tau at Serine 202 and Threonine 205 (Goedert et al., 1995) or anti-rabbit total human amyloid-β (1:1000; #18584 Immuno-Biological Laboratories) that identifies human amyloid-β 40, 42, and 43 fragments. The next day, sections were washed three times for 15 min with TBS. For the amyloid-β stain, sections were then incubated with goat anti-rabbit biotinylated secondary antibody (1:1000; Thermo Fisher Scientific) in TBS-X for 1 h at room temperature. Amyloid-β incubated sections were washed three times for 15 min with TBS. ABC Elite solution (1:400) was made (Vector) and incubated for 30 min at room temperature. All sections were incubated in the ABC Elite solution for 2 h at room temperature and washed three times for 15 min with TBS. Sections were transferred to a 12-well plate with nets to ensure all sections were exposed to 3,3′diaminobenzidine (DAB) equally. This DAB solution with the Nickel addition was made (Vector) and sections developed. Sections were transferred to distilled water for 5 min and then washed three times for 15 min with TBS before mounting, dehydrating in ascending ethanol/xylene, and coverslipping with Cytoseal™ XYL (Thermo Fisher). All sections were imaged using brightfield at ×20 on the Olympus NanoZoomer 2.0-HT slide scanner (Hamamatsu).

For the human brain sections, the contralateral hemisphere of all cases was post-fixed in formalin and the parahippocampal gyrus was paraffin-embedded and cut into 7–8 -µm thick sections and mounted on slides. Sections were deparaffinized with xylene followed by descending ethanol series and incubated in 3% hydrogen peroxide prior to incubation with 90% formic acid for 5 min. Sections were then rinsed with TBS and incubated with a mouse anti-amyloid-β antibody (1:200, Clone 6F/3D, Dako) for 1 h at room temperature. Staining was then visualized with the Vectastain rabbit IgG horse-radish peroxidase kit (VectorLabs) and Vector peroxidase substrate kit DAB (VectorLabs). Slides were finally dehydrated and coverslipped with Cytoseal™ XL. Slides were imaged using brightfield at ×10 on the Olympus BX51.

Immunofluorescence

Sections were washed three times for 15 min in TBS and blocked in 3% normal goat serum (Vector Laboratories) in TBS-X for 1 h at room temperature. Sections were then incubated with primary antibodies mouse anti-GFAP (1:1000; Abcam), rabbit anti-NeuN (1:1000; Cell Signaling), and/or rabbit anti-Iba-1 (1:1000; Wako) in blocking solution overnight at 4°C. The next day, sections were washed in TBS and incubated with the appropriate secondary antibodies conjugated to Alexa 488, Cy3, or Cy5 (1:400) for 1.5 h at room temperature. In a set of sections following secondary incubation, slices were then incubated in freshly made 0.005% thioflavin-S (50% ethanol/50% TBS) for 5 min, then rinsed three times for 30 s in 80% ethanol, 20% TBS, and eventually three times for 10 min in TBS. All sections were mounted on slides, coverslipped using DAPI containing Fluoromount-G® (SouthernBiotech) or, in thioflavin-S-stained sections, Fluoromount-G®, and sealed with clear nail polish.

Tau and amyloid-β pathology quantification

To quantify thioflavin-S positive pathology, we performed stereological quantifications using the Computer Assisted Stereological Toolbox version 2.3.1.5 (Olympus). Thioflavin-S positive neurofibrillary tangles and amyloid-β plaques were simultaneously counted in three serial brain sections containing hippocampus 400 µm apart. Neurofibrillary tangles and amyloid-β plaques are morphologically very distinct and easily discernible from each other. Ten per cent of cortex was counted using a random meander sampling algorithm allowing for per mm2 count. For AT8 and amyloid-β immunohistochemistry pathology, three to four brain sections containing hippocampus, starting between bregma −1.5 mm and −2.0 mm and 400 µm apart, were used from each mouse. Using the NDP viewer software (Hamamatsu), each section was exported and saved as .tiff image file. For AT8 pathology analysis, image files converted to 8-bit greyscale and re-saved in ImageJ. Using the freehand selection tool on the greyscale images, the outline of the cortex and hippocampus was drawn. A uniform threshold value was then applied followed by the ‘analyse particles’ task to determine the per cent covered by positive signal. The average per cent coverage of all three to four sections was used as the final per cent AT8 value for that mouse. For amyloid-β pathology, all three brain sections were captured in the same field of view using the NDP viewer software and exported at ×10 as a single .tiff image per mouse. Images were processed through ImageJ with the biovoxxel plugin using the following batch process script in beanshell:

  • run(“8-bit”);

  • run(“Subtract Background…”, “rolling=40 light sliding”);

  • run(“Invert”);

  • run(“OtsuThresholding 8Bit”);

  • //setThreshold(33, 255);

  • setOption(“BlackBackground”, false);

  • run(“Make Binary”, “thresholded remaining black”);

  • run(“Extended Particle Analzyer”, “extent=0.00-.99 circularity=0.17-1.00 compactness=0-1.00 aspect=0-10000max_feret=0-2000 show=Nothing redirect=None keeP = None display summarize add exclude include”);

  • run(“Measure”);

  • dir = getDirectory(“image”);

  • name = getTitle;

  • index = lastIndexOf(name, “.”);

  • if (index!=-1) name = substring(name, 0, index);

  • name = name + “.xls”;

  • saveAs(“Measurements”, dir+name);

  • print(dir+name)

To account for total section area, the same three sections used for plaque quantification were outlined in the NDP viewer software to generate a single section area (mm2) value. The number of plaques determined by the ImageJ Fiji analysis was divided by the section area to obtain a final plaques/area (mm2) value for each mouse.

GFAP and Iba1 quantification

For GFAP quantification, the cortex of three brain sections spaced 800 µm apart starting at bregma −1.5 mm were imaged for GFAP on the Olympus BX51 for all mice at the same exposure. The images were uploaded into ImageJ, the cortex outlined, and images converted to 8-bit greyscale. The same threshold value was applied to all images and then the ‘analyse particles’ function was applied to measure the per cent area covered by positive GFAP signal. The average of the three sections was determined for one value per mouse. For Iba1 quantification, three brain sections spaced 800 µm apart, starting at bregma −2.0 mm, were imaged at ×20 for fluorescence on the Olympus Nanozoomer 2.0-HT (Hamamatsu). Using the NDP viewer software, each brain section was exported at ×10. Images were uploaded into ImageJ and background subtracted using a rolling ball radius of 40 pixels. Images were then converted to 8-bit greyscale. Using the freehand selection tool, the outline of the cortex was drawn. A uniform threshold value was then applied followed by the ‘analyse particles’ task to determine the per cent covered by positive Iba1 signal. The average per cent coverage of all three sections was used as the final Iba1 per cent coverage for that mouse.

Hippocampal and cortical volume analysis

Beginning at the anterior tip of the hippocampus (bregma −1.0 mm), six sections were taken 400 -µm apart, mounted and imaged at ×20 for brightfield on the Olympus Nanozoomer 2.0-HT (Hamamatsu). Using the NDP viewer software, the hippocampus and cortex in each section was outlined to obtain the total hippocampal and cortical area for each section. Each of the hippocampal and cortical areas was then multiplied by 400 µm to obtain final hippocampal and cortical volumes in mm3 for each mouse.

NeuN count in CA1

Two full hippocampi images per mouse spaced 800 -µm apart were imaged for NeuN and DAPI on the Olympus BX51. Corresponding NeuN and DAPI images were merged and a rectangle spanning 200 µm was drawn over CA1 in ImageJ. The same size rectangle was used for each section. The numbers of NeuN/DAPI positive nuclei were counted within the defined CA1 region. The number of NeuN positive DAPI nuclei for the two sections was averaged to generate a single value per mouse.

Tau seeding assay

In vitro tau seeding activity was measured as previously described (Holmes et al., 2014). For the longitudinal assessment, HEK293 cells stably expressing the repeat domain of tau with the P301S mutation (TauRDP301S) fused with cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP) were plated in poly-d-lysine coated 96-well plates (Corning) at 40 000 cells/well. The next day, cells were transduced with 0.1 µg/well brain lysate plus 1% Lipofectamine® 2000 (Invitrogen) diluted in Opti-MEM™. Every 3–6 h for 24 h, one well per sample was collected. At collection, cells were trypsinized and transferred to a 96-well U-bottom plate (Corning) with chilled Dulbecco’s modified Eagle medium 10% foetal bovine serum media. Cells were pelleted at 1000g, resuspended in 2% paraformaldehyde (Electron Microscopy Services) for 10 min and pelleted again. Cells were resuspended in chilled PBS and immediately run on the MACSQuant® VYB (Miltenyi) flow cytometer. CFP and Forster resonance energy transfer (FRET) were measured by exciting the cells with the 405-nm laser and reading fluorescence at the 405/50 and 525/50 nm filters, respectively. To quantify the FRET signal, a bivariate plot of FRET versus the CFP donor was created. Using cells that received Lipofectamine® alone as a marker of the FRET-negative population, the integrated FRET density was calculated (percentage of FRET-positive cells multiplied by median fluorescence intensity of FRET-positive population). Forty thousand cells per well were analysed. Data analyses were performed using the MACSQuantify software (Miltenyi). Representative images of tau aggregates along the time course were captured using the ZOE Fluorescent Cell Imager (Bio-Rad) using the GFP excitation/emission filters.

For the per cell analysis, the cells were treated with 0.1 µg lysate/well with 1% Lipofectamine®. Cells were incubated with lysate/Lipofectamine complexes in Opti-MEM™ for 24 h and collected as above. Cells were resuspended in flow cytometry buffer containing HEPES-buffered RPMI medium (without phenol red). Image flow cytometry was performed using the ImageStream®X Mark II imaging flow cytometer (Amnis Corporation) equipped with a 40× objective. CFP:YFP FRET was measured from images obtained by 405 nm laser excitation on the ImageStream® using the FRET (YFP:CFP) Intensity Ratio feature. To quantify FRET, CFP bleed-through into the YFP and FRET channel was compensated using IDEAS software (version 6.2). For each experiment, 5 × 105 events per sample were collected and analysed. To quantify the number of FRET-positive tau inclusions/spots in each FRET-positive cell, single cells that contained high and low tau spot counts were identified and gated first. Then, to determine the number of FRET-positive tau inclusions/spots in each cell, masks were created based on the previous high and low tau spot count gates to identify the spot region of interest. The number of individual masks in a cell was enumerated using the Spot Count feature in the IDEAS software per sample.

Experimental design

For selection of mice in the study, treatment groups were gender-, age-, and litter-matched. For sample size calculations, a main readout of treatment efficacy was identified a priori as tau pathology and seeding. Thus, we derived the mean and standard deviations from the APP × rTg4510 12-month cortical AT8 pathology and tau seeding values from Bennett et al. (2017). We planned a study of continuous response variable from independent control (APP × rTg4510 naïve) and experimental (APP × rTg4510 DOX) subjects with one control per experimental subject. Using the mean and standard deviations (SDs) from Bennett et al. (2017) and an effect size of 0.5 based on previous literature of the effect of tau suppression in rTg4510 (Polydoro et al., 2013; Holmes et al., 2017) and PS19 (DeVos et al., 2017) mice on tau pathology and seeding, we performed a power analysis that determined we would need to study at least six experimental subjects and six control subjects to be able to reject the null hypothesis that the tau pathology and seeding means of the APP × rTg4510 DOX and APP × rTg4510 naïve groups are equal with power 0.8. The error probability associated with this test of the null hypothesis is 0.05 (alpha). To ensure objective quantification, the following experiments were blinded by a third-party concealment of image file names and microscope slides: AT8 tau pathology quantification (hippocampus and cortex), thioflavin-S pathology stereology counts (neurofibrillary tangles and amyloid-β plaques), amyloid-β plaque pathology quantification (plaque number and plaque size), GFAP per cent coverage, Iba1 per cent coverage, hippocampal and cortical volume, and NeuN counts in the hippocampus.

Statistical analysis

The data were analysed for statistical significance using the graphing program GraphPad Prism 6. The number of mice used throughout the manuscript are depicted in Fig. 1A. The D’Agostino and Pearson omnibus normality test was applied to all datasets to test for normal distribution where possible. For the proteinase K digest and amyloid-β1-42 ELISA quantification, a two-tailed Student’s t-test was used. A two-way repeated measures ANOVA with Sidak post hoc analysis was used to analyse the SDD-AGE per cent tau per fraction, the longitudinal tau seeding analysis, and the amyloid-β plaque size distribution. Pearson’s correlation was used for the CSF versus brain tau direct comparison, fitted with the line of best fit and 95% confidence interval (CI) bands. For all other experiments, two-way ANOVA with Sidak post hoc analyses were used. Graphical data are represented as individual points for each mouse with mean ± standard error of the mean (SEM) overlapping or, in the case of the SDD-AGE total and per cent tau graphs, longitudinal seeding data and amyloid-β plaque size distribution, a single point representing the mean with error bars representing ± SEM.

Figure 1.

Figure 1

Human tau expression is reduced following DOX treatment. (A) Schematic of experimental setup. DOX chow was fed to half of the mice in all four genotypes—non-transgenic (NT), APP/PS1 (APP), rTg4510, and APP/PS1 × rTg4510—for 6 months starting at 6 months of age. All mice started treatment at the same time and were collected at the same time. (B) Total human tau (MAPT) mRNA expression levels are significantly reduced in both the rTg4510 and APP × rTg4510 lines in the presence of DOX. Treatment effect F(1,46) = 176.9, P < 0.0001. (C) Total mouse tau (Mapt) mRNA expression levels remain unaltered across all genotypes and treatments. Treatment effect F(1,46) = 0.2577, P = 0.6141. Two-way ANOVA, Sidak post hoc analysis. ****P < 0.0001. Each data point represents one mouse. Mean ± SEM.

Results

Doxycycline treatment effectively reduces human MAPT mRNA expression levels

To test whether lowering human tau in the presence of amyloid-β plaques is protective, we crossed the amyloid-β depositing APP/PS1 mice (Jankowsky et al., 2003) with the regulatable rTg4510 tauopathy mice (Santacruz et al., 2005), termed APP × rTg4510. In the present study, human tau was lowered for 6 months, starting at 6 months of age, in half of the study mice by feeding the mice DOX containing chow (Fig. 1A). Half of the non-transgenic and APP/PS1 (APP) mice were treated with DOX to control for any off-target effects due to 6-month exposure to DOX. At sacrifice, the frontal cortex was collected and total RNA extracted to determine if the DOX treatment successfully reduced human tau transgene expression. Human MAPT (tau) mRNA levels, not mouse Mapt (tau) mRNA levels, were significantly lowered in both rTg4510 and APP × rTg4510 DOX mice compared to their naïve genotype controls (Fig. 1B and C), though it is worth noting that the human MAPT/tau transgene was not 100% repressed with the DOX treatment.

Lowering of human tau expression reduces total human tau protein in the brain and CSF

The cortex was homogenized in PBS and the supernatant was run on western blot and probed for total human tau and GAPDH (Fig. 2A). ImageJ densitometry analyses shows a significant decrease in total human tau in both rTg4510 and APP × rTg4510 DOX mice when compared to naïve genotype controls with no difference in total human tau protein between the two DOX-exposed genotypes (Fig. 2B). Similarly, when total, pS396, and pT231 human tau protein levels were measured using ELISA (from both Invitrogen and Meso Scale Diagnostics) a significant decrease in tau expression can be seen in DOX-treated rTg4510 and APP × rTg4510 mice when compared to their naïve genotype controls (Supplementary Fig. 1A–D). Immediately prior to euthanasia, CSF was collected and human tau levels measured on ELISA (Invitrogen). Notably, CSF tau levels measured in the rTg4510 and APP × rTg4510 naïve mice are equal to previously analysed 4-month naïve rTg4510 and APP × rTg4510 mice (Bennett et al., 2017), suggesting CSF tau release is in part an active process and not just a result of widespread neuronal loss. Similar to brain, total human tau levels in the CSF were significantly lowered in both rTg4510 and APP × rTg4510 DOX mice compared to their respective 12-month naïve treatment cohorts (Fig. 2C). This results in a significant direct correlation between total human brain tau and CSF tau (Supplementary Fig. 2). This effect has been seen previously with lowering endogenous mouse tau (DeVos et al., 2013) and endogenous non-human primate tau (DeVos et al., 2017), suggesting CSF tau measurement is a potential biomarker for a tau-lowering therapy.

Figure 2.

Figure 2

Total and oligomeric tau protein levels are reduced with DOX treatment. (A) Representative western blot (WB) probed for total human tau. (B) Quantification of total tau western blots shows a significant decrease in total human tau in DOX treated rTg4510 and APP × rTg4510 mice. Treatment effect F(1,29) = 127.4, P < 0.0001. (C) Total human tau levels as detected by ELISA were significantly reduced in DOX-treated rTg4510 and APP × rTg4510 CSF compared to naïve genotype controls. Treatment effect F(1,26) = 49.20, P < 0.0001. Two-way ANOVA, Sidak post hoc analysis. (D) SDD-AGE blot probed for total tau shows a reduction in high molecular weight (HMW) and low molecular weight (LMW) tau. Black dashed line separates treatment. Red dashed line separates genotype. Quantification is presented in Supplementary Fig. 3. (E) Total tau densitometry values (a.u. = arbitrary units) down the length of the SDD-AGE blot. (F) The per cent tau in the bins down the length of the blot was calculated for each sample and plotted as a group. APP × rTg4510 DOX samples have a higher percentage of high molecular weight tau and lower percentage of low molecular weight tau than the rTg4510 DOX samples. Treatment effect F(12,84) = 11.85, P < 0.0001. Two-way ANOVA, Sidak post hoc analysis. (G) Naïve rTg4510 and APP × rTg4510 lysate incubated with increasing concentrations of proteinase K (PK) was run on western blot. More <14 kDa fragmented tau in the rTg4510 digested sample compared to the APP × rTg4510 sample (arrowheads) was identified at 1 µg/ml proteinase K. (H and I) Lysates were incubated with 1 µg/ml proteinase K and run on western blot for total tau. Representative blot shows the proteinase K digestions patterns (H). The relative intensity of the <14 kDa tau fragments normalized to total tau in the full lane showed a significant decrease in the amount of small proteinase K fragmented tau in the APP × rTg4510 DOX lysate as compared to the rTg4510 DOX lysate (I). Two-tailed student t-test. (J–L) Proteinase K dose escalation was run on lysate from neurofibrillary tangle containing Braak III human brain with no amyloid-β plaques (amyloid-β−) and with frequent amyloid-β plaques (amyloid-β+). An increase at 2.5 µg/ml proteinase K in >28 kDa tau in the amyloid-β+ digested sample as compared to the amyloid-β− sample (arrowheads and red box) was identified (J). All amyloid-β− and amyloid-β+ samples were incubated with 2.5 µg/ml proteinase K and then run on western blot for total tau. Representative blot shows the proteinase K digestions patterns (K). The ratio of the >28 Da tau bands to total tau in the full lane (L). Two-tailed student t-test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Each data point represents one mouse or human sample. Mean ± SEM.

Tau aggregation in the presence of amyloid-β adopts a unique conformation

Previous reports have suggested that amyloid-β is capable of altering tau biology in mice, rats, non-human primates and humans (Sigurdsson et al., 1997; Price and Morris, 1999; Gotz et al., 2001; Lewis et al., 2001; Delacourte et al., 2002; Ribé et al., 2005; Bolmont et al., 2007; Hurtado et al., 2010; Seino et al., 2010; Mairet-Coello et al., 2013; Forny-Germano et al., 2014; Héraud et al., 2014; Barthélemy et al., 2016; Manassero et al., 2016; Bennett et al., 2017; He et al., 2018). To analyse tau aggregates biochemically, brain lysate was first run on an SDD-AGE gel to assess the level of high and low molecular weight tau protein (Fig. 2D). We have previously demonstrated a mild increase in high molecular weight tau as early as 4 months of age in APP × rTg4510 mice (Bennett et al., 2017), though the amount of high molecular weight tau is substantially lower at this age than at the 12 month time point used in the present study. Despite the increase in the amount of high molecular weight tau in the older mice, the SDD-AGE shows a significant decrease in both high and low molecular weight tau protein in the DOX treatment groups (Supplementary Fig. 3). The absolute amount of tau for each sample was then quantified in a series of bins down the length of the blot and plotted (Fig. 2E), highlighting not only the decrease in total tau in the DOX cohorts, but also the different patterns in total tau. On the blot, there was a noticeable high molecular weight band in the APP × rTg4510 DOX samples, which was reduced or absent in the rTg4510 DOX group. To further analyse this, the total amount of tau per sample was set to 100% and the per cent per bin along the gel was plotted for both the DOX cohorts (Fig. 2F) and the naïve cohorts (Supplementary Fig. 4A). This revealed a relative increase in the high molecular weight segments with an accompanying decrease in low molecular weight tau in the APP × rTg4510 mice when compared to rTg4510 mice in both the naïve and DOX conditions, though the effect was more prominent in the DOX cohort. These data suggest that amyloid-β enhances soluble tau aggregation, either through direct (tau aggregates could be in complex with amyloid-β plaques) or indirect interaction. We speculate that this is a long-lived species, given that the human tau transgene had been suppressed for 6 months.

Additionally, the two total human tau ELISAs that were used recognize different regions of tau, with the Invitrogen ELISA measuring a very N-terminal portion of tau (Barten et al., 2011) that has been reported to not recognize aggregated tau as efficiently (Acker et al., 2013) and the Meso Scale Diagnostics human tau ELISA detecting tau between amino acids 150 and 200 (unpublished observations). In the naïve treated mice, while there is a noticeable decrease in Invitrogen total tau in the APP × rTg4510 naïve mice compared to rTg4510 naïve mice, that difference does not exist in the Meso Scale Diagnostics total tau ELISA, perhaps reflecting a difference in conformation and exposed tau epitopes in the two genotypes (Supplementary Fig. 1A–D). To explore whether the Invitrogen and Meso Scale Diagnostics total human tau ELISAs recognize the same fractions of tau equally, we isolated high and low molecular weight tau fractions using size-exclusion chromatography from human control and Alzheimer’s disease frontal cortex lysates (Takeda et al., 2015) (Table 1) and measured each fraction on both the Invitrogen and Meso Scale Diagnostics total human tau ELISAs (Supplementary Fig. 1E–H). While both ELISAs were able to similarly detect human tau in the low molecular weight fraction, the Meso Scale Diagnostics ELISA was capable of recognizing high molecular weight tau with much higher sensitivity, suggesting that the N-terminus tau epitope targeted by the Invitrogen ELISA is either masked by the conformation of the tau molecule or removed following a tau cleavage event. If the Invitrogen ELISA recognizes low molecular weight over high molecular weight tau while the Meso Scale Diagnostics ELISA is capable of recognizing both low and high molecular weight tau, as shown by the size-exclusion chromatography data, it would suggest that the APP × rTg4510 mice have a higher high:low molecular weight tau ratio than rTg4510 mice. This corroborates the SDD-AGE data (Fig. 2F and Supplementary Fig. 4A).

To analyse the possibility of a unique confirmation of tau in the presence of amyloid-β further, we used a protease digestion that others have reported to differentiate tau conformations (Falcon et al., 2015). As a pilot, a rTg4510 and APP × rTg4510 sample were both digested with varying concentrations of proteinase K and the resulting tau banding patterns observed on western blot. Interestingly, there were more fragmented bands in the rTg4510 sample at 1 µg/ml of proteinase K than in the APP × rTg4510 sample (Fig. 2G). Using this a priori identified difference in tau fragmentation, all human tau containing samples were then incubated with 1 µg/ml proteinase K and probed for tau on western blot (Fig. 2H, I and Supplementary Fig. 4). The ratio of fragmented tau to total tau was calculated and plotted for each sample. In the DOX cohort (Fig. 2I) and the naïve cohort (Supplementary Fig. 4), there were significantly more tau fragments generated by proteinase K-digestion at 1 µg/ml in the rTg4510 mice than in amyloid-β expressing APP × rTg4510 mice, suggesting that the conformation of tau in aggregates in the presence of amyloid-β may be more resistant to protease degradation.

Human brain derived tau aggregates are more protease resistant in the presence of amyloid-β

We have previously compared human neuropathological samples that either had plaques and tangles, or tangles only, to explore the analogies between the experimental mouse models and human phenotypes (Bennett et al., 2017). To test the idea of amyloid-β associated tau protease resistance in the human brain, brain lysate was generated from the parahippocampal gyrus from human cases with Braak III/IV tau staging that did (amyloid-β+) or did not (amyloid-β−) have co-occurring amyloid-β neuritic plaques (Table 1 and Supplementary Fig. 5). An amyloid-β− and amyloid-β+ case were both digested with varying concentrations of proteinase K and run on western blot (Fig. 2J). While there were not the same <14 kDa tau digest banding patterns in the human lysate, there was a visible increase in the persistence of >28 kDa tau bands in the amyloid-β+ case at 2.5 µg/ml proteinase K. All human lysates were then incubated with 2.5 µg/ml proteinase K and probed for tau on a western blot (Fig. 2K and L). The ratio of >28 kDa tau to total tau was calculated and plotted for each sample, revealing that amyloid-β+ cases had a significantly higher ratio of >28 kDa protease resistant tau when compared to amyloid-β− cases. These data from human neuropathological material, combined with the data from mouse models, suggest that tau aggregates in the presence of amyloid-β adopt a more proteinase K resistant conformation, though reducing total human tau in the APP × rTg4510 mice is still capable of significantly lowering these proteinase K resistant tau aggregates.

Human tau repression decreases tau pathology throughout the hippocampus and cortex

A major pathological hallmark in rTg4510 mice is the presence of AT8 positive tau accumulations. At 12 months of age, we have previously shown that both rTg4510 and APP × rTg4510 mice have extensive AT8 tau pathology throughout the cortex and hippocampus (Bennett et al., 2017). When total human tau is lowered, there is less AT8 positivity in both the rTg4510 and APP × rTg4510 DOX cohorts when compared directly to their naïve genotype controls (Fig. 3A–C). Despite a reduction in tau pathology in the APP × rTg4510 DOX mice as compared to APP × rTg4510 naïve mice, more AT8 tau pathology remains in the APP × rTg4510 DOX mice when compared to the human APP negative rTg4510 DOX mice, perhaps because of a more stable conformation of tau aggregate in the presence of amyloid-β (Fig. 2 and Supplementary Fig. 4). When tau neurofibrillary tangles were assessed by thioflavin-S—a compound that recognizes beta-sheet structure in protein aggregates—there was a reduction in the number of thioflavin-S neurofibrillary tangles in both the rTg4510 DOX and APP × rTg4510 DOX cohorts (Fig. 3D and E). Unlike with AT8 pathology where the per cent area covered by pathology was assessed, the neurofibrillary tangle burden was measured by counting the number of neurofibrillary tangles using a stereology setup since thioflavin-S also binds to the beta sheets in amyloid-β plaques. Interestingly, unlike AT8 pathology analyses, there was an equal level of neurofibrillary tangle reduction in both the rTg4510 DOX and APP × rTg4510 DOX mice, bringing the neurofibrillary tangle numbers down close to what we have previously reported for rTg4510 and APP × rTg4510 4–6-month-old mice (Bennett et al., 2017).

Figure 3.

Figure 3

Reducing human tau decreases tau pathology in APP × rTg4510 brains. (A–C) Three sections selected at 400 µm intervals throughout the brain that contained hippocampus were taken from all study mice and stained for tau pathology using the AT8 antibody that recognizes phospho-tau at Ser202/Thr205. Representative images (A) and quantification of AT8 pathology in both the cortex [B; treatment effect F(1,46) = 14.08, P = 0.0005] and hippocampus [C; treatment effect F(1,46) = 7.348, P = 0.0094] show a reduction in tau pathology in both the rTg4510 and APP × rTg4510 DOX brain sections as compared to their naïve genotype controls. Interestingly, APP × rTg4510 DOX mice do have significantly more AT8 tau pathology when compared to the rTg4510 DOX mice. (D and E) Quantification [D; treatment effect F(1,46) = 44.32, P < 0.0001] and representative images (E) showing both rTg4510 and APP × rTg4510 mice treated with DOX show fewer thioflavin-S positive neurofibrillary tangles (NFT) in the cortex than the rTg4510 and APP × rTg4510 naïve treated mice, respectively. Two-way ANOVA, Sidak post hoc analysis. *P < 0.05, ****P < 0.0001. Each data point represents one mouse. Mean ± SEM.

Human tau reduction decreases tau bioactivity in the presence of amyloid-β

To measure tau bioactivity levels, we employed the stably expressing HEK293 cells that express the mutant P301S repeat domain of tau (TauRD) fused with CFP and YFP. In the presence of tau aggregates, TauRD-CFP and TauRD-YFP are recruited to the aggregate where they are then in close enough proximity to exhibit FRET, which can be detected on a flow cytometer for quantification.

Because low levels of rTg4510 and APP × rTg4510 lysate yield high bioactivity, we collected treated cells every 3 h to ensure we were not reading out bioactivity at a saturated point. Lysates were applied to the stably expressing cells and collected every 3–6 h for 24 h. Similar to our previous experiments at 12 months of age, naïve rTg4510 and APP × rTg4510 mice showed similar levels of tau bioactivity (Bennett et al., 2017) (Fig. 4). Both the rTg4510 DOX and APP × rTg4510 DOX cohorts showed a significant reduction in bioactivity as compared to their respective naïve genotype controls, starting at 15 h post-treatment for rTg4510 DOX and 18 h post-treatment for APP × rTg4510 DOX. At the final 24-h time point, there was a significant increase in bioactivity in the APP × rTg4510 DOX mice when compared to the non-amyloid-β expressing rTg4510 DOX mice, echoing the phenomenon we have seen previously with younger rTg4510 and APP × rTg4510 mice (Bennett et al., 2017). We also assessed the number and size of FRET-positive inclusions that were induced in the HEK293 biosensor cells. Cells treated with rTg4510 lysate exhibited an increased number of smaller FRET-positive inclusions per cell as measured by total FRET mean fluorescent intensity and spot count as compared to APP × rTg4510 lysate treated cells (Supplementary Fig. 6). This may serve as a proxy as to the types of tau aggregates in the lysate that subsequently recruit TauRD-CFP and -YFP monomer, with rTg4510 lysate containing smaller and less stable aggregates and APP × rTg4510 lysate possessing larger aggregates with increased stability. These bioactivity data combined with the previous biochemical (Fig. 2) and pathological (Fig. 3) data together suggest that it may be the more stable, AT8-aggregated, high molecular weight tau that is the more bioactive tau species as compared to the thioflavin-S positive neurofibrillary tangles.

Figure 4.

Figure 4

Human tau reduction decreases tau seeding activity despite amyloid-β presence. (A) A total of 0.1ug of total brain lysate per well was added to the HEK-TauRDCFP/YFP tau bioactivity sensor cells with Lipofectamine® and one well collected every 3 h for 24 h to measure the amount of aggregation—read out as FRET activity—over time for each sample. Integrated FRET Density was calculated for all samples by multiplying the per cent FRET positive cells by the median fluorescence intensity of the FRET positive population. Both the rTg4510 DOX (blue asterisk) and APP × rTg4510 DOX (green asterisk) samples exhibited less tau seeding activity than their naïve genotype controls. At the final 24 h point, a significant difference between the rTg4510 DOX and APP × rTg4510 DOX groups emerged (black asterisk). Treatment effect F(3,29) = 5.961, P = 0.0027. (B) Representative images of non-transduced cells (−), non-transgenic (NT), and APP/PS1 (APP) treated cells at the final 24 h collection point, all showing no aggregation. (C) Representative images of both rTg4510 and APP × rTg4510 genotypes and each treatment across all time points collected. Two-way repeated measures ANOVA, Sidak post hoc multiple comparisons. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Graphical data are represented as mean ± SEM.

The presence of aggregated tau decreases the number of amyloid-β plaques

While tau-containing neurofibrillary tangles are one of the major pathologies in Alzheimer’s disease, the other is the formation of extracellular amyloid-β plaques (Masters et al., 1985; Braak and Braak, 1991). In the previous characterization of the APP × rTg4510 mice, a decrease in the number of cortical amyloid-β plaques was observed as compared to APP/PS1 mice (Bennett et al., 2017). To determine the effect of tau lowering on amyloid-β pathology, we first measured the amount of PBS soluble amyloid-β1-42 peptide in the brain homogenate (Iwatsubo et al., 1996). We did not observe any changes in the amount of soluble amyloid-β1-42 peptide levels per gram of tissue between either the APP × rTg4510 naïve and DOX cohorts, nor in non-tau containing APP/PS1 mice (Fig. 5A). Next, brain sections were stained with a pan anti-human amyloid-β antibody and both the number of amyloid-β antibody-positive plaques per mm2 as well as the size distribution of plaques counted was assessed (Fig. 5B–D). No plaques were detected in non-transgenic or rTg4510 mice (Fig. 5B and Supplementary Fig. 7). Both the plaque number and size were reduced in the APP × rTg4510 mice when compared to non-tau containing APP/PS1 mice. When human tau was reduced, both the number and size of plaques were partially restored. As a second measure of amyloid-β plaque burden, the number of cortical thioflavin-S-positive plaques were counted. Plaque number was reduced in the APP × rTg4510 naïve mice when compared to APP/PS1 mice, as previously reported, and was partially restored when human tau was lowered (Fig. 5E and F). This partial restoration in plaque number as measured by both amyloid-β antibody and Thioflavin-S in the APP × rTg4510 DOX cohort is still significantly lower than the APP/PS1 mice. This phenomenon of decreased plaque number in the APP × rTg4510 naïve mice compared to APP/PS1 mice may be due to a combination of an increase in astrogliosis and/or microgliosis in the presence of tau pathology, in addition to substantial neuronal loss, which would decrease the amount of APP overexpressing cells in the brain, arguably diminishing amyloid-β plaque deposition.

Figure 5.

Figure 5

Amyloid-β plaque numbers are partially restored after DOX treatment. (A) Total PBS soluble amyloid-β1-42 levels as measured by ELISA were not significantly altered between APP and APP × rTg4510 mice, nor naïve APP × rTg4510 and DOX APP × rTg4510 mice. Treatment effect F(1,46) = 0.096, P = 0.758. Two-way ANOVA. (B) Three sections selected at 400 -µm intervals throughout the brain that contained hippocampus were taken from all study mice and stained for amyloid-β (Aβ) plaque pathology using an antibody that recognizes all human amyloid-β peptides. Representative images of amyloid-β plaques. Ctx = cortex; DG = dentate gyrus. Full brain scale bar = 1 mm; cortex and dentate gyrus scale bars = 100 µm. (C) For all plaques counted, the area of the plaques was also calculated. To determine if there is a shift in the size of the plaques in the study mice, the percentage of small plaques (<16 µm diameter) and larger plaques (>17 µm diameter) was generated for each animal and averaged across groups. APP × rTg4510 naïve mice have a larger percentage of smaller plaques than APP/PS1 expressing mice that is partially restored in the APP × rTg4510 DOX cohort. Treatment effect F(2,28) = 4.003, P = 0.0296. Two-way repeated measures ANOVA. (D) Quantification of the number of plaques per mm2 of brain tissue shows a significant reduction in amyloid-β plaque numbers in the naïve APP × rTg4510 mice as compared to the APP/PS1 only expressing mice, which was partially restored in the APP × rTg4510 DOX treated cohort. Treatment effect F(1,46) = 7.154, P = 0.0103. Two-way ANOVA, Sidak post hoc analysis. (E) Three sections selected at 400 -µm intervals throughout the brain that contained hippocampus were taken from all study mice and stained with thioflavin-S, which recognizes dense core plaques. Quantification of the number of plaques per mm2 of brain tissue shows a significant reduction in amyloid-β plaque numbers in the naïve APP × rTg4510 mice as compared to the APP/PS1 only expressing mice, which was minimally increased in the APP × rTg4510 DOX treated cohort. Treatment effect F(1,46) = 2.923, P = 0.094. Two-way ANOVA, Sidak post hoc analysis. (F) Representative images of cortical thioflavin-S plaques. Scale bar = 100 µm. *P < 0.05, ***P < 0.001, ****P < 0.0001. Each data point represents one mouse. Mean ± SEM.

Lowering human tau in the presence of amyloid-β significantly reduces astrogliosis but not microgliosis

In Alzheimer’s disease, inflammation plays a major role in the disease pathogenesis (Beach et al., 1989; Serrano-Pozo et al., 2013; Heppner et al., 2015). To test the effect of lowering total human tau on astrogliosis and microgliosis, sections were stained for GFAP and ionized calcium-binding adapter molecule 1 (Iba1), respectively. Astrogliosis, as measured by an increase in GFAP per cent coverage, is increased throughout the cortex in both the presence of amyloid-β plaques in APP/PS1 mice and tau pathology in rTg4510 mice (Fig. 6A and B). APP/PS1 mice treated with DOX for 6 months did not have significantly different levels of astrogliosis than naïve APP/PS1 mice, suggesting that DOX alone did not have an impact on amyloid-β-driven astrogliosis. APP × rTg4510 naïve mice showed an additive effect for astrogliosis when compared to APP/PS1 naïve and rTg4510 naïve groups, similar to our previous report (Bennett et al., 2017). Reducing human tau alone with DOX in the rTg4510 mice significantly reduced astrogliosis. Further, compared to the naïve APP × rTg4510 cohort, the APP × rTg4510 DOX mice showed a significant reduction in astrogliosis. However, when compared to the rTg4510 DOX cohort, there was still a significant increase in astrogliosis in the APP × rTg4510 DOX mice. This is likely due, at least in part, to the remaining amyloid-β plaques in the APP × rTg4510 DOX mice.

Figure 6.

Figure 6

Astrogliosis, but not microgliosis, is dampened when human tau levels are reduced in the presence of amyloid-β plaques. (A) Quantification of cortical GFAP per cent covered area shows a significant reduction in astrogliosis in both the rTg4510 and APP × rTg4510 DOX brain sections as compared to their naïve genotype controls. Similar to AT8 tau pathology, APP × rTg4510 DOX mice do have significantly more astrogliosis in the cortex when compared to the rTg4510 DOX mice. Treatment effect F(1,46) = 46.45, P < 0.0001. Two-way ANOVA, Sidak post hoc analysis. (B) Representative images of cortical GFAP staining. (C) Quantification of cortical Iba1 per cent coverage shows a significant reduction in microgliosis in only the rTg4510 DOX brain sections as compared to naïve rTg4510 mice. Similar to astrogliosis, APP × rTg4510 DOX mice do have significantly more microgliosis when compared to the rTg4510 DOX mice. Treatment effect F(1,46) = 8.159, P = 0.0064. Two-way ANOVA, Sidak post hoc analysis. (D) Representative images of cortical Iba1 staining. Scale bar = 50 µm. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Each data point represents one mouse. Mean ± SEM.

In addition to astrogliosis, we assessed microgliosis by staining for Iba1 and looking at per cent coverage of Iba1-positive glia. As microglia become activated, they extend out processes, causing an increase in the per cent area occupied (Blackbeard et al., 2007; Trapp et al., 2007; Chen et al., 2012). Similar to the astrogliosis effect, both amyloid-β and tau pathology alone were capable of inducing an increase in microgliosis (Fig. 6C and D). Having both amyloid-β plaques and tau accumulation also resulted in an increase in microgliosis, though it was not significantly higher than either of the individual Alzheimer’s disease pathologies. While there was a reduction in microgliosis in rTg4510 DOX-treated mice, when human tau was lowered in APP × rTg4510 DOX mice, there was no significant reduction in microgliosis, likely because of the continued presence of amyloid-β plaques that also cause an increase in microgliosis.

Lowering tau in the presence of amyloid-β is sufficient to rescue neuronal loss

A major causative factor in the loss of memory and function in Alzheimer’s disease is the loss of neurons. Because amyloid-β deposition does not appear to result in neuronal death—APP/PS1 mice do not experience neuronal loss—and tau deposition is directly correlated to cognitive decline in human patients (Arriagada et al., 1992; Nelson et al., 2012), we next sought to test in vivo whether lowering human tau protects against neuronal loss when amyloid-β plaques are present by measuring wet brain weight, cortical volume, and neuronal counts. In the rTg4510 and APP × rTg4510 DOX cohorts, there was an increase in wet brain weight when compared to their genotype naïve controls, though only the APP × rTg4510 DOX group reached statistical significance (Fig. 7A). Next, cortical and hippocampal volume was analysed (Fig. 7B–D). Reducing total human tau was sufficient to protect against volume loss in the brain in rTg4510 and APP × rTg4510 DOX mice, though again only the APP × rTg4510 DOX cohort was statistically significant. The lack of significance in the rTg4510 genotype is likely due to a lower number of mice in rTg4510 naïve cohort since there are strong trends and previous studies have reported a robust neuronal protection phenotype in rTg4510 DOX mice (Santacruz et al., 2005; Spires et al., 2006; Holmes et al., 2016; Blackmore et al., 2017). To directly assess neuronal loss, the number of NeuN positive cells—a pan-neuronal marker—in the CA1 portion of the hippocampus were counted (Fig. 7E and F). This revealed a significant, and equal, protective effect of lowering human tau on neuronal loss in both rTg4510 and APP × rTg4510 DOX mice.

Figure 7.

Figure 7

Tau reduction is equally protective against neuronal loss with amyloid-β deposition. (A) At the time of sacrifice, wet weight of each full brain was analysed immediately after perfusion. APP × rTg4510 DOX brains weighed significantly more than naïve APP × rTg4510 mice with rTg4510 DOX mice show a trend towards an increase in brain weight from the rTg4510 naïve treated mice. Treatment effect F(1,46) = 5.112, P = 0.0285. (B–D) For each mouse, the cortex [B; treatment effect F(1,46) = 12.03, P = 0.0012] and hippocampus [C; treatment effect F(1,46) = 15.41, P = 0.0003) of six sequential sections spaced 400 µm apart were outlined for area and volume calculated. APP × rTg4510 mice treated with DOX showed a significant increase in cortical and hippocampal volume when compared to naïve APP × rTg4510, with rTg4510 DOX mice showing a trend towards increased volume when compared to naïve rTg4510 mice. No significant difference was detected between rTg4510 DOX and APP × rTg4510 DOX treated groups. Cortex (red dashed line) and hippocampus (back dashed line) are highlighted in representative photos (D). (E and F) To assess neuronal counts, the number of NeuN-positive nuclei (nuclei labelled with blue DAPI) in the CA1 portion of the hippocampus was counted in two sequential sections spaced 800 µm apart. Similar to the hippocampal volume analysis, significant, and equal, protection is conferred in rTg4510 and APP × rTg4510 DOX mice [E; treatment effect F(1,46) = 27.21, P < 0.0001]. Representative images showing NeuN (red) and DAPI (blue) in the CA1 region of the hippocampus. Two-way ANOVA, Sidak post hoc analysis. ***P < 0.001, ****P < 0.0001. Each data point represents one mouse. Mean ± SEM.

Discussion

By definition, primary tauopathies include human neurodegenerative disorders where there are neural or glial accumulations of the protein tau, namely Alzheimer’s disease, progressive supranuclear palsy, corticobasal degeneration, Pick’s disease, and ∼40% of frontotemporal dementia cases (Goedert et al., 2012). Of these tauopathies, only Alzheimer’s disease has the additional pathological hallmark of extracellular amyloid-β plaques. All previous studies that have analysed a human tau lowering therapy have been done so solely in the presence of tau pathology. However, given the observation of synergy between tau and amyloid-β across multiple systems (Ribé et al., 2005; Bolmont et al., 2007; Hurtado et al., 2010; Seino et al., 2010; Forny-Germano et al., 2014; Héraud et al., 2014; Bennett et al., 2017), we asked whether a human tau reduction approach, which has been shown to be highly effective in human tau transgenic mice (Santacruz et al., 2005; Polydoro et al., 2013; Xu et al., 2014; DeVos et al., 2017), would still be as effective in an environment combining tau and amyloid-β.

To test this idea, we genetically lowered the human tau transgene in APP × rTg4510 mice that develop both amyloid-β plaques and neurofibrillary tangles in an age-dependent manner (Bennett et al., 2017). DOX treatment was equally effective at lowering human MAPT/tau mRNA and protein in both the rTg4510 and APP × rTg4510 lines (Figs 1 and 2). Subsequently, a significant reduction in tau pathology—both AT8 and thioflavin-S—and tau seeding activity was observed in the rTg4510 DOX and APP × rTg4510 DOX mice when compared to their naïve genotype controls (Figs 3 and 4). While tau aggregation is one of the major pathological hallmarks in Alzheimer’s disease, the other is the presence of amyloid-β plaques. We have previously reported that there are fewer plaques in the context of tau pathology in the APP × rTg4510 mice compared to APP/PS1 mice (Bennett et al., 2017). In the study herein, we found a similar plaque number phenotype and observed a partial restoration in the number and size of plaques in APP × rTg510 DOX mice when compared to APP/PS1 mice (Fig. 5). Astrogliosis was also significantly lowered in both rTg4510 and APP × rTg4510 DOX cohorts, though microgliosis was only reduced in the rTg4510 DOX group (Fig. 6). As a final measure, neuronal integrity—as measured by brain weight, hippocampal and cortical volume, and number of neurons—was equally protected in both the rTg4510 and APP × rTg4510 DOX cohorts (Fig. 7). Together, the data presented here support a tau lowering therapy for primary tauopathies, both with and without concurring amyloid-β plaque deposition.

While there was a reduction in tau aggregation, tau pathology, and tau bioactivity in APP × rTg4510 DOX mice, differences in tau aggregates emerged when amyloid-β plaques were present—notably an increased stability as measured by the persistence of high molecular weight after 6 months of transgene repression and increased bioactivity. Additionally, we noted that tau aggregates in the presence of amyloid-β demonstrated an increased resistance to protease digestion. The use of proteinase K to better understand conformations of aggregated proteins has long been used in the prion field to biochemically discriminate prion aggregate conformations, i.e. strains (Parchi et al., 1996; Aguzzi et al., 2007). Proteinase K digestion has also recently been used to study different conformations of alpha-synuclein (Miake et al., 2002; Guo et al., 2013; Monsellier et al., 2016; Jung et al., 2017), huntingtin (Monsellier et al., 2016), and tau (Falcon et al., 2015; Narasimhan et al., 2017) aggregate conformations. When rTg4510 and APP × rTg4510 lysate was digested with proteinase K, fewer tau fragments are generated in human amyloid-β containing lysate, suggesting that the presence of amyloid-β has altered the conformation of tau to be more protease resistant. This phenotype of amyloid-β-induced tau aggregate resistance to proteinase K was recapitulated in human brain lysate containing neurofibrillary tangles with or without concurrent amyloid-β pathology (Fig. 2). Together, we believe these data support the notion that amyloid-β, either directly or indirectly, alters the conformation of soluble tau aggregates, resulting in a more stable conformation of tau aggregate that is longer lived in vivo. We do note that the timing of pathological tau and amyloid-β deposition in this new double transgenic model may not be exactly as seen in human Alzheimer’s disease patients and that this may impact the degree of effect that amyloid-β has on tau aggregation. Future studies of transgenic mouse models that develop amyloid-β deposition well before the onset of tau pathology would be informative and important in better understanding the range of impacts that amyloid-β can have on tau.

We have suggested that Alzheimer’s-induced neurodegeneration can be conceptually divided into an ‘amyloid dependent’ and ‘amyloid independent’ phase, whereby the deposition of plaques leads ultimately to tangles and neurodegeneration, which become independent to the initiating factor. One evocation of this hypothesis is that amyloid-β deposits lead to a synergistic effect on tau, which adopts a more pathological phenotype which, due to enhanced bioactivity, can lead to enhanced Alzheimer’s disease-related phenotypes. The current studies are consistent with this model: tau in the presence of amyloid-β adopts different biochemical characteristics, as measured by size on SDD-AGE blots, protease resistance, and, importantly, both a presumed longer half-life and increased bioactivity as measured on an aggregation assay. Perhaps, though, neurons are capable of withstanding a lower level of tau aggregation, such that a reduction of tau expression is sufficient to be profoundly neuroprotective, either in the presence or absence of amyloid-β deposits.

In addition to neurofibrillary tangle and amyloid-β pathologies impacting disease, both microgliosis and astrogliosis are thought to play an important role in the pathogenesis of Alzheimer’s disease (Serrano-Pozo et al., 2013). In the tau only rTg4510 mice, when tau is decreased by DOX, both microgliosis and astrogliosis are significantly reduced. However, in the presence of amyloid-β deposition, tau reduction is only associated with a reduction in the astrogliosis phenotype. The significant reduction in astrogliosis in the APP × rTg4510 DOX mice is likely due to an additive effect of astrocyte activation when both tau and amyloid-β pathologies are present, such that with decreased tau expression, the astrogliosis is reduced to a similar level as amyloid-β alone APP/PS1 mice. In the human brain, astrogliosis is directly correlated with neurofibrillary tangle deposition, synapse loss, and cognitive decline (Ingelsson et al., 2004; Kashon et al., 2004; Serrano-Pozo et al., 2013) and attenuating the activation of astrocytes in vivo rescues synaptic dysfunction and cognitive decline (Furman et al., 2012), suggesting that lowering of astrogliosis is therapeutically beneficial.

Understanding the consequences of endogenous tau repression is also of importance in thinking of a human tau lowering therapy for the clinic. Tau deletion can protect against a growing number of amyloid-β-mediated toxicities in vivo, including cognition (Roberson et al., 2007; Leroy et al., 2012), seizures (Roberson et al., 2007, 2011; Ittner et al., 2010; Suberbielle et al., 2013; Li et al., 2014), survival (Roberson et al., 2007, 2011; Ittner et al., 2010), axonal transport deficits (Vossel et al., 2010), and double-stranded breaks in DNA (Suberbielle et al., 2013). This complete deletion of tau has also been shown to be phenotypically normal in regard to learning/memory, cognition, and neuroanatomy (Roberson et al., 2007; Morris et al., 2013; Li et al., 2014; van Hummel et al., 2016) with a minor motor phenotype developing later in life (Lei et al., 2012; Morris et al., 2013; Li et al., 2014; van Hummel et al., 2016). Additionally, when murine tau was lowered in adult mice, no deficits in any sensory, motor, or cognitive tasks were detected (DeVos et al., 2013). Endogenous tau has also been lowered in non-human primates with no alterations from baseline reported (Olson et al., 2016; DeVos et al., 2017), further supporting the safety of reducing tau levels in the adult brain.

Alzheimer’s disease is a complex disease with amyloid-β plaque deposition, tau accumulation, and neuroinflammation all contributing to the overall neurodegeneration. In our studies here, amyloid-β causes an increase in glial activation while also having an impact on the pathogenicity of tau aggregation. Whether amyloid-β interacts directly or indirectly with tau aggregates to induce a unique, more pathogenic conformation will be an important subject for further study. We believe these current data, while providing pre-clinical support for a tau lowering therapy in human Alzheimer’s disease patients, provide a basis to begin dissecting the contributions of each of these different pathologies—tau, amyloid-β, and gliosis—in the mature phase of Alzheimer’s disease.

Supplementary Material

Supplementary Data

Acknowledgements

We thank Dr Marc Diamond for the HEK293 CFP/YFP-TauRD cell line and Dr Kathleen Schoch for providing manuscript edits. Acknowledgement is also made to the donors of Alzheimer’s Disease Research, a program of BrightFocus Foundation, for support of this research.

Funding

This research was funded by NIA training grants to the Division of Medical Sciences at Harvard University (NIH/NIA T32 AG000222, S.L.D. and R.E.B.), Brightfocus Foundation (S.L.D. and R.E.B.), the Massachusetts Alzheimer’s Disease Center grant P50AG05134 (B.T.H.), the JPB Foundation (B.T.H.) and by NIH Grants P30 NS045776 (M.J.) and AG026249 (B.T.H.).

Supplementary material

Supplementary material is available at Brain online.

Glossary

Abbreviations

CFP

cyan fluorescence protein

DOX

doxycycline

ELISA

enzyme-linked immunosorbent assay

FRET

Forster resonance energy transfer

SDD-AGE

semi-denaturing detergent agarose gel electrophoresis

References

  1. Acker CM, Forest SK, Zinkowski R, Davies P, d’Abramo C. Sensitive quantitative assays for tau and phospho-tau in transgenic mouse models. Neurobiol Aging 2013; 34: 338–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aguzzi A, Heikenwalder M, Polymenidou M. Insights into prion strains and neurotoxicity. Nat Rev Mol Cell Biol 2007; 8: 552–61. [DOI] [PubMed] [Google Scholar]
  3. Arriagada PV, Marzloff K, Hyman BT. Distribution of Alzheimer-type pathologic changes in nondemented elderly individuals matches the pattern in Alzheimer’s disease. Neurology 1992; 42: 1681–8. [DOI] [PubMed] [Google Scholar]
  4. Barten DM, Cadelina GW, Hoque N, DeCarr LB, Guss VL, Yang L, et al. Tau transgenic mice as models for cerebrospinal fluid tau biomarkers. J Alzheimers Dis 2011; 24 (Suppl 2): 127–41. [DOI] [PubMed] [Google Scholar]
  5. Barthélemy NR, Fenaille F, Hirtz C, Sergeant N, Schraen-Maschke S, Vialaret J, et al. Tau protein quantification in human cerebrospinal fluid by targeted mass spectrometry at high sequence coverage provides insights into its primary structure heterogeneity. J Proteome Res 2016; 15: 667–76. [DOI] [PubMed] [Google Scholar]
  6. Beach TG, Walker R, McGeer EG. Patterns of gliosis in alzheimer’s disease and aging cerebrum. Glia 1989; 2: 420–36. [DOI] [PubMed] [Google Scholar]
  7. Bennett RE, DeVos SL, Dujardin S, Corjuc B, Gor R, Gonzalez J, et al. Enhanced Tau aggregation in the presence of amyloid β. Am J Pathol 2017; 187: 1601–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Blackbeard J, O’Dea KP, Wallace VCJ, Segerdahl A, Pheby T, Takata M, et al. Quantification of the rat spinal microglial response to peripheral nerve injury as revealed by immunohistochemical image analysis and flow cytometry. J Neurosci Methods 2007; 164: 207–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Blackmore T, Meftah S, Murray TK, Craig PJ, Blockeel A, Phillips K, et al. Tracking progressive pathological and functional decline in the rTg4510 mouse model of tauopathy. Alzheimers Res Ther 2017; 9: 77. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Bolmont T, Clavaguera F, Meyer-Luehmann M, Herzig MC, Radde R, Staufenbiel M, et al. Induction of tau pathology by intracerebral infusion of amyloid-β-containing brain extract and by amyloid-β deposition in APP × Tau transgenic mice. Am J Pathol 2007; 171: 2012–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Braak H, Braak E. Neuropathological stageing of alzheimer-related changes. Acta Neuropathol 1991; 82: 239–59. [DOI] [PubMed] [Google Scholar]
  12. Buee L, Delacourte A. Comparative biochemistry of tau in progressive supranuclear palsy, corticobasal degeneration, FTDP-17 and pick’ s disease. Brain Pathol 1999; 693: 681–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Chen Z, Jalabi W, Shpargel KB, Farabaugh KT, Dutta R, Yin X, et al. Lipopolysaccharide-induced microglial activation and neuroprotection against experimental brain injury is independent of hematogenous TLR4. J Neurosci 2012; 32: 11706–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Delacourte A, Sergeant N, Champain D, Wattez A, Maurage C-A, Lebert F, et al. Nonoverlapping but synergetic tau and APP pathologies in sporadic Alzheimer’s disease. Neurology 2002; 59: 398–407. [DOI] [PubMed] [Google Scholar]
  15. DeVos SL, Goncharoff DK, Chen G, Kebodeaux CS, Yamada K, Stewart FR, et al. Antisense reduction of tau in adult mice protects against seizures. J Neurosci 2013; 33: 12887–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. DeVos SL, Miller RL, Schoch KM, Holmes BB, Kebodeaux CS, Wegener AJ, et al. Tau reduction prevents neuronal loss and reverses pathological tau deposition and seeding in mice with tauopathy. Sci Transl Med 2017; 9: eaag0481. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Falcon B, Cavallini A, Angers R, Glover S, Murray TK, Barnham L, et al. Conformation determines the seeding potencies of native and recombinant tau aggregates. J Biol Chem 2015; 290: 1049–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Forny-Germano L, Lyra e Silva NM, Batista AF, Brito-Moreira J, Gralle M, Boehnke SE, et al. Alzheimer’s disease-like pathology induced by amyloid-β oligomers in nonhuman primates. J Neurosci 2014; 34: 13629–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Furman JL, Sama DM, Gant JC, Beckett TL, Murphy MP, Bachstetter AD, et al. Targeting astrocytes ameliorates neurologic changes in a mouse model of Alzheimer’s disease. J Neurosci 2012; 32: 16129–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Goedert M, Ghetti B, Spillantini MG. Frontotemporal dementia: implications for understanding Alzheimer disease. Cold Spring Harb Perspect Med 2012; 2: a006254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Goedert M, Jakes R, Vanmechelen E. Monoclonal antibody AT8 recognises tau protein phosphorylated at both serine 202 and threonine 205. Neurosci Lett 1995; 189: 167–9. [DOI] [PubMed] [Google Scholar]
  22. Gotz J, Chen F, van Dorpe J, Nitsch RM. Formation of neurofibrillary tangles in P301L tau transgenic mice induced by abeta 42 fibrils. Science 2001; 293: 1491–5. [DOI] [PubMed] [Google Scholar]
  23. Guo JL, Covell DJ, Daniels JP, Iba M, Stieber A, Zhang B, et al. Distinct α-synuclein strains differentially promote tau inclusions in neurons. Cell 2013; 154: 103–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Halfmann R, Lindquist S. Screening for amyloid aggregation by Semi-Denaturing Detergent-Agarose Gel Electrophoresis. J Vis Exp 2008; 17: pii: 838. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. He Z, Guo JL, McBride JD, Narasimhan S, Kim H, Changolkar L, et al. Amyloid-β plaques enhance Alzheimer’s brain tau-seeded pathologies by facilitating neuritic plaque tau aggregation. Nat Med 2018; 24: 29–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Heppner FL, Ransohoff RM, Becher B. Immune attack: the role of inflammation in Alzheimer disease. Nat Rev Neurosci 2015; 16: 358–72. [DOI] [PubMed] [Google Scholar]
  27. Héraud C, Goufak D, Ando K, Leroy K, Suain V, Yilmaz Z, et al. Increased misfolding and truncation of tau in APP/PS1/tau transgenic mice compared to mutant tau mice. Neurobiol Dis 2014; 62: 100–12. [DOI] [PubMed] [Google Scholar]
  28. Holmes BB, Furman JL, Mahan TE, Yamasaki TR, Mirbaha H, Eades WC, et al. Proteopathic tau seeding predicts tauopathy in vivo. Proc Natl Acad Sci USA 2014; 111: E4376–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Holmes HE, Colgan N, Ismail O, Ma D, Powell NM, O’Callaghan JM, et al. Imaging the accumulation and suppression of tau pathology using multiparametric MRI. Neurobiol Aging 2016; 39: 184–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Holmes HE, Powell NM, Ma D, Ismail O, Harrison IF, Wells JA, et al. Comparison of in vivo and ex vivo MRI for the detection of structural abnormalities in a mouse model of tauopathy. Front Neuroinform 2017; 11: 20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Hurtado DE, Molina-Porcel L, Iba M, Aboagye AK, Paul SM, Trojanowski JQ, et al. Aβ accelerates the spatiotemporal progression of tau pathology and augments tau amyloidosis in an Alzheimer mouse model. Am J Pathol 2010; 177: 1977–88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Hyman BT, Van Hoesen GW, Damasio AR, Barnes CL. Alzheimer’s disease: cell-specific pathology isolates the hippocampal formation. Science 1984; 225: 1168–70. [DOI] [PubMed] [Google Scholar]
  33. Ingelsson M, Fukumoto H, Newell KL, Growdon JH, Hedley-Whyte ET, Frosch MP, et al. Early Abeta accumulation and progressive synaptic loss, gliosis, and tangle formation in AD brain. Neurology 2004; 62: 925–31. [DOI] [PubMed] [Google Scholar]
  34. Ittner LM, Ke YD, Delerue F, Bi M, Gladbach A, van Eersel J, et al. Dendritic function of tau mediates amyloid-beta toxicity in Alzheimer’s disease mouse models. Cell 2010; 142: 387–97. [DOI] [PubMed] [Google Scholar]
  35. Iwatsubo T, Saido TC, Mann DM, Lee VM, Trojanowski JQ. Full-length amyloid-beta (1-42(43)) and amino-terminally modified and truncated amyloid-beta 42(43) deposit in diffuse plaques. Am J Pathol 1996; 149: 1823–30. [PMC free article] [PubMed] [Google Scholar]
  36. Jankowsky JL, Fadale DJ, Anderson J, Xu GM, Gonzales V, Jenkins NA, et al. Mutant presenilins specifically elevate the levels of the 42 residue -amyloid peptide in vivo: evidence for augmentation of a 42-specific secretase. Hum Mol Genet 2003; 13: 159–70. [DOI] [PubMed] [Google Scholar]
  37. Jankowsky JL, Fadale DJ, Anderson J, Xu GM, Gonzales V, Jenkins NA, et al. Mutant presenilins specifically elevate the levels of the 42 residue beta-amyloid peptide in vivo: evidence for augmentation of a 42-specific gamma secretase. Hum Mol Genet 2004; 13: 159–70. [DOI] [PubMed] [Google Scholar]
  38. Jankowsky JL, Slunt HH, Ratovitski T, Jenkins NA, Copeland NG, Borchelt DR. Co-expression of multiple transgenes in mouse CNS: a comparison of strategies. Biomol Eng 2001; 17: 157–65. [DOI] [PubMed] [Google Scholar]
  39. Jung BC, Lim Y-J, Bae E-J, Lee JS, Choi MS, Lee MK, et al. Amplification of distinct α-synuclein fibril conformers through protein misfolding cyclic amplification. Exp Mol Med 2017; 49: e314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Kashon ML, Ross GW, O’Callaghan JP, Miller DB, Petrovitch H, Burchfiel CM, et al. Associations of cortical astrogliosis with cognitive performance and dementia status. J Alzheimers Dis 2004; 6: 595–604; discussion 673–81. [DOI] [PubMed] [Google Scholar]
  41. Lei P, Ayton S, Finkelstein DI, Spoerri L, Ciccotosto GD, Wright DK, et al. Tau deficiency induces parkinsonism with dementia by impairing APP-mediated iron export. Nat Med 2012; 18: 291–5. [DOI] [PubMed] [Google Scholar]
  42. Leroy K, Ando K, Laporte V, Dedecker R, Suain V, Authelet M, et al. Lack of tau proteins rescues neuronal cell death and decreases amyloidogenic processing of APP in APP/PS1 mice. Am J Pathol 2012; 181: 1928–40. [DOI] [PubMed] [Google Scholar]
  43. Lewis J, Dickson DW, Lin WL, Chisholm L, Corral A, Jones G, et al. Enhanced Neurofibrillary degeneration in transgenic mice expressing mutant tau and APP. Science 2001; 293: 1487–91. [DOI] [PubMed] [Google Scholar]
  44. Li Z, Hall AM, Kelinske M, Roberson ED. Seizure resistance without parkinsonism in aged mice after tau reduction. Neurobiol Aging 2014; 35: 2617–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Mairet-Coello G, Courchet J, Pieraut S, Courchet V, Maximov A, Polleux F. The CAMKK2-AMPK kinase pathway mediates the synaptotoxic effects of Aβ oligomers through tau phosphorylation. Neuron 2013; 78: 94–108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Manassero G, Guglielmotto M, Zamfir R, Borghi R, Colombo L, Salmona M, et al. Beta-amyloid 1-42 monomers, but not oligomers, produce PHF-like conformation of Tau protein. Aging Cell 2016; 15: 914–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Masters CL, Simms G, Weinman NA, Multhaup G, McDonald BL, Beyreuther K. Amyloid plaque core protein in Alzheimer disease and down syndrome. Proc Natl Acad Sci USA 1985; 82: 4245–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Mayford M, Bach ME, Huang Y-Y, Wang L, Hawkins RD, Kandel ER. Control of memory formation through regulated expression of a CaMKII transgene. Science 1996; 274: 1678–83. [DOI] [PubMed] [Google Scholar]
  49. Miake H, Mizusawa H, Iwatsubo T, Hasegawa M. Biochemical characterization of the core structure of α-synuclein filaments. J Biol Chem 2002; 277: 19213–19. [DOI] [PubMed] [Google Scholar]
  50. Monsellier E, Bousset L, Melki R. α-Synuclein and huntingtin exon 1 amyloid fibrils bind laterally to the cellular membrane. Sci Rep 2016; 6: 19180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Morris JC, Heyman A, Mohs RC, Hughes JP, van Belle G, Fillenbaum G, et al. The Consortium to establish a registry for Alzheimer’s disease (CERAD): Part I. Clinical and neuropsychological assessment of Alzheimer’s disease. Neurology 1989; 39: 1159–65. [DOI] [PubMed] [Google Scholar]
  52. Morris M, Hamto P, Adame A, Devidze N, Masliah E, Mucke L. Age-appropriate cognition and subtle dopamine-independent motor deficits in aged tau knockout mice. Neurobiol Aging 2013; 34: 1523–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Narasimhan S, Guo JL, Changolkar L, Stieber A, McBride JD, Silva LV, et al. Pathological tau strains from human brains recapitulate the diversity of tauopathies in nontransgenic mouse brain. J Neurosci 2017; 37: 11406–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Nelson PT, Alafuzoff I, Bigio EH, Bouras C, Braak H, Cairns NJ, et al. Correlation of Alzheimer disease neuropathologic changes with cognitive status: a review of the literature. J Neuropathol Exp Neurol 2012; 71: 362–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Olson RE, Cacace AM, Hagedorn P, Høg AM, Jensen ML, Nielsen NF, et al. Tau antisense oligomers and uses thereof. International Patent Number: WO/2016/126995. Basel, Switzerland: 2016. [Google Scholar]
  56. Parchi P, Castellani R, Capellari S, Ghetti B, Young K, Chen SG, et al. Molecular basis of phenotypic variability in sporadc creudeldt-jakob disease. Ann Neurol 1996; 39: 767–78. [DOI] [PubMed] [Google Scholar]
  57. Polydoro M, de Calignon A, Suárez-Calvet M, Sanchez L, Kay KR, Nicholls SB, et al. Reversal of neurofibrillary tangles and tau-associated phenotype in the rTgTauEC model of early Alzheimer’s disease. J Neurosci 2013; 33: 13300–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Price JL, Morris JC. Tangles and plaques in nondemented aging and “preclinical” Alzheimer’s disease. Ann Neurol 1999; 45: 358–68. [DOI] [PubMed] [Google Scholar]
  59. Ribé EM, Pérez M, Puig B, Gich I, Lim F, Cuadrado M, et al. Accelerated amyloid deposition, neurofibrillary degeneration and neuronal loss in double mutant APP/tau transgenic mice. Neurobiol Dis 2005; 20: 814–22. [DOI] [PubMed] [Google Scholar]
  60. Roberson ED, Halabisky B, Yoo JW, Yao J, Chin J, Yan F, et al. Amyloid-β/Fyn-induced synaptic, network, and cognitive impairments depend on tau levels in multiple mouse models of Alzheimer’s disease. J Neurosci 2011; 31: 700–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Roberson ED, Scearce-Levie K, Palop JJ, Yan F, Cheng IH, Wu T, et al. Reducing endogenous tau ameliorates amyloid beta-induced deficits in an Alzheimer’s disease mouse model. Science 2007; 316: 750–4. [DOI] [PubMed] [Google Scholar]
  62. Sanders DW, Kaufman SK, DeVos SL, Sharma AM, Mirbaha H, Li A, et al. Distinct tau prion strains propagate in cells and mice and define different tauopathies. Neuron 2014; 82: 1271–88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Santacruz K, Lewis J, Spires T, Paulson J, Kotilinek L, Ingelsson M, et al. Tau suppression in a neurodegenerative mouse model improves memory function. Science 2005; 309: 476–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Seino Y, Kawarabayashi T, Wakasaya Y, Watanabe M, Takamura A, Yamamoto-Watanabe Y, et al. Amyloid β accelerates phosphorylation of tau and neurofibrillary tangle formation in an amyloid precursor protein and tau double-transgenic mouse model. J Neurosci Res 2010; 88: 3547–54. [DOI] [PubMed] [Google Scholar]
  65. Serrano-Pozo A, Gómez-Isla T, Growdon JH, Frosch MP, Hyman BT. A phenotypic change but not proliferation underlies glial responses in Alzheimer disease. Am J Pathol 2013; 182: 2332–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Sigurdsson EM, Lee JM, Dong XW, Hejna MJ, Lorens SA. Bilateral injections of amyloid-beta 25-35 into the amygdala of young Fischer rats: behavioral, neurochemical, and time dependent histopathological effects. Neurobiol Aging 1997; 18: 591–608. [DOI] [PubMed] [Google Scholar]
  67. Spires TL, Orne JD, SantaCruz K, Pitstick R, Carlson GA, Ashe KH, et al. Region-specific dissociation of neuronal loss and neurofibrillary pathology in a mouse model of tauopathy. Am J Pathol 2006; 168: 1598–607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Suberbielle E, Sanchez PE, Kravitz AV, Wang X, Ho K, Eilertson K, et al. Physiologic brain activity causes DNA double-strand breaks in neurons, with exacerbation by amyloid-β. Nat Neurosci 2013; 16: 613–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Takeda S, Commins C, DeVos SL, Nobuhara CK, Wegmann S, Roe AD, et al. Seed-competent high-molecular-weight tau species accumulates in the cerebrospinal fluid of Alzheimer’s disease mouse model and human patients. Ann Neurol 2016; 80: 355–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Takeda S, Wegmann S, Cho H, Devos SL, Commins C, Roe AD, et al. Neuronal uptake and propagation of a rare phosphorylated high-molecular-weight tau derived from Alzheimer’s disease brain. Nat Commun 2015; 6: 8490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Trapp BD, Wujek JR, Criste GA, Jalabi W, Yin X, Kidd GJ, et al. Evidence for synaptic stripping by cortical microglia. Glia 2007; 55: 360–8. [DOI] [PubMed] [Google Scholar]
  72. van Hummel A, Bi M, Ippati S, van der Hoven J, Volkerling A, Lee WS, et al. No overt deficits in aged tau-deficient C57Bl/6.Mapttm1(EGFP)Kit GFP Knockin Mice. PLoS One 2016; 11: e0163236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Vossel KA, Zhang K, Brodbeck J, Daub AC, Sharma P, Finkbeiner S, et al. Tau reduction prevents Abeta-induced defects in axonal transport. Science 2010; 330: 198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Xu H, Rösler TW, Carlsson T, de Andrade A, Fiala O, Hollerhage M, et al. Tau silencing by siRNA in the P301S mouse model of tauopathy. Curr Gene Ther 2014; 14: 343–51. [DOI] [PubMed] [Google Scholar]
  75. Yanamandra K, Kfoury N, Jiang H, Mahan TE, Ma S, Maloney SE, et al. Anti-tau antibodies that block tau aggregate seeding in vitro markedly decrease pathology and improve cognition in vivo. Neuron 2013; 80: 402–14. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Data

Articles from Brain are provided here courtesy of Oxford University Press

RESOURCES