Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2018 Jul 7;8(7):306. doi: 10.1007/s13205-018-1331-y

Development of PCR-based molecular marker for screening of disease-suppressive composts against Fusarium wilt of tomato (Solanum lycopersicum L.)

C M Mehta 1,3,4,✉, Ramesh N Pudake 2, Rashmi Srivastava 1, Uma Palni 3, Anil K Sharma 1
PMCID: PMC6035786  PMID: 30002996

Abstract

The present study was carried out to develop a PCR-based molecular marker suitable for screening of disease-suppressive composts against Fusarium wilt of tomato. An effective uncultured bacterial community was screened from our previous study on investigation of microbial communities in composts for their potential for biocontrol of Fusarium wilt. Based on available sequence information (Accession no. HQ388491) of selective community, PCR-based molecular markers were designed and tested for their specificity in different compost sample. To confirm specificity of designed marker, real-time reverse transcription-PCR (qRT-PCR) analysis was performed. Selective marker efficacy was further tested for different set of composts and results were cross-verified by conducting bioassay of same composts against Fusarium wilt in tomato crop. Results showed that out of two designed set of primers (i.e., PAC1F/PAC1R and PAC4F/PAC4R), primer set PAC4F/PAC4R resulted in successful amplification of 199 bp in highly disease-suppressive compost (i.e., CPP); however, no/below detection level amplification was observed in non-suppressive compost (JC). qRT-PCR analysis confirmed the specificity of selective marker by representing single peak in melting curve. A clear difference was observed in relative population of selective community in different set of composts. It was observed maximum in the most effective compost, i.e., CPP followed by other disease-suppressive composts. Cross-examination of results with bioassay confirmed that composts with presence of selective bacterial community having no/very less disease incidence of Fusarium. It is clearly evident from the study that such kind of molecular markers can be developed and used in future research focusing on compost-based disease suppression.

Keywords: Compost, Disease suppression, PCR, Molecular marker, qRT-PCR, Fusarium wilt

Introduction

Every year, plant diseases cause significant economic crop loss all over the world (Koenning and Wrather 2010; Chakraborty and Newton 2011; Siebold and Tiedemann 2013; Chellemi et al. 2016). Among all plant diseases, Fusarium spp. is the most common species comprising pathogens, parasites and saprophytes, affecting all vegetative and reproductive parts of plants (Jennings et al. 2004; Klein et al. 2011; Khastini et al. 2012; Akhter et al. 2015; Fu et al. 2017). Tomato (Solanum lycopersicum L.) is one of the most important vegetable crops worldwide that could be used in many different ways like fresh as well as processed (Radzevičius et al. 2009; Glogovac et al. 2010; Gupta et al. 2017). Fusarium oxysporum f. sp. lycopersici is one of the most devastating pathogens of tomato (Balaž et al. 2009; Boukerma et al. 2017), causing great losses in productivity and fruit quality, especially on sensitive varieties under favorable weather conditions and once contaminated, soil remains contaminated indefinitely (Agrios 2005).

The most significant control for Fusarium wilt of tomato was use of methyl bromide, but due to environmental and human health concern, application of methyl bromide in fruits and vegetable crops has been banned by Montreal protocol (Minuto et al. 2006). Therefore, compost was considered as a potential alternative of methyl bromide to suppress disease, production of fruit and vegetable crops (Salman et al. 2017). The composts from various sources are well known for their role in suppression of plant diseases and are commonly used as a natural biological control since long time (Grebus et al. 1994; Hoitink et al. 1997; Vestberg et al. 2009; Hadar 2011; Shivlata and Satyanarayana 2017). The disease suppression of compost is considered as a result of two components: one when compost acts as a source for various biochemical compounds such as hormones, antibiotics and other secreted chemicals of microorganism, and secondly the beneficial microbes of compost (Özer and Köycü 2006; Fuchs 2010; Mehta et al. 2016; Scotti et al. 2016). However, all the composts are not equally effective towards disease suppression since they carry a huge difference in biochemical and microbial activities (Mupambwa et al. 2016; Tossavainen et al. 2017). Its known that intense microbial activity is observed in decomposition of most biodegradable materials during composting process (Weltzien 1991; Adani et al. 1997) and the majority of characteristics of compost are due to the presence of microbial activity. Judging the disease suppression capability of compost based on presence of these biochemical compounds is a costly affair, as it involves highly sophisticated instruments like HPLC, GC–MS, etc. (Matsunaga et al. 2013; Fels et al. 2014). Microbe secretes majority of these useful biomolecules during the composting, so if we can detect presence of the beneficial microbes in the compost, we can correlate it to disease suppression.

Due to the lack of well-defined characteristics of compost and the non-availability of methods to assess it, there is an immediate need of development of quick detection tools to check the disease-suppressing capacity of compost. There are many studies where the researchers have explored the microbial diversity of different compost and soil by using molecular tools (Nannipieri et al. 2003; Mehta et al. 2014; Pudasaini et al. 2017). Differential gradient gel electrophoresis (DGGE) is one of the most commonly used techniques in diversity studies (Yu et al. 2015; Mehta et al. 2016). Previous studies have implied that molecular biology approaches could be effectively used for improved understanding of disease suppression by compost (Blaya et al. 2016; Ros et al. 2017). In previous studies, our laboratory has identified few types of compost that suppressed the occurrence of Fusarium wilt in tomato. Through DGGE profiling of compost, specific bacterial community was observed in highly disease-suppressive compost (Mehta et al. 2016). Based on available information, this study was carried out to develop closely linked PCR-based molecular markers that can be used to detect specific microbial community in composts. Results of this study will be useful for marker-assisted study for disease suppressiveness property of different sets of compost.

Materials and methods

Compost collection and bioassay

In present study, seven composts [viz. Vermi Nagla (VN); Vermi Halduchaur (VH); Vermi Halduchaur Mature (VHM); BN: Bamboo NADEP (BN); Raw NADEP (RN); Compost with Trichoderma (CT) and Vermi Khanna (VK)] produced aerobically and collected from nearby areas of Pantnagar, Uttarakhand, (India) and screened for their disease suppressiveness property against Fusarium wilt (Fusarium oxysporum f. sp. lycopersici) of tomato. Similar methodology (Mehta et al. 2016) was used to conduct bioassay of selected composts. The composts were mixed at the rate of 20% (w/w) with autoclaved sand and filling 150 g of this potting mix in small pots. Inoculum of pathogen was produced in liquid potato dextrose medium and to infest the plants 12 ml of 5-day-old cultures (107 propagules per ml) was used. Equal number of control pots with same quantity of inoculum were used and experiment was replicated three times under controlled conditions in glass house. Supplementary light was provided by cool white lamps, 400 µE m−2 s−1, 400–700 nm, with a 16/8 h day/night cycle at 25/19 °C and 50% relative humidity.

DNA extraction from composts

DNA from compost was extracted using a HiPurA™ Soil DNA Kit (HiMedia, India) according to the manufacturer’s instructions. Briefly, the cell lysis was performed by soil lysis solution (SL) in bead beating tubes and centrifuged at 13,000×g for 1 min. Supernatant was collected and followed by addition of inhibitor removal solution (IRIS) and binding solution (SB) and centrifugation steps. Lysate was loaded into spin column included in the kit and centrifuged. Washing of DNA was performed with the washing solution (WSP) and finally DNA was eluted by adding 100 µl of elution buffer (ET) included in the kit. The extracted DNA was then stored at − 20 °C for further analysis. DNA concentration was estimated by measuring the absorbance at 260 nm/280 nm.

Development of specific primer

Nucleotide sequence of 16S rDNA gene from the disease suppressive compost in previous study (Mehta et al. 2016) was specific to uncultured Actinomycetes (Accession no. HQ388491). BLASTN (Altschul et al. 1990) was used to retrieve the homologous sequences (JN037867 and EU328054) from gene bank (http://blast.ncbi.nlm.nih.gov/Blast.cgi). All three nucleotide sequences were aligned using program CLUSTALW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2/) and were examined for the conserved regions. Specific nucleotide regions were selected to design the primers using Primer3 (v. 0.4.0) online tool (http://frodo.wi.mit.edu/).

Primer set Name sequence (5′ to 3′) Position Bases Homology (%) Fragment size (bp)
PAC1F AGCAAGTCGGCTGTGAAAGT 215–234 20 100 229
PAC1R ACGTTTACGGCGTGGACTAC 424–443 20 100
PAC4F TCGAGTCCGGTAGAGGAGAA 276–295 20 100 199
PAC4R TCATTGGTATAACCGCCACA 455–474 20 100
Open in a new tab

Position of each primer, homology and fragment size was obtained using nucleotide sequence HQ388491 (Mehta et al. 2016). To confirm the specific amplification by designed primers, a PCR analysis was performed with DNA from previously studied seven compost samples. 50 µl of PCR reaction mixture consisted of 5 µl 10X Taq Buffer, 1 µl of dNTPs (10 mM), 0.5 µl of each primer (10 µM), and 1.5 µl of Taq DNA polymerase (3 U/µl) (Genei, Banglore, India) and 20 ng of compost DNA.. The PCR cycle was as follows: 97 °C for 5 min, 35 cycles of denaturation at 97 °C for 30 s, annealing at 53 °C for 30 s and extension at 72 °C for 1 min, followed by a final extension at 72 °C for 5 min. All the PCR reactions were performed using gradient thermal cycler (Bio-rad, USA). The electrophoresis of PCR amplicon was done in 2% agarose gel, and to confirm the correct amplification it was cloned in pGEM-T (Promega, USA) and sequenced.

qRT-PCR analysis

Maxima SYBR Green/ROX qPCR master mix (Thermo Scientific, USA) was used with the Stratagene Mx Real-Time qPCR system (Stratagene, USA) for qRT-PCR. The specificity of primer set (PAC4F/PAC4R) was examined and the amplification of a specific transcript was confirmed by the appearance of a single peak in the melting curve analysis following completion of the amplification reaction. The relative level of specific bacterial population in compost DNA was normalized against the relative total bacterial population determined in each sample by using the 16S rRNA universal primers—Mf341 and Mr907 (Muyzer et al. 1995).

The reaction mixtures contained 2.5 ng of DNA, 1 µl of each primer (400 nM), 12.5 µl of Maxima SYBR Green/ROX qPCR master mix (Fermentas, USA) and PCR-grade water in a final volume of 25 µl. In all the experiments, appropriate negative controls containing no template were subjected to the same procedure to exclude or detect any possible contamination or carry-over. Each sample was amplified three times for each experiment and all the experiments were repeated at least twice. The program used included one step at 95 °C for 10 min, and 35 cycles consisting of 95 °C for 30 s, 58 °C for 30 s, and 72 for 40 s, followed by gradual heating (0.5 °C every 30 s) from 50 to 85 °C in order to generate the melting curve.

Results and discussion

Collection of composts and bioassay

Similar to our previous study (Mehta et al. 2016), a bioassay experiment was performed with seven new composts collected from nearby areas. After 15 days infection with pathogen, disease incidence was observed in the plants grown in pots mixed with compost. Fresh, dry biomass and percent disease in the plants were recorded. All composts were consistently suppressive to Fusarium wilt (Fig. 1). As compared to control plants, the most notably suppressive composts were Vermi Nagla (VN), Vermi Halduchaur (VH), Bamboo NADEP (BN), compost with Trichoderma (CT) and Vermi Khanna (VK) with no disease incidence. Composts Vermi Halduchaur Mature (VHM) and Raw NADEP were recorded with < 15% disease incidence. A significant difference was also observed in fresh biomass of the plants grown with compost mix. Maximum fresh biomass (2.80 g) was observed in the plants amended with CT while minimum (1.12 g) in VHM. Compared to control plants, a significant increase in dry biomass was also observed. Maximum dry biomass (0.188 g) was observed in the plants amended with VK while minimum (0.107 g) was recorded in VHM (excluding control plants).

Fig. 1.

Fig. 1

Open in a new tab

Percent disease, fresh and dry biomass of tomato plants grown in compost amended sand, infested with Fusarium oxysporum f. sp. lycopersici. Bars with the same letters are not statistically significant (P ≤ 0.05). Details of the composts; VN Vermi Nagla, VH Vermi Halduchaur, VHM Vermi Halduchaur Mature, BN Bamboo NADEP, RN Raw NADEP, CT Compost with Trichoderma, VK Vermi Khanna

Validation of specific primer

To validate the specificity of designed primers, both set of primers (i.e., PAC1F/PAC1R and PAC4F/PAC4R) were tested on DNA isolated from previously studied compost (CPP: Cow Pit Pat-Supa; highly disease suppressive) and (JC: Jatropha cake + cow dung + Cuscuta reflexa; non-suppressive). After standardization of amplification condition only one set of primer (i.e., set PAC4F and PAC4R) resulted in successful amplification of 199 bp in highly disease-suppressive compost (i.e., CPP); however, no amplification was observed in non-suppressive compost (JC) (Fig. 2). For further confirmation, band amplicon was cloned and sequenced. Sequencing results confirmed its 100% similarity to the original sequence used in primer designing (HQ388491). After confirmation of specificity of designed primer for specific bacterial community, a similar experiment was repeated with new set of composts selected in present study. DNA was successfully isolated from all collected compost and PCR was performed with similar primer set. Amplification was observed in all selected composts except control (i.e., JC) and VHM. DNA template from all the composts was further tested for comparative study of population of specific bacterium by using real-time PCR analysis.

Fig. 2.

Fig. 2

Open in a new tab

Semi-quantitative RT PCR analysis with a seven previously studied composts and b seven new composts. “A” represents amplification with universal bacterial primers (Mf341 and Mr907) and “B” represents amplification with specific primers (PAc4f and PAc4r). “M” represents molecular marker. Compost details: S-NADEP Saklani NADEP, CP cow dung + poultry waste, JC Jatropha cake + cow dung, JCC Jatropha cake + cow dung + Cuscuta reflexa, JNMs Jatropha cake + mushroom spent, JNMsC Jatropha cake + mushroom spent + Cuscuta reflexa, CPP Cow Pit Pat-Supa

Real-time PCR for comparative study of population of specific uncultured bacterium in different composts

The primers designed to amplify specific population of uncultured bacterium resulted in a single melting peak in DNA extracted from all selected composts except in the compost with no disease suppression (JC). The comparative study of this specific bacterium in various composts was investigated by real-time-PCR using the primers PAC4F and PAC4R. The universal primers for 16S rRNA (Mf341 and Mr907) was used as internal control. The results showed that the population of specific bacterium was detected in composts where there is disease suppression. Furthermore, this bacterium was differentially present in various composts and it is correlated with suppressive activity of that compost (Fig. 3a). In compost namely CPP, NADEP, Vermi Nagla, the population levels were higher than those in other composts (Fig. 3b).The growing evidence indicates that bacterium are involved in suppression of several soil borne diseases. Thus, we first time find out the presence of specific actinobacteria population in relation to Fusarium disease suppression in tomato seedlings by compost. Actinobacteria are very well known for degradation of lignin and in compost curing (Kirby 2005; Danon et al. 2008) and also for their antagonistic property against different plant and human pathogens (Cha et al. 2016; Fels et al. 2014). Most of the studies related to disease suppressiveness/antagonistic property are with cultured actinobacterium. However, there are a large number of uncultured actinobacteria which may have a great impact on the properties of compost. Present study also revealed the role of uncultured actinobacterium in disease suppression and confirmation of the specificity of this microbe by using molecular tools.

Fig. 3.

Fig. 3

Open in a new tab

The relative population of uncultured bacterium in various composts. a With pre-selected composts; b with new set of composts along with positive and negative control from previous study (highly disease suppressive; CPP and non-suppressive composts-JC)

DNA-based markers are well studied and known for their specificity in different applications including genome mapping, gene tagging, genetic diversity, phylogenetic analysis and forensic investigations (Grover and Sharma 2016). Amplification with designed set of primer in disease suppressive composts reveals the specificity of PCR-based molecular marker. The high degree of similarity between the chosen community and amplified product implies that the primers are specific for selective actinobacterium community.

Since in the present study primers were designed to target specific microbial community of compost, accuracy of identifying selective community was very important. Results confirmed a clear relation between abundance of actinobacteria and disease suppressiveness property of compost.

Conclusion

Present study on the development of PCR-based molecular marker can be a valuable tool for preliminary testing of compost for its disease-suppressive nature confirmation to the results of bioassay test. This approach is particularly well suited to compost microorganisms that are difficult to identify or isolate because of the presence of other aggressive species. However, compost microbiology is still a complex phenomenon and there are possibilities of involvement of an individual microorganism or group of microorganisms in disease suppression. Therefore, in future there is a need to develop more molecular markers for rapid screening of compost.

Abbreviations

PCR

Polymerase chain reaction

qRT-PCR

Real-time reverse transcription-PCR

Compliance with ethical standards

Conflict of interest

The authors would like to declare that there is no conflict of interest with this research.

References

  1. Adani F, Genevini PL, Gasperi F, Zorzi G. Organic matter evolution index (OMEI) as a measure of composting efficiency. Compost Sci Util. 1997;5(2):53–62. doi: 10.1080/1065657X.1997.10701874. [DOI] [Google Scholar]
  2. Agrios GN. Plant pathology. 5. San Diego: Academic Press; 2005. Plant diseases caused by fungi; pp. 385–614. [Google Scholar]
  3. Akhter A, Hage-Ahmed K, Soja G, Steinkellner S. Compost and biochar alter mycorrhization, tomato root exudation, and development of Fusarium oxysporum f. sp. lycopersici. Front Plant Sci. 2015;6:529. doi: 10.3389/fpls.2015.00529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215(3):403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
  5. Balaž F, Stojšin V, Jasnić S, Inđić D, Bagi F, Budakov D. The most important fungal diseases in greenhouse production. Biljni Lekar (Plant Doctor) 2009;37(5):468–493. [Google Scholar]
  6. Blaya J, Marhuenda FC, Pascual JA, Ros M. Microbiota characterization of compost using omics approaches opens new perspectives for phytophthora root rot control. PLoS One. 2016;11(8):e0158048. doi: 10.1371/journal.pone.0158048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Boukerma L, Benchabane M, Charif A, Khelifi L (2017) Activity of plant growth promoting rhizobacteria (PGPRs) in the biocontrol of tomato Fusarium wilt. Plant Prot Sci 53(2). 10.17221/178/2015-PPS
  8. Cha JY, Han S, Hong HJ, Cho H, Kim D, Kwon Y, Kwon SK, Crüsemann M, Lee YB, Kim JF, Giaever G. Microbial and biochemical basis of a Fusarium wilt-suppressive soil. ISME J. 2016;10(1):119–129. doi: 10.1038/ismej.2015.95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chakraborty S, Newton AC. Climate change, plant diseases and food security: an overview. Plant Pathol. 2011;60(1):2–14. doi: 10.1111/j.1365-3059.2010.02411.x. [DOI] [Google Scholar]
  10. Chellemi DO, Gamliel A, Katan J, Subbarao KV. Development and deployment of systems-based approaches for the management of soilborne plant pathogens. Phytopathology. 2016;106(3):216–225. doi: 10.1094/PHYTO-09-15-0204-RVW. [DOI] [PubMed] [Google Scholar]
  11. Danon M, Franke-Whittle IH, Insam H, Chen Y, Hadar Y. Molecular analysis of bacterial community succession during prolonged compost curing. FEMS Microbiol Ecol. 2008;65(1):133–144. doi: 10.1111/j.1574-6941.2008.00506.x. [DOI] [PubMed] [Google Scholar]
  12. El Fels L, Lemee L, Ambles A, Hafidi M. Identification and biotransformation of lignin compounds during co-composting of sewage sludge-palm tree waste using pyrolysis-GC/MS. Int Biodeterior Biodegrad. 2014;92:26–35. doi: 10.1016/j.ibiod.2014.04.001. [DOI] [Google Scholar]
  13. Fu L, Penton CR, Ruan Y, Shen Z, Xue C, Li R, Shen Q. Inducing the rhizosphere microbiome by biofertilizer application to suppress banana Fusarium wilt disease. Soil Biol Biochem. 2017;104:39–48. doi: 10.1016/j.soilbio.2016.10.008. [DOI] [Google Scholar]
  14. Fuchs JG. Microbes at work. Berlin: Springer; 2010. Interactions between beneficial and harmful microorganisms: from the composting process to compost application; pp. 213–229. [Google Scholar]
  15. Glogovac S, Takač A, Gvozdanović-Varga J. Tomato (L. esculentum Mill.) genotypes variability of fruit traits. Genetika. 2010;42(3):397–406. doi: 10.2298/GENSR1003397G. [DOI] [Google Scholar]
  16. Grebus ME, Watson ME, Hoitink HAJ. Biological, chemical and physical properties of composted yard trimmings as indicators of maturity and plant disease suppression. Compost Sci Util. 1994;2(1):57–71. doi: 10.1080/1065657X.1994.10757919. [DOI] [Google Scholar]
  17. Grover A, Sharma PC. Development and use of molecular markers: past and present. Crit Rev Biotechnol. 2016;36(2):290–302. doi: 10.3109/07388551.2014.959891. [DOI] [PubMed] [Google Scholar]
  18. Gupta S, Nawaz K, Parween S, Roy R, Sahu K, Kumar Pole A, Khandal H, Srivastava R, Kumar Parida S, Chattopadhyay D. Draft genome sequence of Cicer reticulatum L., the wild progenitor of chickpea provides a resource for agronomic trait improvement. DNA Res. 2017;24(1):1–10. doi: 10.1093/dnares/dsw042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hadar Y. Suppressive compost: when plant pathology met microbial ecology. Phytoparasitica. 2011;39(4):311–314. doi: 10.1007/s12600-011-0177-1. [DOI] [Google Scholar]
  20. Hoitink HAJ, Stone AG, Han DY. Suppression of plant diseases by composts. Hortic Sci. 1997;32(2):184–187. [Google Scholar]
  21. Jennings P, Coates ME, Walsh K, Turner JA, Nicholson P. Determination of deoxynivalenol- and nivalenol-producing chemotypes of Fusarium graminearum isolated from wheat crops in England and Wales. Plant Pathol. 2004;53(5):643–652. doi: 10.1111/j.0032-0862.2004.01061.x. [DOI] [Google Scholar]
  22. Khastini RO, Ohta H, Narisawa K. The role of a dark septate endophytic fungus, Veronaeopsis simplex Y34, in fusarium disease suppression in Chinese cabbage. J Microbiol. 2012;50(4):618–624. doi: 10.1007/s12275-012-2105-6. [DOI] [PubMed] [Google Scholar]
  23. Kirby R. Actinomycetes and lignin degradation. Adv Appl Microbiol. 2005;58:125–168. doi: 10.1016/S0065-2164(05)58004-3. [DOI] [PubMed] [Google Scholar]
  24. Klein E, Katan J, Gamliel A. Soil suppressiveness to Fusarium disease following organic amendments and solarization. Plant Dis. 2011;95(9):1116–1123. doi: 10.1094/PDIS-01-11-0065. [DOI] [PubMed] [Google Scholar]
  25. Koenning SR, Wrather JA. Suppression of soybean yield potential in the continental United States by plant diseases from 2006 to 2009. Plant Health Prog. 2010 [Google Scholar]
  26. Matsunaga T, Moriizumi M, Kameda T. Molecular characterization of organic nitrogen in cattle manure compost by size-exclusion HPLC with chemiluminescent nitrogen detection. Anal Sci. 2013;29(9):923–926. doi: 10.2116/analsci.29.923. [DOI] [PubMed] [Google Scholar]
  27. Mehta CM, Palni U, Franke-Whittle IH, Sharma AK. Compost: its role, mechanism and impact on reducing soil-borne plant diseases. Waste Manag. 2014;34(3):607–622. doi: 10.1016/j.wasman.2013.11.012. [DOI] [PubMed] [Google Scholar]
  28. Mehta CM, Yu D, Srivastava R, Sinkkonen A, Kurola JM, Gupta V, Jääskeläinen H, Palni U, Sharma AK, Romantschuk M. Microbial diversity and bioactive substances in disease suppressive composts from India. Comp Sci Util. 2016;24(2):105–116. doi: 10.1080/1065657X.2015.1087894. [DOI] [Google Scholar]
  29. Minuto A, Spadaro D, Garibaldi A, Gullino ML. Control of soilborne pathogens of tomato using a commercial formulation of Streptomyces griseoviridis and solarization. Crop Prot. 2006;25(5):468–475. doi: 10.1016/j.cropro.2005.08.001. [DOI] [Google Scholar]
  30. Mupambwa HA, Ravindran B, Mnkeni PNS. Potential of effective micro-organisms and Eisenia fetida in enhancing vermi-degradation and nutrient release of fly ash incorporated into cow dung–paper waste mixture. Waste Manag. 2016;48:165–173. doi: 10.1016/j.wasman.2015.10.001. [DOI] [PubMed] [Google Scholar]
  31. Muyzer G, Teske A, Wirsen CO, Jannasch HW. Phylogenetic relationships of Thiomicrospira species and their identification in deep-sea hydrothermal vent samples by denaturing gradient gel electrophoresis of 16S rDNA fragments. Arch Microbiol. 1995;164(3):165–172. doi: 10.1007/BF02529967. [DOI] [PubMed] [Google Scholar]
  32. Nannipieri P, Ascher J, Ceccherini M, Landi L, Pietramellara G, Renella G. Microbial diversity and soil functions. Eur J Soil Sci. 2003;54(4):655–670. doi: 10.1046/j.1351-0754.2003.0556.x. [DOI] [Google Scholar]
  33. Özer N, Köycü ND. The ability of plant compost leachates to control black mold (Aspergillus niger) and to induce the accumulation of antifungal compounds in onion following seed treatment. Biocontrol. 2006;51(2):229–243. doi: 10.1007/s10526-005-1035-1. [DOI] [Google Scholar]
  34. Pudasaini S, Wilson J, Ji M, van Dorst J, Snape I, Palmer AS, Burns BP, Ferrari BC. Microbial diversity of browning Peninsula, Eastern Antarctica revealed using molecular and cultivation methods. Front Microbiol. 2017;8:591. doi: 10.3389/fmicb.2017.00591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Radzevičius A, Karklelienė R, Viškelis P, Bobinas Č, Bobinaitė R, Sakalauskienė S. Tomato (Lycopersicon esculentum Mill.) fruit quality and physiological parameters at different ripening stages of Lithuanian cultivars. Agron Res. 2009;7(2):712–718. [Google Scholar]
  36. Ros M, Raut I, Santisima-Trinidad AB, Pascual JA. Relationship of microbial communities and suppressiveness of Trichoderma fortified composts for pepper seedlings infected by Phytophthora nicotianae. PloS one. 2017;12(3):e0174069. doi: 10.1371/journal.pone.0174069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Salman M, Shahin N, Abu-Khalaf N, Jawabrih M, Rumaileh BA, Abuamsha R, Barghouthi SA. Antagonistic activity of Pseudomonas fluorescens against Fusarium oxysporum f. sp. nievum isolated from soil samples in palestine. JPS. 2017;6(2):1. doi: 10.5539/jps.v6n2p1. [DOI] [Google Scholar]
  38. Scotti R, Pane C, Spaccini R, Palese AM, Piccolo A, Celano G, Zaccardelli M. On-farm compost: a useful tool to improve soil quality under intensive farming systems. Appl Soil Ecol. 2016;107:13–23. doi: 10.1016/j.apsoil.2016.05.004. [DOI] [Google Scholar]
  39. Shivlata L, Satyanarayana T. Agro-environmental sustainability. Berlin: Springer; 2017. Actinobacteria in agricultural and environmental sustainability; pp. 173–218. [Google Scholar]
  40. Siebold M, Tiedemann A. Effects of experimental warming on fungal disease progress in oilseed rape. Glob Change Biol. 2013;19(6):1736–1747. doi: 10.1111/gcb.12180. [DOI] [PubMed] [Google Scholar]
  41. Tossavainen M, Nykänen A, Valkonen K, Ojala A, Kostia S, Romantschuk M. Culturing of Selenastrum on diluted composting fluids: conversion of waste to valuable algal biomass in presence of bacteria. Bioresour Technol. 2017;238:205–213. doi: 10.1016/j.biortech.2017.04.013. [DOI] [PubMed] [Google Scholar]
  42. Vestberg M, Kukkonen S, Rantala S, Prochazka P, Tuohimetsä S, Setälä H, Romantschuk M, Kurola J, Yu D, Parikka P. Suppressiveness of Finnish commercial compost against soil borne disease. Int Symp Grow Media Compost. 2009;891:59–65. [Google Scholar]
  43. Weltzien HC. Microbial ecology of leaves. New York: Springer; 1991. Biocontrol of foliar fungal diseases with compost extracts; pp. 430–450. [Google Scholar]
  44. Yu D, Sinkkonen A, Hui N, Kurola JM, Kukkonen S, Parikka P, Vestberg M, Romantschuk M. Molecular profile of microbiota of Finnish commercial compost suppressive against Pythium disease on cucumber plants. Appl Soil Ecol. 2015;92:47–53. doi: 10.1016/j.apsoil.2015.03.005. [DOI] [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES