Skip to main content
NCBI home page
American Journal of Physiology - Renal Physiology logoLink to American Journal of Physiology - Renal Physiology
. 2017 Nov 29;314(5):F753–F762. doi: 10.1152/ajprenal.00528.2017

Klotho and activin A in kidney injury: plasma Klotho is maintained in unilateral obstruction despite no upregulation of Klotho biosynthesis in the contralateral kidney

Anders Nordholm 1, Maria L Mace 1,2, Eva Gravesen 2, Jacob Hofman-Bang 2, Marya Morevati 2, Klaus Olgaard 2, Ewa Lewin 1,2,✉
PMCID: PMC6031917  PMID: 29187373

Abstract

In a new paradigm of etiology related to chronic kidney disease-mineral and bone disorder (CKD-MBD), kidney injury may cause induction of factors in the injured kidney that are released into the circulation and thereby initiate and maintain renal fibrosis and CKD-MBD. Klotho is believed to ameliorate renal fibrosis and CKD-MBD, while activin A might have detrimental effects. The unilateral ureter obstruction (UUO) model is used here to examine this concept by investigating early changes related to renal fibrosis in the obstructed kidney, untouched contralateral kidney, and vasculature which might be affected by secreted factors from the obstructed kidney, and comparing with unilateral nephrectomized controls (UNX). Obstructed kidneys showed early Klotho gene and protein depletion, whereas plasma Klotho increased in both UUO and UNX rats, indicating an altered metabolism of Klotho. Contralateral kidneys had no compensatory upregulation of Klotho and maintained normal expression of the examined fibrosis-related genes, as did remnant UNX kidneys. UUO caused upregulation of transforming growth factor-β and induction of periostin and activin A in obstructed kidneys without changes in the contralateral kidneys. Plasma activin A doubled in UUO rats after 10 days while no changes were seen in UNX rats, suggesting secretion of activin A from the obstructed kidney with potentially systemic effects on CKD-MBD. As such, increased aortic sclerostin was observed in UUO rats compared with UNX and normal controls. The present results are in line with the new paradigm and show very early vascular effects of unilateral kidney fibrosis, supporting the existence of a new kidney-vasculature axis.

Keywords: activin A, Klotho, renal fibrosis, unilateral ureter obstruction, Wnt

INTRODUCTION

Chronic kidney disease (CKD) is a state of progressive renal fibrosis (7). To be able to block advancing CKD, it is essential to understand the pathophysiology underlying this development.

The experimental unilateral ureter obstruction (UUO) model is an ideal renal injury model for studying the rapid development of renal fibrosis in a situation with only minor effect on the total glomerular filtration rate. It provides optimal conditions for examination of the early changes occurring in the untouched contralateral kidney, which might be the potential recipient for eventual outflow of hormones or factors released from the obstructed kidney (58). Optimally, the UUO model should be compared with a unilateral nephrectomized (UNX) model, as the remnant kidney in the UNX model is comparable to the contralateral kidney from the UUO model except the remnant UNX kidney lacks an obstructed (injured) counterpart. In the present study these two experimental models are used, and a systematic analysis of the time courses of hormonal changes in UUO is performed by measuring gene expression and plasma levels related to kidney injury. This is with focus on how a new concept of kidney disease might cause induction of factors in the injured kidney, which are released into the circulation and thereby potentially initiate and maintain renal fibrosis and development of CKD-mineral and bone disorder (CKD-MBD). As such, this new paradigm of etiology related to CKD-MBD has recently been proposed by Hruska et al. (16). The potential factors and hormones that may influence the progressive fibrogenetic changes evident in acute renal injury are examined. Thus this combination of models enables the evaluation of the early development of renal disease both in the obstructed kidney and potentially in the nonmanipulated contralateral kidney compared with UNX controls. Furthermore, it allows for comparison between the two models in regard to the early changes occurring in extrarenal tissue such as aorta.

The renal expression and plasma levels of the antifibrotic hormone Klotho are a major focus of the present investigation. Klotho was discovered in 1997 by Kuro-o et al. (28) and is primarily expressed in the kidneys, parathyroids, and choroid plexus (3, 13, 26, 28). Systemic Klotho depletion and whole nephron Klotho depletion result in an almost identical phenotype including accelerated aging with premature death, vascular calcification (VC), osteoporosis, and widespread organ atrophy as well as disturbed mineral metabolism (28, 32). Klotho overexpression in mice extends life span by up to 30% (30), and recent evidence demonstrates that Klotho has an antifibrotic effect on renal tissue (38). Thus Klotho can be regarded as a kidney-derived, kidney-protective hormone related to longevity (20, 31, 38). The Klotho gene (Kl) encodes a type I single-pass transmembrane protein (~135 kDa) consisting of five exons and two internal repeats, KL1 and KL2 (61). Transmembrane Klotho (tmKlotho) is subject to shedding of the extracellular domain near the cell surface by proteases a disintegrin and metalloproteinase (ADAM)-10/17 providing a circulating isoform of Klotho consisting of KL1 and KL2 (~130 kDa; 4). tmKlotho acts as an obligate coreceptor for the bone-derived hormone fibroblast growth factor 23 (FGF-23) inducing a high affinity of the FGF receptor (FGFR) to FGF-23 (10, 29, 41, 57, 59, 65). In proximal tubules, the Klotho-FGF-23-FGFR complex increases phosphaturia (11, 49, 51, 63) and decreases 1,25(OH)2 vitamin D metabolism, thereby indirectly decreasing intestinal phosphate absorption (50, 52). In this way, the complex decreases hyperphosphatemia and presumably also VC (21). The circulating or soluble Klotho (sKlotho) acts as an endocrine hormone, probably independent of FGF-23 (17). Generated from tmKlotho by shedding (4), sKlotho is present in blood (21, 25), urine (21), and cerebrospinal fluid (25). sKlotho is believed to exert pleiotropic actions including inhibition of fibrosis (6, 48, 54) and stem cell preservation (33) as well as cytoprotection through antiapoptosis (24, 53), antisenescence (24), and antioxidation (42). It has been shown that sKlotho binds to the type II transforming growth factor (TGF)-β receptor and thereby inhibits TGF-β1 signaling resulting in decreased fibrogenesis and decreased epithelial-to-mesenchymal transition (EMT; 6). Additionally, sKlotho is believed to attenuate fibrosis by inhibition of Wnt (portmanteau of wingless and integrated family) signaling through cell cycle arrest and Wnt-ligand binding (33, 48, 68).

TGF-β is a major contributor to the induction of renal fibrogenesis (40), exerting its action through apoptosis, increased synthesis, and decreased degradation of extracellular matrix as well as induction of EMT (8, 27, 40). Periostin is another profibrotic factor widely expressed in the body (5). Periostin is not only linked to bone homeostasis but also participates in fibrogenesis and EMT (5, 35, 44). Results from a recent study indicated that NF-κB might induce periostin expression in the kidney and thereby initiate renal damage (46). Renal fibrosis may lead to recapitulation of nephrogenesis with upregulation of Wnt signaling as in embryonic development of renal tissue (8, 55). Wnt signaling contributes to EMT, providing linkage to the TGF-β signaling pathway, although the precise mechanism remains poorly understood (40, 56, 66, 67).

Recently, sclerostin and activin A have been associated with renal fibrosis and CKD-MBD (16), where sclerostin functions as a tissue-specific Wnt inhibitor and is an osteocyte-specific protein related to bone mass and embryogenesis (43).

Activin A, a member of the TGF-β superfamily, is a circulating hormone as well as a renal developmental factor (36, 64). Activin A is formed from inhibin-βA homodimers (Inhba), and Agapova et al. have shown that both plasma levels and renal expression of activin A increase as a consequence of renal injury (1). Furthermore, they have demonstrated that a ligand trap blocking the activin A type IIA receptor (ActRIIA) inhibits EMT, VC, and renal fibrosis as well as upregulates renal Klotho in a kidney contralateral to an injured kidney (1).

Using the UUO and UNX models, the present study investigates the daily changes in Klotho plasma levels as well as renal gene and protein expressions. This enables us to explore whether Klotho is upregulated in the kidney contralateral to the obstructed kidney and whether plasma levels of Klotho are preserved in rats with only one functional kidney. Finally, the study examines whether renal factors related to kidney injury and CKD-MBD induce profibrotic changes in the contralateral kidney and in the vasculature.

METHODS

Animals.

Adult male Wistar rats (Taconic) were used in the study and housed in a temperature-controlled environment with a 12-h light-dark cycle. They had free access to water and standard diet containing 0.9% calcium, 0.7% phosphate, and 600 IU vitamin D3/kg food (Altromin Spezialfutter). The experimental studies were executed in accordance with the national guidelines for use of laboratory animals and approved by the Danish Animal Inspectorate (reference no. 2012-DY-2934-00023/BES).

Experimental models.

UUO was performed by abdominal incision followed by ligation of the left ureter. UNX was performed by posterior access and exposure of the left kidney through incision in the back. The renal vessels and the ureter were ligated, and the kidney was removed. Hypnorm/midazolam (Panum Institute, Copenhagen, Denmark) was used as anesthesia for the surgical procedures with postoperative subcutaneous administration of carprofen (Rimadyl; Pfizer, Copenhagen, Denmark) as pain relief for 3 days. At death, pentobarbital (Nycomed-DAK, Copenhagen, Denmark) was used as anesthesia for eye phlebotomy and kidney harvest just before euthanization.

Experimental design.

Littermates were randomized to UUO (n = 33) or UNX (n = 33) at arrival. Following surgical procedures, the UUO and UNX rats were divided into subgroups of six, each euthanized at day 1, 2, 3, 4, 7, or 10 (only 3 animals in the 7-day subgroups). The removed kidney from UNX rats was used as baseline. Blood samples were drawn from the tail vein at baseline and through retroorbital puncture at death. Kidney harvest from UUO rats (obstructed and contralateral) and UNX rats (remnant kidney) at death were performed through abdominal access. The obstructed kidneys from the UUO model were analyzed and compared with the contralateral kidneys from UUO rats and to the remnant and baseline kidneys from UNX rats. A group of six healthy littermates were used as controls for plasma Klotho analyses.

To establish any possible kidney injury-induced genetic changes in the vasculature, a group of UUO, UNX, and Sham rats (n = 5 in each group) were examined after 15 days. Blood was drawn at baseline and death. The thoracic aorta was harvested just before euthanasia. Surgical procedures, phlebotomy, anesthesia, and pain relief were performed as described above.

Biochemistry.

Blood samples were centrifuged immediately after collection, and plasma was separated and stored at −80°C until analysis. Creatinine, urea, total calcium, and phosphate were measured by Vitros 250 (Ortho Clinical Diagnostics). Parathyroid hormone (PTH) levels were analyzed using the rat bioactive PTH ELISA assay (Immutopics) (22), and FGF-23 levels were analyzed by the intact FGF-23 ELISA assay (Kainos Laboratories) (12). Sclerostin and activin A plasma levels were measured by sandwich ELISA (R&D Systems). Plasma Klotho levels were kindly analyzed at the George M. O’Brien Kidney Research Core Center, University of Texas Southwestern Medical Center (Dallas, TX) by an immunoprecipitation-immunoblot assay using a synthetic Klotho antibody (2). The Klotho control samples in the present study were measured in both EDTA and heparinized plasma from the same animals with practically identical results, indicating a solid compliance of the assay used.

Quantitative PCR.

The harvested kidneys and aortas were immediately frozen in liquid nitrogen and subsequent stored at −80°C until analysis. Samples were pulverized by mortar and bead beater homogenizer. E.Z.N.A. RNA isolation kit (Omega Bio-Tek) was used for RNA extraction, and synthesis of cDNA was performed using SuperScript III (Invitrogen). A Roche LightCycler 480 (Roche) was used with a temperature profile of 94°C for 2 min, 45 cycles of 94°C for 30 s, 59°C for 45 s, and 72°C for 90 s. The mRNA levels were normalized to the mean of reference genes with respect to reference gene stability (60). Primers are presented in Table 1.

Table 1.

Primer sequences

Gene Common Name Primer Sequence
Bmp7 Bone morphogenetic protein-7 (BMP7) F: CGGGAGCGGTTTGACAACGAGA
R: CTCAGAAGCCCAGATGGTACGG
Inhba Inhibin-βA (subunit of activin A) F: AGTGGGGGAAAACGGGTATGTGGA
R: CCTGTTGGCCTTGGGGACTTTCA
Kl Klotho/α-Klotho F: CGTGAATGAGGCTCTGAAAGC
R: GAGCGGTCACTAAGCGAATACG
Postn Periostin F: GAACCCGGAGTCACCAACATC
R: TGCTGCCACGAACGAACTTA
Sost Sclerostin F: GCCTCCTCAGGAACTAGAGAAC
R: TACTCGGACACGTCTTTGGTG
TGFb1 Transforming growth factor-β1 (TGF-β1) F: TCCACGTGGAAATCAATGGGATCA
R: CAGTTCTTCTCTGTGGAGCTGAA
Open in a new tab

F, forward; R, reverse.

Western blotting.

Protein extraction was done using T-PER (Thermo Scientific). Twenty micrograms of protein were loaded on stain-free precast Bio-Rad 4–15% gels, transferred to nitrocellulose Bio-Rad membrane, and blocked in 5% BSA PBS-Tween 20 (PBST) 0.05% (Klotho) or 5% milk Tris-buffered saline-Tween 20 (TBST) 0.1% (GAPDH). A primary Klotho antibody (AB154163; Abcam) was diluted in 3% BSA PBS(-T) 1:1,000. A GAPDH antibody (MAD374; Merck Millipore) was diluted in 5% milk TBST 0.1% 1:1,000,000. Secondary antibodies were anti-rabbit and anti-mouse (P0448 and P0447; Dako). Recombinant Klotho (cat. no. 1819-Kl; R&D Systems) was used as a positive control. Quantification was performed and calculated individually for each blot by ImageJ software. For the purpose of presentation, the quantifications are subsequently merged into one figure with baseline normalized to 1 (Fig. 1F).

Fig. 1.

Fig. 1.

Open in a new tab

Plasma Klotho in unilateral ureter obstruction (UUO), unilateral nephrectomized (UNX), and healthy control rats and kidney Klotho mRNA and protein expression in obstructed and contralateral kidneys from UUO and UNX rats. A: plasma Klotho (p-Klotho). Rats with only one functioning kidney demonstrated an increase in plasma Klotho from day 1 and forward, as all UUO and UNX rats had elevated plasma Klotho levels, P < 0.05 compared with controls. No difference was observed between UUO and UNX rats at any time points; n = 6 in all groups. B–F: Klotho protein expression. Representative Western blot from baseline kidneys compared with obstructed kidneys on days 1 and 3 (B), obstructed kidney on days 4 and 10 (C), contralateral kidney on days 1 and 3 (D), and contralateral kidney on days 4 and 10 (E). Each lane represents individual rats. Protein and molecular size markers are presented at each blot. Lane 4 in B is excluded because of a lane-specific error; rKl, recombinant Klotho; M, protein molecular weight marker. F: quantification of all Western blots depicted as Klotho in relation to GAPDH with baseline normalized to 1; n = 6 in all subgroups. Renal Klotho protein expression decreases continuously over time in obstructed kidneys with an early onset already on day 1 (P < 0.05) and a subsequent more pronounced decline (P < 0.0001). In the contralateral kidneys no difference was found on days 1, 3, 4, and 10. G: Klotho (Kl) mRNA expression. Unilateral ureter obstruction resulted in a rapid and gradual decline in Klotho gene expression in the obstructed kidney with onset already on day 1 (P < 0.0001) and nadir on day 10 (P < 0.0001). No compensatory upregulation was present in the contralateral kidney. The contralateral kidney showed no change in renal gene expression of Klotho at any time points, and no difference could be observed compared with remnant and baseline UNX kidneys; n = 30 in the baseline (Base) group, and n = 6 in all UNX and UUO groups. Data are presented as means ± SE. Significantly different from baseline: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Statistical analyses.

Data analysis was performed using GraphPad Prism 7 software. Data are presented as means ± SE. Student’s t-test was used for data with normal distribution, and a Mann-Whitney U-test was used for nonparametric data. P < 0.05 was considered significant.

RESULTS

Circulating Klotho is maintained in unilateral obstructive nephropathy despite no upregulation of Klotho biosynthesis in the contralateral kidney.

Because of the long half-life of Klotho, from 7 h in normal rats to 25 h in anephric rats (20), plasma Klotho was followed by daily measurements at baseline and on days 1, 2, 3, 4, and 10 in the presented models. Despite significant reduction in functioning kidney mass, plasma Klotho levels increased in both UNX and UUO rats (Fig. 1A) from 25.2 ± 4.8 at baseline to 48.5 ± 1.8 (day 1) and 60.3 ± 7.4 (day 10) in UNX rats and to 50.3 ± 6.3 (day 1) and 43.2 ± 3.3 (day 10) in UUO rats (all P < 0.05). There were no differences between UUO and UNX regardless of the number of days with intervention. Therefore, it was examined whether UUO or UNX resulted in a compensatory upregulation of Klotho (Kl) mRNA and protein in the contralateral untouched kidney of the UUO model or in the remnant kidney of the UNX model.

In the obstructed kidney, Klotho mRNA was downregulated already on day 1 with a gene expression of 0.74 ± 0.06 vs. 1.41 ± 0.07 at baseline (P < 0.0001; Fig. 1G) and continued to decline throughout the study with a nadir of 0.23 ± 0.02 after 10 days (P < 0.0001). No compensatory upregulation of Klotho mRNA was found in the contralateral kidney, which had gene expression of Klotho similar to that of the healthy baseline kidney. Neither did a reduction of kidney mass by 50% in the UNX model show a compensatory upregulation of Klotho gene expression; the expression was similar to that of healthy kidneys at baseline. This expression pattern was maintained for 10 days.

Klotho protein expression in the kidney exhibited a similar pattern to its gene expression, with Klotho protein declining significantly in the obstructed kidney from day 1 and forward (P < 0.05; Fig. 1, B, C, and F). The decrease was even more pronounced on day 3 (P < 0.0001) and further on days 4 and 10 (P < 0.0001). In the contralateral kidney of the UUO model, no significant differences in kidney Klotho protein expression were found compared with baseline when measured on days 1, 3, 4, and 10 (Fig. 1, D–F). Thus Klotho declined in the obstructed kidney without a compensatory upregulation in the contralateral kidney. The increased plasma Klotho levels in UUO and UNX models suggest an alteration in the metabolism of Klotho potentially due to decreased urinary excretion.

TGF-β, periostin, and bone morphogenetic protein-7 in the unilateral obstructive nephropathy model.

The UUO model is a classic model of renal fibrosis. In the present investigation the development of fibrosis was confirmed by measuring TGF-β (Tgfb1) and periostin (Postn) gene expressions in the obstructed kidney.

A rapid upregulation of TGF-β mRNA was demonstrated in the obstructed kidney of the UUO model (Fig. 2A), and the expression of TGF-β gene increased from 0.64 ± 0.03 at baseline to 0.87 ± 0.07 on day 1 and continued to rise to 1.61 ± 0.12 on day 10 (P < 0.001). The gene expression of TGF-β in the contralateral kidney of UUO rats and in the remnant kidney of UNX rats was similar to baseline.

Fig. 2.

Fig. 2.

Open in a new tab

Transforming growth factor (TGF)-β, periostin, and bone morphogenetic protein-7 (BMP7) mRNA expression in obstructed and contralateral kidneys from unilateral ureter obstruction (UUO) rats, remnant kidneys from unilateral nephrectomized (UNX) rats, and normal baseline kidneys. A: TGF-β (Tgfb1) mRNA expression increased in the obstructed kidney on day 1 (P < 0.001) and continued to rise throughout the study with a peak on day 10 (P < 0.0001). No significant differences were present in contralateral kidneys, which had expression of TGF-β similar to that of remnant and baseline kidneys. B: periostin (Postn) was undetectable in healthy baseline kidneys. However, unilateral ureter obstruction caused an extreme induction of renal periostin mRNA expression appearing on day 1 (P < 0.0001), peaking on day 2 (P < 0.0001) and subsequently declining to levels still substantially higher than baseline (P < 0.0001). Contralateral kidneys from UUO rats and remnant kidneys from UNX rats were untraceable, similar to baseline. C: the antifibrotic BMP7 (Bmp7) mRNA expression was downregulated in obstructed kidneys from day 1 (P < 0.001) and forward (P < 0.05) stabilizing around half the expression level of baseline kidneys. Contralateral kidneys maintained its expression of BMP7 within normal range, similar to remnant UNX and baseline kidneys; n = 30 in the baseline (Base) group, and n = 6 in all other subgroups. Data are presented as means ± SE. Significantly different from baseline: *P < 0.05, ***P < 0.001, ****P < 0.0001.

Periostin was not detected in healthy baseline kidneys. However, in the obstructed kidney, induction of the profibrotic periostin mRNA (0.76 ± 0.07) was seen already on day 1 (P < 0.0001), rising to 4.32 ± 1.73 on day 2, and remained elevated until day 10 (P < 0.0001; Fig. 2B). The gene expression of periostin was undetectable in the contralateral kidney of UUO rats similar to the remnant kidney of UNX rats, indicating the absence of fibrogenesis.

Bone morphogenetic protein-7 (BMP7) is a kidney-derived antifibrotic factor, and as with Klotho, a kidney-protective effect has been shown by administration of exogenous BMP7 (15). The gene expression of BMP7 (Bmp7) was rapidly downregulated in the obstructed kidney (Fig. 2C) from 0.98 ± 0.04 at baseline to 0.71 ± 0.08 at day 1 (P < 0.01) and remained subsequently downregulated (P < 0.0001). No differences were found between baseline, UNX, and the contralateral kidney. Similar to the genetic pattern of Klotho, there was no compensatory upregulation of BMP7 expression in the contralateral kidney. These results demonstrate that the kidney contralateral to the obstructed kidney maintains its gene expression patterns within the normal range despite a significant shift in profibrotic direction in the obstructed kidney.

Activin A is induced in the obstructed kidney and plasma levels are increased in the UUO model.

Activin A has been proposed to be a kidney-derived factor that is induced in the injured kidney with systemic effects on vasculature and bone (16). Plasma levels of activin A were increased in UUO rats after 10 days of obstruction [217 ± 14 pg/ml at baseline vs. 413 ± 44 pg/ml at day 10 (P < 0.0001); Fig. 3A]. In healthy baseline kidneys, activin A (Inhba) mRNA was undetectable as previously demonstrated by others (16). Interestingly, no expression of activin A was found in the hyperplastic remnant kidney of the UNX model or in the contralateral kidney of the UUO model (Fig. 3B). However, in the obstructed kidney an increase was found already on day 1 (1.19 ± 0.08, P < 0.0001), which persisted until the last measurement on day 10 (3.22 ± 0.56, P < 0.0001).

Fig. 3.

Fig. 3.

Open in a new tab

Plasma activin A levels in normal, unilateral nephrectomized (UNX), and unilateral ureter obstruction (UUO) rats and kidney activin A mRNA expression in obstructed and contralateral kidneys from UUO rats, remnant kidneys from UNX rats, and baseline normal kidneys. A: plasma activin A (p-activin). After 10 days of obstruction, UUO rats had an almost doubling of activin A plasma levels compared with baseline (P < 0.0001). No increase was present on days 1 and 3 in UUO rats, and UNX rats did not show elevation in plasma activin A at any time points; n = 4–7. B: activin A (Inhba) mRNA expression. Unilateral ureter obstruction resulted in a clear induction of renal activin A mRNA on day 1 (P < 0.0001), which increased continuously with a peak on day 10 (P < 0.0001). Simultaneously, activin A was untraceable in contralateral, remnant, and baseline kidneys; n = 4–6. Data are presented as means ± SE. Significantly different from baseline (Base): ****P < 0.0001.

Gene expression of sclerostin is increased in the aorta in the UUO model, despite near-normal kidney function.

The Wnt inhibitor sclerostin is another factor involved in the progression of CKD-MBD. Plasma sclerostin was elevated in both UUO and UNX rats already on day 1 (P < 0.05) with no difference between the groups (Fig. 4A). However, there was no renal expression of sclerostin (Sost) mRNA in any of the groups, despite induction of kidney injury (data not shown).

Fig. 4.

Fig. 4.

Open in a new tab

Increased aortic sclerostin mRNA expression in unilateral ureter obstruction (UUO) rats and plasma sclerostin levels in normal, unilateral nephrectomized (UNX), and UUO rats. A: plasma sclerostin (p-sclerostin) increased in both UUO and UNX rats to similar levels (P < 0.05). No differences were present between UUO and UNX at any time points; n = 4–6. B: sclerostin (Sost) mRNA expression in thoracic aorta. After 15 days of unilateral ureter obstruction, sclerostin mRNA expression increased markedly compared with both UNX and Sham rats (P < 0.01). There were no differences in sclerostin expression between UNX and Sham rats; n = 5. Data are presented as means ± SE. Significantly different from baseline (Base): *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

With the RNA-sequencing (RNA-seq) method, our laboratory has previously demonstrated that chronic uremia induced a large number of highly significant changes in the gene expression of calcified uremic aortas, including substantial upregulated sclerostin (Sost) expression (47). Therefore, the present investigation examined whether such an upregulation occurred at day 15. The gene expression patterns were examined in the aorta after 15 days of UUO. Sclerostin (Sost) mRNA was increased in the aorta of UUO rats compared with UNX and Sham (UUO, 1.53 ± 0.35; UNX, 0.27 ± 0.07; Sham, 0.28 ± 0.07; P < 0.01; Fig. 4B). Gene expression of TGF-β was not significantly changed in the aorta [UUO, 1.14 ± 0.14; UNX, 0.92 ± 0.11; Sham, 0.53 ± 0.27; not significant (NS); Fig. 5A], and neither was the aortic gene expression of periostin after 15 days of UUO (UUO, 1.22 ± 0.40; UNX, 1.04 ± 0.29; Sham, 0.81 ± 0.16; NS; Fig. 5B). The expression of activin A mRNA in the aorta was similar in all groups (UUO, 1.15 ± 0.16; UNX, 1.14 ± 0.16; Sham, 1.13 ± 0.11; NS; Fig. 5C).

Fig. 5.

Fig. 5.

Open in a new tab

Transforming growth factor (TGF)-β, periostin, and activin A mRNA expression in thoracic aorta from unilateral ureter obstruction (UUO), unilateral nephrectomized (UNX), and Sham rats. A: TGF-β (Tgfb1) mRNA expression in thoracic aorta from UUO, UNX, and Sham rats after 15 days. Aortic TGF-β mRNA did not increase significantly in either UUO or UNX rats although the results suggest a tendency toward a rise in both groups. B: periostin (Postn) mRNA expression in thoracic aorta from UUO, UNX, and Sham rats after 15 days. No changes in aortic periostin gene expression were present between UUO, UNX, and Sham rats. C: activin A (Inhba) mRNA expression in thoracic aorta from UUO, UNX, and Sham rats after 15 days. Similar levels of activin A gene expression were present in all groups; n = 4–5 in all groups. Data are presented as means ± SE.

Biochemical characteristics.

Both UUO and UNX rats had a similar modest decrease in kidney function, as shown by increased creatinine and urea levels (Table 2). Plasma phosphate, calcium, and PTH levels were stable in all groups throughout the study.

Table 2.

Biochemical characteristics

Unilateral Nephrectomy
 Unilateral Ureter Obstruction
Baseline Day 1 Day 2 Day 3 Day 4 Day 10 Day 1 Day 2 Day 3 Day 4 Day 10
Creatinine, μM 24 ± 0.2 34 ± 2.3* 33 ± 2,5* 34 ± 1.5* 33 ± 2.0* 35 ± 1.5* 45 ± 1.5* 36 ± 1.6* 34 ± 0.8* 35 ± 1.4* 36 ± 1.8*
Urea, mM 6.5 ± 0.1 8.9 ± 0.3* 8.2 ± 0.5 8.8 ± 0.4* 8.2 ± 0.6 9.0 ± 0.7* 7.7 ± 0.3 7.8 ± 0.7 7.6 ± 0.3 7.7 ± 0.7 8.0 ± 0.3
Phosphate, mM 2.66 ± 0.06 3.09 ± 0.38 2.65 ± 0.12 2.47 ± 0.08 2.42 ± 0.08 2.49 ± 0.17 2.80 ± 0.12 2.47 ± 0.12 2.40 ± 0.06 2.30 ± 0.05 2.41 ± 0.14
Total calcium, mM 2.55 ± 0.01 2.46 ± 0.03 2.53 ± 0.05 2.53 ± 0.04 2.55 ± 0.02 2.18 ± 0.14* 2,57 ± 0.06 2.45 ± 0.03 2.57 ± 0.06 2.54 ± 0.06 2.54 ± 0.06
PTH, pg/ml 197 ± 12 174 ± 77 NM 301 ± 84 NM 318 ± 82 313 ± 107 NM 271 ± 75 NM 257 ± 40
n 30 6 6 6 6 6 6 6 6 6 6
Open in a new tab

Values are means ± SE. PTH, parathyroid hormone; NM, not measured.

*

P < 0.05 compared with baseline.

DISCUSSION

The present investigation demonstrated a rapid decline of Klotho gene and protein expression in the obstructed kidney of the UUO model without a compensatory upregulation in the contralateral kidney.

Plasma levels of Klotho were increased in rats with only one functioning kidney. An interesting and clinically relevant pathophysiological question is how early renal changes occur after kidney injury or ureter obstruction, as kidney injury may result in induction and release of factors that have systemic effects and may initiate CKD-MBD. The experimental model of UUO enables examination of the consequences of renal fibrosis in a situation that only mildly affects the total glomerular filtration rate. It also provides optimal conditions for the study of the early hormonal changes occurring in the untouched contralateral kidney that potentially might be affected by factors released from the obstructed kidney. Thus comparing the UUO and UNX models provides an opportunity to evaluate the very early development of renal disease in the obstructed kidney and potentially in the nonmanipulated contralateral kidney. The combined measurement of changes in the vascular gene expressions provides additional knowledge about potential systemic effects secondary to kidney fibrosis.

TGF-β and Wnt signaling are examples of important regulators of renal fibrogenesis (40, 55). Klotho may interact with these signaling pathways and potentially act as an important antifibrotic hormone (19). We have previously shown that renal Klotho mRNA is unaltered for the first 6 h after introduction of UUO (34), and therefore the present investigation was initiated on day 1, demonstrating that renal injury by UUO induced a rapid shift in the pattern of renal gene expressions already within the first day. Both obstructed and contralateral kidneys from UUO rats were examined, providing an opportunity to evaluate possible compensatory mechanisms in the untouched contralateral kidney. The time course of gene expression pattern in kidneys subjected to UUO was systematically examined with special attention to changes in Klotho. The results showed a rapid and significant downregulation of Klotho mRNA and protein in the obstructed kidney already on day 1, which is in line with previous studies showing downregulation of Klotho on day 3 after ureter obstruction (6). Interestingly, Klotho mRNA and protein expression was maintained within normal levels in the kidney contralateral to the obstructed kidney throughout the study.

A rapid and sustained upregulation of TGF-β was found in parallel with induction of periostin in the obstructed kidney. The rapid upregulation of these two profibrotic genes demonstrates that fibrogenesis with TGF-β and periostin is acting concurrently and might have direct interactions as previously proposed (35). Simultaneously with the profibrotic shift in gene expression patterns, the expression of the antifibrotic factors BMP7 and Klotho was downregulated in the obstructed kidney. Therefore the question was whether the contralateral kidney might induce a compensatory upregulation of kidney-protective factors such as Klotho and BMP7. As a morphogenetic protein, BMP7 is essential for renal development. In different models of renal injury a protective role of BMP7 in renal fibrosis and inflammation has been demonstrated by administration of exogenous protein or overexpression of BMP7 (15, 39). However, the results of the present study showed that the gene expression in the contralateral kidney was maintained within normal levels similar to healthy baseline kidney.

Hruska et al. (16) have suggested a new paradigm of etiology related to CKD-MBD. Kidney injury induces production of factors, reactivated by attempted renal repair, that are released into the circulation and drive the induction of progressive renal fibrosis and development of CKD-MBD (16). The Wnt inhibitors sclerostin and Dickkopf-related protein-1 (DKK-1) have been proposed as such factors (9). No gene expression of sclerostin was detectable in any kidney specimens from the present study. Despite that, elevated plasma sclerostin levels were measured in both UNX and UUO rats. Sclerostin gene expression was induced in the aorta making the vasculature a possible contributor to the elevated plasma sclerostin levels. The early induction of aortic sclerostin mRNA in UUO together with an early increase in plasma sclerostin in UUO could theoretically represent cross talk between kidneys and vasculature. In this respect we have previously demonstrated a dramatic increase in sclerostin expression in the calcified aorta of long-term uremic 5/6 nephrectomized rats. Sclerostin was in the top 10 of the most upregulated genes identified by high-throughput RNA-seq of transcriptomes in the uremic aorta (47). The present data demonstrate that the upregulation of sclerostin in the aorta is a very early event occurring secondary to renal fibrosis, even in the absence of uremia. This finding supports the new paradigm proposed by Hruska et al. (16).

Activin A is linked to both the TGF-β and the Wnt signaling system and has been proposed as a contributor to renal fibrosis and VC (1, 62). We found clear evidence of activin A induction in the obstructed kidney together with a twofold higher plasma level after 10 days of obstruction. Interestingly, activin A was undetectable in the contralateral kidney as well as in UNX remnant and baseline kidneys. Plasma levels did not increase in UNX rats compared with baseline, and activin A mRNA expression was maintained at normal levels in the aorta. This indicates that kidney injury due to ureter obstruction induces production of activin A in the obstructed kidney with subsequent secretion to the circulation. These results support recently published data, which found that increased plasma activin A is an early event in 5/6 nephrectomized uremic rats on a high-phosphate diet (14). Furthermore, it has been shown that a ligand trap blocking the function of activin A might ameliorate renal fibrosis, EMT, innate immune response, and VC (1, 45). Overall, this suggests that activin A might participate in the early pathophysiological changes occurring in response to kidney injury.

It is remarkable how the contralateral kidney is able to maintain normal expression of genes related to fibrogenesis. We hypothesize that the sustained expression of kidney Klotho may be the primary kidney-protective factor. Exploration into the interaction between Klotho and activin A may elucidate these promising effects of Klotho on CKD and mineral metabolism.

UUO and CKD are characterized by progressive renal fibrosis (58). CKD is considered a state of renal and plasma Klotho deficiency (2, 38), as to be expected as Klotho primarily derives from kidneys (20, 28, 31). Plasma Klotho is believed to decline with decreasing renal function (2) although it remains controversial whether plasma Klotho is an early biomarker of renal disease (18). This study demonstrates a rapid onset of renal Klotho deficiency in obstructed kidneys already within a day. In spite of Klotho deficiency in obstructed kidneys and unaltered Klotho expression in contralateral UUO and remnant UNX kidneys, plasma Klotho increased in both UUO and UNX rats compared with healthy controls. The increased plasma Klotho levels in UUO and UNX models therefore suggest an alteration in the metabolism of Klotho due to decreased urinary excretion, as a significant transepithelial tubular transport and urinary excretion of Klotho has previously been documented (20). Another possible explanation could be increased cleavage of tmKlotho. However, we did not find any upregulation in renal Adam17 mRNA (data not shown), as would have been expected in that case. Apart from the potential amelioration of renal fibrosis, sKlotho possesses a number of pleiotropic functions (17). Reduced sKlotho is believed to be of significant importance for the development of VC, and genetic Klotho deficiency causes VC in both mice (28) and man (23), though the precise mechanisms remain unclear and hypomorphic Klotho mice have increased plasma levels of calcitriol and phosphate. Conflicting results have been published on whether Klotho is expressed in the vasculature (31, 37, 47). We have convincingly demonstrated that the Klotho gene is not expressed in aorta from either normal or uremic rats, using the optimal method of RNA-seq analysis (47). Thus the effect of Klotho in VC is not mediated by tmKlotho but might be attributed to sKlotho, potentially through interaction with FGF-23. The genetic pattern in aortas of the present study differs to some extent from the findings with RNA-seq in uremic rats on high-phosphate diet (47). Sclerostin was upregulated in both studies, but the gene expressions of periostin, TGF-β, and activin A differed. The discrepancies could be attributed to the time course of the present study but could also be due to sKlotho acting on the vasculature.

In conclusion, kidney injury by UUO reflects a condition of early Klotho deficiency in the obstructed kidney already on day 1. No compensatory upregulation was present in the contralateral kidney, which maintained its gene and protein expression patterns within the normal range. However, both UUO and UNX rats showed a significant increase in plasma Klotho levels, indicating an altered metabolism of Klotho, presumably due to a decreased urinary excretion. The obstructed kidney showed a profibrotic shift in gene expressions although the contralateral kidney had a sustained pattern of expression of fibrosis-related genes. The contralateral kidney does not exhibit an increase in fibrosis-related genes at the times studied. The mechanism is not clear but may possibly be related to the preserved renal Klotho expression. The present investigation showed evidence of renal induction and secretion of activin A from the obstructed kidney. In addition, this study supports the new concept proposing that the induction of attempted repair processes in the injured kidney leads to release of circulating factors affecting the kidney-vasculature axis, as upregulation of aortic sclerostin became evident already 15 days after introduction of UUO despite near-normal kidney function in the present model.

GRANTS

This study was supported by the Kirsten and Freddy Johansen Foundation. The O’Brien Kidney Research Core Center, University of Texas Southwestern Medical Center, Dallas, TX, is supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant P30-DK-079328.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

A.N., M.L.M., E.G., K.O., and E.L. conceived and designed research; A.N., M.L.M., E.G., J.H.-B., M.M., K.O., and E.L. performed experiments; A.N., M.L.M., E.G., J.H.-B., M.M., K.O., and E.L. analyzed data; A.N., M.L.M., E.G., J.H.-B., M.M., K.O., and E.L. interpreted results of experiments; A.N., M.M., K.O., and E.L. prepared figures; A.N. drafted manuscript; A.N., M.L.M., E.G., K.O., and E.L. edited and revised manuscript; A.N., M.L.M., E.G., J.H.-B., M.M., K.O., and E.L. approved final version of manuscript.

ACKNOWLEDGMENTS

We thank technician Nina Sejthen for excellent laboratory expertise and support. We are most grateful and acknowledge the O’Brien Kidney Research Core Center, University of Texas Southwestern Medical Center (Dallas, TX) for measuring plasma Klotho.

REFERENCES

  • 1.Agapova OA, Fang Y, Sugatani T, Seifert ME, Hruska KA. Ligand trap for the activin type IIA receptor protects against vascular disease and renal fibrosis in mice with chronic kidney disease. Kidney Int 89: 1231–1243, 2016. doi: 10.1016/j.kint.2016.02.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Barker SL, Pastor J, Carranza D, Quiñones H, Griffith C, Goetz R, Mohammadi M, Ye J, Zhang J, Hu MC, Kuro-o M, Moe OW, Sidhu SS. The demonstration of αKlotho deficiency in human chronic kidney disease with a novel synthetic antibody. Nephrol Dial Transplant 30: 223–233, 2015. doi: 10.1093/ndt/gfu291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ben-Dov IZ, Galitzer H, Lavi-Moshayoff V, Goetz R, Kuro-o M, Mohammadi M, Sirkis R, Naveh-Many T, Silver J. The parathyroid is a target organ for FGF23 in rats. J Clin Invest 117: 4003–4008, 2007. doi: 10.1172/JCI32409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bloch L, Sineshchekova O, Reichenbach D, Reiss K, Saftig P, Kuro-o M, Kaether C. Klotho is a substrate for α-, β- and γ-secretase. FEBS Lett 583: 3221–3224, 2009. doi: 10.1016/j.febslet.2009.09.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bonnet N, Garnero P, Ferrari S. Periostin action in bone. Mol Cell Endocrinol 432: 75–82, 2016. doi: 10.1016/j.mce.2015.12.014. [DOI] [PubMed] [Google Scholar]
  • 6.Doi S, Zou Y, Togao O, Pastor JV, John GB, Wang L, Shiizaki K, Gotschall R, Schiavi S, Yorioka N, Takahashi M, Boothman DA, Kuro-o M. Klotho inhibits transforming growth factor-β1 (TGF-β1) signaling and suppresses renal fibrosis and cancer metastasis in mice. J Biol Chem 286: 8655–8665, 2011. doi: 10.1074/jbc.M110.174037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Eddy AA. Overview of the cellular and molecular basis of kidney fibrosis. Kidney Int Suppl (2011) 4: 2–8, 2014. doi: 10.1038/kisup.2014.2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Edeling M, Ragi G, Huang S, Pavenstädt H, Susztak K. Developmental signalling pathways in renal fibrosis: the roles of Notch, Wnt and Hedgehog. Nat Rev Nephrol 12: 426–439, 2016. doi: 10.1038/nrneph.2016.54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Evenepoel P, D’Haese P, Brandenburg V. Sclerostin and DKK1: new players in renal bone and vascular disease. Kidney Int 88: 235–240, 2015. doi: 10.1038/ki.2015.156. [DOI] [PubMed] [Google Scholar]
  • 10.Gattineni J, Alphonse P, Zhang Q, Mathews N, Bates CM, Baum M. Regulation of renal phosphate transport by FGF23 is mediated by FGFR1 and FGFR4. Am J Physiol Renal Physiol 306: F351–F358, 2014. doi: 10.1152/ajprenal.00232.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gattineni J, Bates C, Twombley K, Dwarakanath V, Robinson ML, Goetz R, Mohammadi M, Baum M. FGF23 decreases renal NaPi-2a and NaPi-2c expression and induces hypophosphatemia in vivo predominantly via FGF receptor 1. Am J Physiol Renal Physiol 297: F282–F291, 2009. doi: 10.1152/ajprenal.90742.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Gravesen E, Mace ML, Hofman-Bang J, Olgaard K, Lewin E. Circulating FGF23 levels in response to acute changes in plasma Ca(2+). Calcif Tissue Int 95: 46–53, 2014. doi: 10.1007/s00223-014-9861-8. [DOI] [PubMed] [Google Scholar]
  • 13.Hofman-Bang J, Martuseviciene G, Santini MA, Olgaard K, Lewin E. Increased parathyroid expression of klotho in uremic rats. Kidney Int 78: 1119–1127, 2010. doi: 10.1038/ki.2010.215. [DOI] [PubMed] [Google Scholar]
  • 14.Hortells L, Sosa C, Guillén N, Lucea S, Millán Á, Sorribas V. Identifying early pathogenic events during vascular calcification in uremic rats. Kidney Int 92: 1384–1394, 2017. doi: 10.1016/j.kint.2017.06.019. [DOI] [PubMed] [Google Scholar]
  • 15.Hruska KA, Guo G, Wozniak M, Martin D, Miller S, Liapis H, Loveday K, Klahr S, Sampath TK, Morrissey J. Osteogenic protein-1 prevents renal fibrogenesis associated with ureteral obstruction. Am J Physiol Renal Physiol 279: F130–F143, 2000. doi: 10.1152/ajprenal.2000.279.1.F130. [DOI] [PubMed] [Google Scholar]
  • 16.Hruska KA, Sugatani T, Agapova O, Fang Y. The chronic kidney disease–mineral bone disorder (CKD-MBD): advances in pathophysiology. Bone 100: 80–86, 2017. doi: 10.1016/j.bone.2017.01.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Hu MC, Kuro-o M, Moe OW. Renal and extrarenal actions of Klotho. Semin Nephrol 33: 118–129, 2013. doi: 10.1016/j.semnephrol.2012.12.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Hu MC, Moe OW. Klotho as a potential biomarker and therapy for acute kidney injury. Nat Rev Nephrol 8: 423–429, 2012. doi: 10.1038/nrneph.2012.92. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hu MC, Shi M, Gillings N, Flores B, Takahashi M, Kuro-o M, Moe OW. Recombinant α-Klotho may be prophylactic and therapeutic for acute to chronic kidney disease progression and uremic cardiomyopathy. Kidney Int 91: 1104–1114, 2017. doi: 10.1016/j.kint.2016.10.034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hu MC, Shi M, Zhang J, Addo T, Cho HJ, Barker SL, Ravikumar P, Gillings N, Bian A, Sidhu SS, Kuro-o M, Moe OW. Renal production, uptake, and handling of circulating αKlotho. J Am Soc Nephrol 27: 79–90, 2016. doi: 10.1681/ASN.2014101030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Hu MC, Shi M, Zhang J, Quiñones H, Griffith C, Kuro-o M, Moe OW. Klotho deficiency causes vascular calcification in chronic kidney disease. J Am Soc Nephrol 22: 124–136, 2011. doi: 10.1681/ASN.2009121311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Huan J, Olgaard K, Nielsen LB, Lewin E. Parathyroid hormone 7-84 induces hypocalcemia and inhibits the parathyroid hormone 1-84 secretory response to hypocalcemia in rats with intact parathyroid glands. J Am Soc Nephrol 17: 1923–1930, 2006. doi: 10.1681/ASN.2005101136. [DOI] [PubMed] [Google Scholar]
  • 23.Ichikawa S, Imel EA, Kreiter ML, Yu X, Mackenzie DS, Sorenson AH, Goetz R, Mohammadi M, White KE, Econs MJ. A homozygous missense mutation in human KLOTHO causes severe tumoral calcinosis. J Clin Invest 117: 2684–2691, 2007. doi: 10.1172/JCI31330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Ikushima M, Rakugi H, Ishikawa K, Maekawa Y, Yamamoto K, Ohta J, Chihara Y, Kida I, Ogihara T. Anti-apoptotic and anti-senescence effects of Klotho on vascular endothelial cells. Biochem Biophys Res Commun 339: 827–832, 2006. doi: 10.1016/j.bbrc.2005.11.094. [DOI] [PubMed] [Google Scholar]
  • 25.Imura A, Iwano A, Tohyama O, Tsuji Y, Nozaki K, Hashimoto N, Fujimori T, Nabeshima Y. Secreted Klotho protein in sera and CSF: implication for post-translational cleavage in release of Klotho protein from cell membrane. FEBS Lett 565: 143–147, 2004. doi: 10.1016/j.febslet.2004.03.090. [DOI] [PubMed] [Google Scholar]
  • 26.Imura A, Tsuji Y, Murata M, Maeda R, Kubota K, Iwano A, Obuse C, Togashi K, Tominaga M, Kita N, Tomiyama K, Iijima J, Nabeshima Y, Fujioka M, Asato R, Tanaka S, Kojima K, Ito J, Nozaki K, Hashimoto N, Ito T, Nishio T, Uchiyama T, Fujimori T, Nabeshima Y. α-Klotho as a regulator of calcium homeostasis. Science 316: 1615–1618, 2007. doi: 10.1126/science.1135901. [DOI] [PubMed] [Google Scholar]
  • 27.Kalluri R, Neilson EG. Epithelial-mesenchymal transition and its implications for fibrosis. J Clin Invest 112: 1776–1784, 2003. doi: 10.1172/JCI200320530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kuro-o M, Matsumura Y, Aizawa H, Kawaguchi H, Suga T, Utsugi T, Ohyama Y, Kurabayashi M, Kaname T, Kume E, Iwasaki H, Iida A, Shiraki-Iida T, Nishikawa S, Nagai R, Nabeshima YI. Mutation of the mouse klotho gene leads to a syndrome resembling ageing. Nature 390: 45–51, 1997. doi: 10.1038/36285. [DOI] [PubMed] [Google Scholar]
  • 29.Kurosu H, Ogawa Y, Miyoshi M, Yamamoto M, Nandi A, Rosenblatt KP, Baum MG, Schiavi S, Hu MC, Moe OW, Kuro-o M. Regulation of fibroblast growth factor-23 signaling by klotho. J Biol Chem 281: 6120–6123, 2006. doi: 10.1074/jbc.C500457200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kurosu H, Yamamoto M, Clark JD, Pastor JV, Nandi A, Gurnani P, McGuinness OP, Chikuda H, Yamaguchi M, Kawaguchi H, Shimomura I, Takayama Y, Herz J, Kahn CR, Rosenblatt KP, Kuro-o M. Suppression of aging in mice by the hormone Klotho. Science 309: 1829–1833, 2005. doi: 10.1126/science.1112766. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Lewin E, Olgaard K. The vascular secret of Klotho. Kidney Int 87: 1089–1091, 2015. doi: 10.1038/ki.2015.80. [DOI] [PubMed] [Google Scholar]
  • 32.Lindberg K, Amin R, Moe OW, Hu MC, Erben RG, Östman Wernerson A, Lanske B, Olauson H, Larsson TE. The kidney is the principal organ mediating klotho effects. J Am Soc Nephrol 25: 2169–2175, 2014. doi: 10.1681/ASN.2013111209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Liu H, Fergusson MM, Castilho RM, Liu J, Cao L, Chen J, Malide D, Rovira II, Schimel D, Kuo CJ, Gutkind JS, Hwang PM, Finkel T. Augmented Wnt signaling in a mammalian model of accelerated aging. Science 317: 803–806, 2007. doi: 10.1126/science.1143578. [DOI] [PubMed] [Google Scholar]
  • 34.Mace ML, Gravesen E, Nordholm A, Hofman-Bang J, Secher T, Olgaard K, Lewin E. Kidney fibroblast growth factor 23 does not contribute to elevation of its circulating levels in uremia. Kidney Int 92: 165–178, 2017. doi: 10.1016/j.kint.2017.01.015. [DOI] [PubMed] [Google Scholar]
  • 35.Mael-Ainin M, Abed A, Conway SJ, Dussaule JC, Chatziantoniou C. Inhibition of periostin expression protects against the development of renal inflammation and fibrosis. J Am Soc Nephrol 25: 1724–1736, 2014. doi: 10.1681/ASN.2013060664. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Maeshima A, Nojima Y, Kojima I. The role of the activin-follistatin system in the developmental and regeneration processes of the kidney. Cytokine Growth Factor Rev 12: 289–298, 2001. doi: 10.1016/S1359-6101(01)00010-7. [DOI] [PubMed] [Google Scholar]
  • 37.Mencke R, Hillebrands JL. The role of the anti-ageing protein Klotho in vascular physiology and pathophysiology. Ageing Res Rev, 35: 124–146, 2017. doi: 10.1016/j.arr.2016.09.001. [DOI] [PubMed] [Google Scholar]
  • 38.Mencke R, Olauson H, Hillebrands JL. Effects of Klotho on fibrosis and cancer: a renal focus on mechanisms and therapeutic strategies. Adv Drug Deliv Rev 121: 85–100, 2017. doi: 10.1016/j.addr.2017.07.009. [DOI] [PubMed] [Google Scholar]
  • 39.Meng XM, Chung AC, Lan HY. Role of the TGF-β/BMP-7/Smad pathways in renal diseases. Clin Sci (Lond) 124: 243–254, 2013. doi: 10.1042/CS20120252. [DOI] [PubMed] [Google Scholar]
  • 40.Meng XM, Nikolic-Paterson DJ, Lan HY. TGF-β: the master regulator of fibrosis. Nat Rev Nephrol 12: 325–338, 2016. doi: 10.1038/nrneph.2016.48. [DOI] [PubMed] [Google Scholar]
  • 41.Mirams M, Robinson BG, Mason RS, Nelson AE. Bone as a source of FGF23: regulation by phosphate? Bone 35: 1192–1199, 2004. doi: 10.1016/j.bone.2004.06.014. [DOI] [PubMed] [Google Scholar]
  • 42.Mitobe M, Yoshida T, Sugiura H, Shirota S, Tsuchiya K, Nihei H. Oxidative stress decreases klotho expression in a mouse kidney cell line. Nephron, Exp Nephrol 101: e67–e74, 2005. doi: 10.1159/000086500. [DOI] [PubMed] [Google Scholar]
  • 43.Moester MJ, Papapoulos SE, Löwik CW, van Bezooijen RL. Sclerostin: current knowledge and future perspectives. Calcif Tissue Int 87: 99–107, 2010. doi: 10.1007/s00223-010-9372-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Morra L, Moch H. Periostin expression and epithelial-mesenchymal transition in cancer: a review and an update. Virchows Arch 459: 465–475, 2011. doi: 10.1007/s00428-011-1151-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Palin NK, Savikko J, Pasternack A, Rintala JM, Kalra B, Mistry S, Kumar A, Roth MP, Helin H, Ritvos O. Activin inhibition limits early innate immune response in rat kidney allografts-a pilot study. Transpl Int 30: 96–107, 2017. doi: 10.1111/tri.12876. [DOI] [PubMed] [Google Scholar]
  • 46.Prakoura N, Kavvadas P, Kormann R, Dussaule JC, Chadjichristos CE, Chatziantoniou C. NFκB-induced periostin activates integrin-β3 signaling to promote renal injury in GN. J Am Soc Nephrol 28: 1475–1490, 2017. doi: 10.1681/ASN.2016070709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Rukov JL, Gravesen E, Mace ML, Hofman-Bang J, Vinther J, Andersen CB, Lewin E, Olgaard K. Effect of chronic uremia on the transcriptional profile of the calcified aorta analyzed by RNA sequencing. Am J Physiol Renal Physiol 310: F477–F491, 2016. doi: 10.1152/ajprenal.00472.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Satoh M, Nagasu H, Morita Y, Yamaguchi TP, Kanwar YS, Kashihara N. Klotho protects against mouse renal fibrosis by inhibiting Wnt signaling. Am J Physiol Renal Physiol 303: F1641–F1651, 2012. doi: 10.1152/ajprenal.00460.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Segawa H, Kawakami E, Kaneko I, Kuwahata M, Ito M, Kusano K, Saito H, Fukushima N, Miyamoto K. Effect of hydrolysis-resistant FGF23-R179Q on dietary phosphate regulation of the renal type-II Na/Pi transporter. Pflugers Arch 446: 585–592, 2003. doi: 10.1007/s00424-003-1084-1. [DOI] [PubMed] [Google Scholar]
  • 50.Shimada T, Hasegawa H, Yamazaki Y, Muto T, Hino R, Takeuchi Y, Fujita T, Nakahara K, Fukumoto S, Yamashita T. FGF-23 is a potent regulator of vitamin D metabolism and phosphate homeostasis. J Bone Miner Res 19: 429–435, 2004. doi: 10.1359/JBMR.0301264. [DOI] [PubMed] [Google Scholar]
  • 51.Shimada T, Urakawa I, Yamazaki Y, Hasegawa H, Hino R, Yoneya T, Takeuchi Y, Fujita T, Fukumoto S, Yamashita T. FGF-23 transgenic mice demonstrate hypophosphatemic rickets with reduced expression of sodium phosphate cotransporter type IIa. Biochem Biophys Res Commun 314: 409–414, 2004. doi: 10.1016/j.bbrc.2003.12.102. [DOI] [PubMed] [Google Scholar]
  • 52.Shimada T, Yamazaki Y, Takahashi M, Hasegawa H, Urakawa I, Oshima T, Ono K, Kakitani M, Tomizuka K, Fujita T, Fukumoto S, Yamashita T. Vitamin D receptor-independent FGF23 actions in regulating phosphate and vitamin D metabolism. Am J Physiol Renal Physiol 289: F1088–F1095, 2005. doi: 10.1152/ajprenal.00474.2004. [DOI] [PubMed] [Google Scholar]
  • 53.Sugiura H, Yoshida T, Mitobe M, Yoshida S, Shiohira S, Nitta K, Tsuchiya K. Klotho reduces apoptosis in experimental ischaemic acute kidney injury via HSP-70. Nephrol Dial Transplant 25: 60–68, 2010. doi: 10.1093/ndt/gfp451. [DOI] [PubMed] [Google Scholar]
  • 54.Sugiura H, Yoshida T, Shiohira S, Kohei J, Mitobe M, Kurosu H, Kuro-o M, Nitta K, Tsuchiya K. Reduced Klotho expression level in kidney aggravates renal interstitial fibrosis. Am J Physiol Renal Physiol 302: F1252–F1264, 2012. doi: 10.1152/ajprenal.00294.2011. [DOI] [PubMed] [Google Scholar]
  • 55.Surendran K, Schiavi S, Hruska KA. Wnt-dependent β-catenin signaling is activated after unilateral ureteral obstruction, and recombinant secreted frizzled-related protein 4 alters the progression of renal fibrosis. J Am Soc Nephrol 16: 2373–2384, 2005. doi: 10.1681/ASN.2004110949. [DOI] [PubMed] [Google Scholar]
  • 56.Tan RJ, Zhou D, Zhou L, Liu Y. Wnt/β-catenin signaling and kidney fibrosis. Kidney Int Suppl (2011) 4: 84–90, 2014. doi: 10.1038/kisup.2014.16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Ubaidus S, Li M, Sultana S, de Freitas PH, Oda K, Maeda T, Takagi R, Amizuka N. FGF23 is mainly synthesized by osteocytes in the regularly distributed osteocytic lacunar canalicular system established after physiological bone remodeling. J Electron Microsc (Tokyo) 58: 381–392, 2009. doi: 10.1093/jmicro/dfp032. [DOI] [PubMed] [Google Scholar]
  • 58.Ucero AC, Benito-Martin A, Izquierdo MC, Sanchez-Niño MD, Sanz AB, Ramos AM, Berzal S, Ruiz-Ortega M, Egido J, Ortiz A. Unilateral ureteral obstruction: beyond obstruction. Int Urol Nephrol 46: 765–776, 2014. doi: 10.1007/s11255-013-0520-1. [DOI] [PubMed] [Google Scholar]
  • 59.Urakawa I, Yamazaki Y, Shimada T, Iijima K, Hasegawa H, Okawa K, Fujita T, Fukumoto S, Yamashita T. Klotho converts canonical FGF receptor into a specific receptor for FGF23. Nature 444: 770–774, 2006. doi: 10.1038/nature05315. [DOI] [PubMed] [Google Scholar]
  • 60.Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3: H0034, 2002. doi: 10.1186/gb-2002-3-7-research0034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Xu Y, Sun Z. Molecular basis of Klotho: from gene to function in aging. Endocr Rev 36: 174–193, 2015. doi: 10.1210/er.2013-1079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Yamashita S, Maeshima A, Kojima I, Nojima Y. Activin A is a potent activator of renal interstitial fibroblasts. J Am Soc Nephrol 15: 91–101, 2004. doi: 10.1097/01.ASN.0000103225.68136.E6. [DOI] [PubMed] [Google Scholar]
  • 63.Yan X, Yokote H, Jing X, Yao L, Sawada T, Zhang Y, Liang S, Sakaguchi K. Fibroblast growth factor 23 reduces expression of type IIa Na+/Pi co-transporter by signaling through a receptor functionally distinct from the known FGFRs in opossum kidney cells. Genes Cells 10: 489–502, 2005. doi: 10.1111/j.1365-2443.2005.00853.x. [DOI] [PubMed] [Google Scholar]
  • 64.Ying SY. Inhibins, activins, and follistatins: gonadal proteins modulating the secretion of follicle-stimulating hormone. Endocr Rev 9: 267–293, 1988. doi: 10.1210/edrv-9-2-267. [DOI] [PubMed] [Google Scholar]
  • 65.Yoshiko Y, Wang H, Minamizaki T, Ijuin C, Yamamoto R, Suemune S, Kozai K, Tanne K, Aubin JE, Maeda N. Mineralized tissue cells are a principal source of FGF23. Bone 40: 1565–1573, 2007. doi: 10.1016/j.bone.2007.01.017. [DOI] [PubMed] [Google Scholar]
  • 66.Zhou D, Li Y, Lin L, Zhou L, Igarashi P, Liu Y. Tubule-specific ablation of endogenous β-catenin aggravates acute kidney injury in mice. Kidney Int 82: 537–547, 2012. doi: 10.1038/ki.2012.173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Zhou D, Tan RJ, Zhou L, Li Y, Liu Y. Kidney tubular β-catenin signaling controls interstitial fibroblast fate via epithelial-mesenchymal communication. Sci Rep 3: 1878, 2013. doi: 10.1038/srep01878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Zhou L, Li Y, Zhou D, Tan RJ, Liu Y. Loss of Klotho contributes to kidney injury by derepression of Wnt/β-catenin signaling. J Am Soc Nephrol 24: 771–785, 2013. doi: 10.1681/ASN.2012080865. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from American Journal of Physiology - Renal Physiology are provided here courtesy of American Physiological Society

RESOURCES