Skip to main content
NCBI home page
Journal of Cell Communication and Signaling logoLink to Journal of Cell Communication and Signaling
. 2017 Dec 23;12(3):603–613. doi: 10.1007/s12079-017-0411-9

Sulfatase-1 knockdown promotes in vitro and in vivo aggressive behavior of murine hepatocarcinoma Hca-P cells through up-regulation of mesothelin

Salma Abdi Mahmoud 1, Mohammed Mohammed Ibrahim 1,2, Ahmed Hago Musa 1, Yuhong Huang 1, Jun Zhang 1, Jingwen Wang 1, Yuanyi Wei 1, Li Wang 1, Shunting Zhou 1, Boyi Xin 1, Wei Xuan 1, Jianwu Tang 1,✉
PMCID: PMC6039345  PMID: 29275459

Abstract

Our previous study (Oncotarget 2016; 7:46) demonstrated that the over-expression of sulfatase-1 in murine hepatocarcinoma Hca-F cell line (a murine HCC cell with lymph node metastatic [LNM] rate of >75%) downregulates mesothelin and leads to reduction in lymphatic metastasis, both in vitro and in vivo. In current work, we investigated the effects of Sulf-1 knockdown on mesothelin (Msln) and it’s effects on the in vitro cell proliferation, migration, invasion, and in vivo tumor growth and LNM rate for Hca-P cells (a murine HCC cell with LNM rate of <25%). Western blotting and qRT-PCR assay indicated that both in vitro and in vivo Sulf-1 was down-regulated by 75% and 68% and led to up regulation of Msln by 55% in shRNA-transfected-Sulf-1-Hca-P cells compared with Hca-P and nonspecific sequence control plasmid transfected Hca-P cell (shRNA-Nc-Hca-P). The in vitro proliferation, migration and invasion potentials were significantly enhanced following Sulf-1 stable down-regulation. In addition, Sulf-1 knock-down significantly promoted tumor growth and increased LNM rates of shRNA-Sulf-1-Hca-P-transplanted mice by 78.6% (11 out of 14 lymph nodes were positive of cancer). Consistent with our previous work, we confirmed that Sulf-1 plays an important role in hepatocarcinoma cell proliferation, migration, invasion and metastasis. The interaction between Sulf-1 and Msln is a potential therapeutic target in the development of liver cancer therapy.

Keywords: Sulfatase-1, Mesothelin, Hepatocellular carcinoma, Migration and invasion, Lymph node metastasis

Introduction

Hepatocellular carcinoma (HCC) is the third most common in worldwide cancer distribution and is the second leading cancer with high morbidity and mortality (Song et al. 2016; Torre et al. 2015). Lymphatic metastasis is the most important indicator of cancer prognosis, but in the literature, only few investigators (Suvendu Das 2008; Yoshimatsu et al. 2016; Dieterich and Detmar 2015; Gibot et al. 2016; Nathanson 2003) have reported about lymph node metastasis in hepatocellular carcinoma. Thus, the signaling pathways and the molecular mechanisms by which malignant liver cancer cells leave their primary site and invade regional lymph node have not been satisfactorily investigated in HCC.

Sulfatase-1 (Sulf-1) is one of the heparan sulfate 6-O-endosulfatases which are enzymes with unique ability to remove 6-O-sulfation pattern of Heparan Sulfate Proteoglycan (HSPG) on the cell surface (Pascale et al. 2016). Sulf-1 is located at the cell surface and extracellular matrix and is reported to regulate many genes involved in tumor progression and metastasis (Ma et al. 2011). The tumor suppresser function of Sulf-1 is reported to inhibit RAS/ERK, PI3K/AKT, WNT/β-catenin, stat3, TGF-β, and HEDGEHOG signaling in hepatocellular carcinoma, gastric cancer, ovarian cancer, and head and neck squamous cell carcinoma (Liu et al. 2014; Li et al. 2011; Lai et al. 2004a; Liu et al. 2013; Narita et al. 2007; Dhanasekaran et al. 2015; Bao et al. 2013; Roy et al. 2014; Khurana et al. 2011; Lai et al. 2004b; Li et al. 2005; Zhang et al. 2012).

Mesothelin (Msln) is also a cell surface glycoprotein that is overexpressed in various malignancies. Studies have shown that Msln promotes tumor growth, invasiveness and drug resistance by acting on the tyrosine kinase receptors which in turn stimulates PI3K/AKT and MAPK/ERK signaling (Chang et al. 2009). Msln expression was reported to be induced by the sulfated HSPG-Wnt/β-catenin signaling pathway and led to increased proliferation, invasion and metastasis (Wang et al. 2012; Prieve and Moon 2003; Szatmári et al. 2015).

Hca-P cell line is a murine HCC cell line syngeneic with Hca-F but with <25% LNM rate. Our lab developed both Hca-P and Hca-F cell lines. The two cell lines have unique features for the study of lymphatic metastasis (Cui et al. 2006; Song et al. 2005; Hou et al. 2001; Li et al. 1998). Our previous work indicated that there is a functional relationship between Sulf-1 and Msln in murine hepatocarcinoma (Mahmoud et al. 2016). Its overexpression in Hca-F murine hepatocarcinoma cell line down regulates Msln and leads to suppression of the in vitro proliferation, migration and invasion, as well as in vivo tumor growth and LNM rate. In the current study, we continued to validate the functional relationship between Sulf-1 and Msln, and the potential tumor suppressor role in hepatocarcinoma. Using RNAi silencing technique, we successfully down-regulated Sulf-1 in Hca-P by obtaining polyclonal shRNA-Sulf-1-Hca-P cells. Consistently, the stable knockdown of Sulf-1 up regulated Msln and led to an increase in the in vitro proliferation, migration and invasion capacities of Hca-P cells. In addition, the in vivo tumor growth and LNM rate of shRNA-Sulf-1-Hca-P-bearing mice were also significantly enhanced following the down-regulation of Sulf-1.

Materials and methods

Cell lines and stable plasmid transfection

Mouse hepatocellular carcinoma Hca-P cells (established by Department of Pathology, Dalian Medical University, Dalian, China) were cultured in 90% RPMI 1640 supplemented with penicillin/streptomycin and 10% fetal bovine serum (Gibco, USA), and cultured in a humidified incubator at 37 °C with 5% CO2.

We divided the cells into three groups: (1) stable down regulated Sulf-1 transfected Hca-P cells (shRNA-Sulf-1-Hca-P), (2) nonspecific sequence control plasmid transfected Hca-P cells (shRNA-Nc-Hca-P), and (3) non-transfected Hca-P cells (Hca-P). A day prior to transfection, 5× 105 cells per well were plated into a 6-well plate in a medium with 10% FBS and placed in an incubator with a temperature of 37 °C with 5% CO2. Then the cells were stably transfected with Sulf-1 down regulation plasmid (pGPU6/GFP/Neo-Sulf-1-Mus-950, GenePharma, China) and nonspecific sequence control plasmid (pGPU6/GFP/Neo-shNc, GenePharma, China). The transfection was done by using lipofectamine 2000 Reagent (Invitrogen, USA) according to the manufacturer’s protocol. Prior to the transfection, we empirically determined G418 selection concentration of the Hca-P cells to be 400 μg/ml of effective drug concentration. We continued to culture the transfected cells (shRNA-Sulf-1-Hca-P and shRNA-Nc-Hca-P) under the selection pressure of G418 until they became completely resistant to the drug. We then cultured the cells and the levels of Sulf-1 protein and mRNA in the down regulation cells were determined by Western Blot procedure and qRT-PCR, respectively.

Western blot analysis in vitro and in vivo

We harvested the plated cells in the log phase of growth and washed them twice with ice-cold PBS whilst the tissue samples were homogenized using tissue homogenizer. We extracted total proteins from the cultured cells and tissue samples and then quantified the proteins by the BCA method using Nanodrop spectrophotometer (Thermofisher Scientific USA). Equal amounts of proteins prepared into equal volumes were loaded onto a gel (SDS-PAGE) and separated by electrophoresis. Guided by a pre-stained protein molecular weight ladder (PageRuler ™ Prestained Protein Ladder #SM0671/2, Bio Lab China), portions of the gel corresponding to the molecular weights of Sulf-1, Msln and Glyceraldehyde 3-phospate dehydrogenase (Gapdh) proteins were sectioned out and transblotted onto a PVDF membranes (Invitrogen, USA). The membranes were blocked in 5% non-fat dried milk for one hour and then probed with monoclonal goat anti- Sulfatase 1 (Abcam, China, 1-3 μg/ml), anti- Mesothelin (Abcam, China, 1 μg/ml) and anti-Gapdh (ZSGB-Bio, China, 1:7500) primary antibodies for 1 h. After washing the membranes six times, rabbit anti-goat secondary antibody was applied to Sulf-1, anti- rabbit secondary antibody applied to Msln and anti-mouse secondary antibody applied on Gapdh for 1 h and the bright bands were captured by Li-Cor Odyssey Infrared Imaging System (Version 3.0 software).

qRT-PCR analysis in vitro and in vivo

In the in vitro experiment, total RNA was extracted from shRNA-Sulf-1-Hca-P, shRNA-Nc-Hca-P and Hca-P cells using the Trizol method (Invitrogen, USA). In the in vivo experiment, prior to mRNA extraction, all the equipment was autoclaved and washed with nuclease-free water, followed by rinsing with 100% ethanol and left to air dry. The samples were thawed and 1 g of cancer tissue was measured from each of the groups. The samples were homogenized using tissue homogenizer and total RNA was extracted from 500 mg of the homogenate using the Trizol method. Reverse transcription of purified RNA from both the in vivo and the in vitro samples were performed using oligonucleotide dT primers. qRT-PCR was carried out using SYBR green I dye and the quantification of gene transcripts was performed and normalized to Gapdh as the internal control. The sequences of primer pairs used in the present study are listed in Table 1. PCR was carried out under the following conditions: 45 cycles of denaturation for 30s at 95 °C, annealing for 30s at 55 °C, and extension for 30s at 72 °C. The relative mRNA expression level was collected and measured by using ∆Ct equation. We performed the PCR with Mx 3005P qRT-PCR machine (Agilent Technologies, Germany).

Table 1.

Nucleotide sequences of the primers used in qRT-PCR

Genes Primers
Forward Reverse
Sulf-1 GCCAAGCGCCATGATGAG TTCCACGCTCTGGCTGACT
Msln CACACTGAAAACTCTGCTCAAAGTC TCACATAGATAGCTTAACGGGATGTC
Gapdh AAGGGTTTGGGACAGACGA CATGAACAGCGCAAGGATTA
Open in a new tab

Cell proliferation analysis in vitro

The effect of Sulf-1 down regulation on Hca-P cells proliferation was measured using Dojindo’s CCK-8 cell proliferation kit (Dojindo Molecular Technologies, Japan). Briefly, triplicates of 3× 103 cells/well of shRNA-Sulf-1-Hca-P, shRNA-Nc-Hca-P and Hca-P cells were plated in 96 well plates and cell proliferation was measured at 24 h, 48 h, 72 h and 96 h later. We performed the Cell proliferation test by adding 10 μl of CCK-8/well and measured the absorbance at 450 nm 30 min after adding the reagent, using Multiskan Go spectrometer (Thermofisher Scientific, USA).

Flow cytometry analysis in vitro

The cell groups (shRNA-Sulf-1-Hca-P, shRNA-Nc-Hca-P and Hca-P cells) were synchronized at G0/G1 phase by growth in 100% confluence with reduced serum for three days (Vecsler et al. 2013). We then passaged the cells and cultured them for 24 h after which we harvested them in the log phase of growth, washed twice with ice-cold PBS and fixed them in 75% cold ethanol overnight at 4 °C. The following day the cells were washed twice with ice-cold PBS after discarding the ethanol, 50 μg/ml of RNase (Sigma, USA) was added for 30 min and then stained with 20 μg/ml of propidium Iodide (Sigma, USA) overnight in darkness. We performed flow cytometry on the cells (Beckman Coulter, USA) and analyzed the data by Multicycle software (Phoenix Flow Systems, San Diego, USA) to get the cell cycle distributions.

Migration assay in vitro

Transwell cell culture plates were used to determine the effect of Sulf-1 down-regulation on the cells’ migration potential. The upper chambers of the inserts were seeded with 2× 104 cells in 200 μl serum-free 1640 culture medium whilst the lower chambers were filled with 750 μl of 1640 containing 20% FBS as a chemoattractant, except in control wells which contained serum-free 1640 in both upper and lower chambers. After 16 h of incubation in humidified incubator with 5% CO2 the non-migrated cells in the upper chambers were swabbed off and the plates were fixed, stained, and then observed under an inverted fluorescent microscope.

Cell invasion assay in vitro

The inner chambers of the transwell plates were coated with ECM gel (Sigma, USA) and incubated at 37 °C for 1 h to produce an artificial basement membrane. The rest of the procedure was as described in migration assay above. Both the migration assay and the invasion assay were performed concurrently, and the former, aside being an assay on its own, was additionally used as control for the later.

Animals and implanted cell lines in vivo

The animals were provided by the Animal Facility of Dalian Medical University. All experimental procedures were approved by the Animal Ethics Committee of the Dalian Medical University, China. A total of 21 male inbred 615 mice (aged 6–8 weeks, weighing 18-22 g) were randomly divided into three groups (shRNA-Sulf-1-Hca-P, shRNA-Nc-Hca-P and Hca-P). The left footpad of each mouse was inoculated with 0.1 ml cell suspension (approximately 2 × 106cells).

Tumor growth and lymphatic metastasis assay in vivo

Tumor growth was monitored and measured on days 7, 14, 21 and 28 and the values were used to calculate the tumor volume according to the formula [length × width2]/2. Four weeks later, all the mice were humanely sacrificed and the tumors were dissected and weighed. Regional lymph nodes (inguinal and axillary) were also dissected for the analysis of lymph node metastatic rate.

Immunohistochemistry (IHC) and hematoxylin and eosin (H&E) stain analysis

The resected tumor tissues were cut into 5 μm sections and fixed in paraformaldehyde. IHC stain was employed to detect the expression of Sulfatase-1 and Mesothelin. The tissues were fixed in 4% buffered formalin for 15 min at 4 °C and rinsed in TBS. Paraffin sections were dewaxed in xylene and rehydrated in a series of ethanol solutions after which antigen retrieval was done with Tris buffer at pH 9.0 in a microwave. Endogenous peroxidase activity was blocked by 20 min pre-incubation with 3% H2O2 and then incubated with the blocking solution (Horse serum) for 30 min at room temperature. The incubation with primary antibodies (goat monoclonal anti- Sulfatase 1 antibody, Abcam, China, 1-3 μg/ml, and anti- Mesothelin antibody, Abcam, China, 1 μg/ml) was carried out overnight at 4 °C. The sections were then incubated with the secondary antibody for 1 h and color was developed with diaminobenzidine (DAB) (Zhongshan Biotechnology, China). The positive reaction manifested as a brown stain. The sections were counterstained in Mayor’s haematoxylin. Dehydration process started from 80%, 95% and 100% of ethanol for 2 min each and then washed with xylene 2times for 2 min each. Mounting and cover slipping were done and we proceeded to slide reading. Other slides were stained by routine H&E staining method and the rate of lymph node metastasis was determined. Metastasis rates in the two barrier Lymph nodes, including inguinal and axillary lymph nodes in the drainage routes from footpad tumors were assessed, and metastasis rate was expressed as a ratio of metastatic lymph nodes to the total number of lymph nodes in each mice group.

Statistical analysis

Each assay was performed three times. SPSS 17 software was used for all statistical analysis. One-way Anova was used to determine the significant differences among the groups at P < 0.05. We expressed the data as the mean ± standard deviation (S.D).

Results

Western blot results for the expression of Sulf-1 and Msln in vitro and in vivo

Western blot assay indicated that Sulf-1 was dramatically down regulated in shRNA-Sulf-1-Hca-P cells, both in vitro and in vivo. Compared to Hca-P and shRNA-Nc-Hca-P cells, Sulf-1 level decreased in shRNA-Sulf-1-Hca-P cells by 75% and 68% in vitro and in vivo, respectively (P < 0.05). At the same time, Msln expression level in shRNA-Sulf-1-Hca-P increased by 55% and 45% in vitro and in vivo, respectively (P < 0.05). These results confirm that Sulf-1 was successfully down regulated in Hca-P cells, and that its down regulation resulted in up regulation of Msln both in vitro and in vivo (Fig. 1a–d).

Fig. 1.

Fig. 1

Open in a new tab

Western blot and qrt-PCR analysis for Sulf-1 and Msln. Fig a & b Show the western blot results of Sulf 1 and Msln in vitro. a Presents the immunoblots whiles b shows the relative protein quantification of the immunoblots in a. Fig c & d Show the western blot results of Sulf 1 and Msln in vivo. c Presents the immunoblots whiles d shows the relative protein quantification of the immunoblots in c. Fig e & f Represent the Δct values for mRNA levels of Sulf-1 and Msln in vitro and in vivo respectively. Data are presented in columns as mean ± standard deviation (SD) and the results were statistically significant at P < 0.05

Qrt-PCR results for the expression of Sulf-1 and Msln in vitro and in vivo

The levels of mRNA of both Sulf-1 and Msln were measured in vitro and in vivo by qRT-PCR and normalized to Gapdh, and ∆ct was used to calculate the values. In the shRNA-Sulf-1-Hca-P cells the result showed that the ∆ct values for Sulf-1 in vitro and in vivo were 2.21 and 1.98 while the ∆ct values for Msln were 0.23 and 0.28 compared to the two control groups (Fig. 1e, f). This indicates that the mRNA expression level of Sulf-1 is lower in shRNA-Sulf-1-Hca-P cells with a concurrently higher Msln mRNA expression level compared to the two controls (P < 0.05). Clearly, this confirms that Sulf-1 down regulation promoted Msln expression both in vitro and in vivo.

The role of Sulf-1 in cell proliferation of Hca-P cells in vitro

In agreement with our previous work which showed that up-regulation of Sulf-1 inhibited cell proliferation of Hca-F cells (Mahmoud et al. 2016), our current work indicated that, down regulation of Sulf-1 significantly promotes the cell proliferation of Hca-P cells in vitro. Compared to the Hca-P and shRNA-Nc-Hca-P cells, shRNA-Sulf-1-Hca-P cells exhibited enhanced cell proliferation seen on 3rd and 4th days with a statistical significance of P < 0.05 (Fig. 2a, b). This shows that Sulf-1 played an important role in the regulation of Hca-P cells proliferation and this highlights the tumor suppressor effect of Sulf-1.

Fig. 2.

Fig. 2

Open in a new tab

Cell proliferation assay. a cell proliferation measurement using manual cell count. b CCK 8 assay for Sulf-1 up regulation. The curve for shRNA-Sulf-1-Hca-P cells shows a higher proliferation in the CCK8 analysis compared to the two controls with significant at P < 0.05. c-d Cell cycle analysis in shRNA-Sulf-1-Hca-P, shRNA-Nc-Hca-P and Hca-P cells. Cluster bar chart of the cell cycle showing percentage distributions of the cell cycle phases in the three cell groups. The values represent the number of cells in each phase of the cell cycle as a percentage of the total cells. The values were statistically significant at P < 0.05

The role of Sulf-1 on cell cycle in vitro

We further investigated the growth promoting effect of Sulf-1 down regulation on Hca-P cell line by using PI staining followed by flow cytometry. The results showed that in the shRNA-Sulf-1-Hca-P cells there was 30.83% decrease in cells accumulation in G0-G1 phase with a resultant increase by 20.07% in the number of cells in S-phase and 10.51% increase in cells in G2-M phase compared to the two controls as shown in Table 2 and Fig. 2c, d. This result indicates that Sulf-1 plays an important role in controlling hepatocellular carcinoma cell division.

Table 2.

Cell Cycle Percentage Distribution

Group The percentage of cell cycle phase (%)
G0-G1 S G2-M
Hca-P 69.49 ± 0.67 26.90 ± 1.4 3.61 ± 0.85
shRNA-Sulf-1-Hca-P 32.82 ± 0.07* 49.78 ± 0.03* 17.40 ± 0.02*
shRNA-Nc-Hca-P 65.99 ± 1.08 29.60 ± 1.09 4.41 ± 0.01
Open in a new tab

The difference for cell cycle analysis in Hca-P, shRNA-Sulf-1-Hca-P and shRNA-Nc-Hca-P cells were statistical significant at P < 0.05

The role of Sulf-1 on migration and invasion in vitro

We performed transwell assay to examine the changes in mobility and invasion of the shRNA-Sulf-1-Hca-P, shRNA-Nc-Hca-P and Hca-P cell lines. The migrated cell numbers for shRNA-Sulf-1-Hca-P, shRNA-Nc-Hca-P and Hca-P were 412 ± 21.78, 201 ± 10.65 and 213 ± 12.96. Meanwhile, the number of cells invaded through the filter membrane for shRNA-Sulf-1-Hca-P, shRNA-Nc-Hca-P and Hca-P cells were 382 ± 15, 199 ± 11.5 and 211 ± 10.0. Compare to the two control groups, the number of cells that migrated or invaded through from Sulf-1 down regulated cells were significantly increased by 2.00-folds (Fig. 3 a, b).

Fig. 3.

Fig. 3

Open in a new tab

Migration and invasion assay. a Transwell migration and invasion assays were performed in shRNA-Sulf-1-Hca-P, shRNA-Nc-Hca-P and Hca-P cells. The results showed an increase in both migration and invasion in shRNA-Sulf-1-Hca-P cells. b The results presented in a bar chart with mean ± standard deviation (SD) and were statistically significant at P < 0.05

The role of Sulf-1 in tumor growth in vivo

In the in vivo study, we observed that the mice inoculated with shRNA-Sulf-1-Hca-P cells had a faster rate of tumor growth and the tumors were bigger in size compared to the two controls (Fig. 4a–c). The immunohistochemistry results showed that the tumor tissues from shRNA-Sulf-1-Hca-P bearing mice had lower Sulf-1 expression level but higher Msln expression level compared to the two control groups (Fig. 4d). These results confirmed that Sulf-1 regulates the expression of Msln, and this finding is consistent with our in vitro results.

Fig. 4.

Fig. 4

Open in a new tab

Tumor growth and IHC analysis. a-c. Display dissected tumors, tumor volume and the tumor weight from shRNA-Sulf-1-Hca-P, shRNA-Nc-Hca-P and Hca-P inoculated mice. The tumor from shRNA-Sulf-1-Hca-P group were bigger compared to the two controls P < 0.05. d IHC staining of the tumor tissues from shRNA-Sulf-1-Hca-P, shRNA-Nc-Hca-P and Hca-P groups. The Sulf-1 expression is lower in shRNA-Sulf-1-Hca-P while Msln expression level is higher compared to the controls

The role of Sulf-1 in LNM rates in vivo

We also observed an increase in LNM rate in shRNA-Sulf-1- Hca-P bearing mice compared to the Hca-P and shRNA-Nc- Hca-P bearing mice as shown in Table 3. The LNM rates for Hca-P, shRNA-Sulf-1- Hca-P and shRNA-Nc- Hca-P bearing mice were 28.6% (4 out of 14 lymph nodes), 78.6% (11 out of 14 lymph nodes) and 35.7% (5 out of 14 lymph nodes), respectively. The LNM rates for shRNA-Sulf-1- Hca-P cells increased by 50% over Hca-P and 42.9% over shRNA-Nc- Hca-P. This means that, downregulations of Sulf-1 is associated with an increase in LNM rate, and corroborates the trail of findings in this study as well as findings from our previous work that Sulf-1 has a tumor suppressor property. The lymph nodes were also examined histopathologically (H&E), and the results revealed that, the lymph nodes from shRNA-Sulf-1-Hca-P bearing mice have more tumor cells with mitotic figures in the nodal marginal sinus with necrotic tissues, compared to the two control groups, (Fig. 5). This means that, the lymphatic metastatic level in shRNA-Sulf-1-Hca-P bearing mice was higher compared to the control groups and confirms that Sulf-1 plays an important role in reducing LNM rates.

Table 3.

The extent of lymph node metastasis to the axillary and inguinal lymph nodes in the three mice groups inoculated

Group LN Lymph node metastatic rate
LNM rate % LNM rate P value
Hca-P Inguinal 3/7 28.6
Axillary 1/7
Sulf-1-shRNA-Hca-P Inguinal 6/7 78.6 *0.05
Axillary 5/7
Nc-shRNA-Hca-P Inguinal 3/7 35.7
Axillary 2/7
Open in a new tab

LN, refers to lymph node; LNM, refers to lymph node metastasis

Fig. 5.

Fig. 5

Open in a new tab

Haematoxylin and Eosin (H&E) staining for lymph node tissues. a Hca-P. b shRNA-Sulf-1-Hca-P. c shRNA-Nc-Hca-P. The lymph node from shRNA-Sulf-1-Hca-P group had giant tumor cells with mitotic figures in the nodal marginal sinus with necrotic tissues and were of high grade compared to that of the control groups

Discussion

Down regulation of Sulf-1 is linked to the development and progression of a variety of cancers (Lai et al. 2003). As reported by other researchers, loss of Sulf-1 is associated with an increased chance of cancer development, invasion and metastasis of hepatocellular carcinoma (HCC), breast cancer, ovarian cancer, head and neck cancer, and Gastric cancer (Gopal et al. 2012; Akutsu et al. 2010; Mondal et al. 2015; Bao et al. 2013; Narita et al. 2007). Recently, in our previously study we found that Sulf-1 was linked to the lymphatic metastasis of hepatocarcinoma (Mahmoud et al. 2016). Using murine hepatocarcinoma Hca-P cell line, we found that down regulation of Sulf-1 in Hca-P cell line promoted cell proliferation, migration and invasion in vitro, and promoted tumor growth and metastasis in vivo. Furthermore, we explored the relationship between Sulf-1 and Msln in tumor cells, and showed that down regulation of Sulf-1 up regulates Msln expression both in vitro and in vivo. Sulf-1 directs its tumor suppression function by desulfating HSPG and inhibits Wnt/β-catenin signaling (Yang et al. 2015) while Msln expression is reported to be stimulated by the highly sulfated HSPG-Wnt/β-catenin signaling in cancers (Demir et al. 2016; Bayoglu et al. 2015; Lou et al. 2016).

Tumor Cell over proliferation is one of the important prognostic factors in tumor evolution, and this happens when there is a gain of function mutation in the genes controlling cell proliferation or loss of function mutation in tumor suppressor genes. Sulf-1 is reported to suppress cell proliferation and tumor growth by downregulating the expression of Hedgehog pathway target genes such as GLI1, PTCH1, PTCH2, HHIP, C-MYC, CCND1, FOXF1, FOXM1 and BCL2 (Huangfu and Anderson 2006; Østerlund and Kogerman 2006; Chuang et al. 2003; Chuang and McMahon 1999; Katoh and Katoh 2009). Our results show that down regulation of Sulf-1 promotes cell proliferation by up regulating Msln expression. These results confirm the tumor suppressor role of Sulf-1 as reported in other studies.

It our previous study we have shown that, expression of Sulf-1 in HCC led to induction of G0-G1 and G2-M phase arrest through inhibition of Msln (Mahmoud et al. 2016), and Msln is a known tumor promoter gene and its expression is reported to speed G1-S phase transition in the cell cycle (Tang et al. 2013). In our current study, we have shown that down regulation of Sulf-1 significantly speeds up cell cycle transition through the G1 to S-phase and then to G2-M phase. These findings are in agreement with what other researchers have found and this supports the tumor suppressor function of Sulf-1 in HCC.

Sulf-1 plays a significant role in in vitro migration and invasion capacities of tumor cells. Li J., et al. reported that Sulf-1 inhibits migration and invasiveness by down regulating Wnt/β-catenin signaling and inhibits the expression of metastasis related genes such as DKK4, S100A4, and S100P. These genes have been identified as Wnt signaling downstream target genes (Li et al. 2011). Our current study showed that, down regulation of Sulf-1 promotes migration and invasion abilities of Hca-P cell line by up regulating Msln expression. Msln is one of the Wnt/β-catenin downstream target genes, so it is possible that the action of Sulf-1 on Msln is through inhibition of Wnt/β-catenin signaling which leads to a decrease in migration and invasion of the cancer cells. It is also plausible to suggest that the alteration in both migration and invasion capacities directly contributed to the alteration in the LNM potential of Hca-P cell.

Our in vivo experiments showed that down regulation of Sulf-1 led to up regulation of Msln expression and promoted tumor growth and an increase in LNM rates of Hca-P cells. Sulf-1 has been reported to inhibit the factors which are associated with tumorigenesis and lymphagiogenesis in virous cancers (Lai et al. 2008). Consistent with our previous study (Mahmoud et al. 2016) both the in vitro and in vivo investigations of the index study strongly suggest a tumor suppressor effect for Sulf-1 in murine hepatocarcinoma and its expression inhibits Msln expression and reduces LNM rates.

In our studies, we have found that Sulf-1 down regulation up regulates Msln expression both in vitro and in vivo. The mechanism through which Sulf-1 and Msln interact has not been investigated and is therefore unknown and unexploited. Based on the evidence retrieved from literature and evidence obtained from our studies we proposed that sulfated-HSPG-Wnt/β pathway is most likely the pathway through which the interaction between Sulf-1 and Msln operates in HCC (Fig. 6).

Fig. 6.

Fig. 6

Open in a new tab

A schematic diagram showing the role of Sulfatase-1 in inhibiting mesothelin expression in Carcinogenesis. Desulfation action of sulfatase-1 on heparin sulfate proteoglycan (HSPG) leads to the inhibition of formation of HSPG-Wnt/β-catenin-Msln complex. This action will inhibits the activation of Msln and leads to inhibition of the signaling pathway involved in cell proliferation, migration, invasion, lymphatic metastasis and cell survival

Conclusions

In summary, our study highlights that down regulation of Sulf-1 up regulates Msln expression and promotes cell proliferation, migration, invasion, and tumor growth with increases in lymph node metastasis in Hca-P murine HCC cells. This is in agreement with our previous study where upregulation of Sulf-1 resulted in down regulation of Msln with a decrease in the aggressive behavior of murine HCC cells (Hca-F cells, syngeneic to Hca-P). The relationship between Sulf-1 and Msln has never been addressed by any investigation before, so our index study corroborates the previous study to show that there is a functional relationship between these two genes and this represents a promising target for developing therapeutic and preventive strategies against malignant progression in hepatocellular carcinoma.

Funding

This work was supports by grants from the National Natural Science Foundation of China [No. 81071725 and No. 30772468]; and the Financial Department of Liaoning Province [Nos. 20,121,203]. We would like to thank the Department of Pathology and the Key Lab for Tumor Metastasis and Intervention of Liaoning Province, as well as, and the Chinese Scholarship Council (CSC).

Compliance with ethical standards

Conflict of interest

The authors declare that they have no competing interests.

Contributor Information

Salma Abdi Mahmoud, Email: dr.salma_0503@qq.com.

Mohammed Mohammed Ibrahim, Email: mimkp2004@yahoo.com.

Ahmed Hago Musa, Email: ahmedhajo80@hotmail.com.

Yuhong Huang, Email: huangyh_1020@163.com.

Jun Zhang, Email: dlcom@126.com.

Jingwen Wang, Email: wangjing1366@163.com.

Yuanyi Wei, Email: yywei83@163.com.

Li Wang, Email: 422676404@qq.com.

Shunting Zhou, Email: 315828243@qq.com.

Boyi Xin, Email: xingboyi1991@sina.com.

Wei Xuan, Email: missweixuan@163.com.

Jianwu Tang, Phone: +8641186118866, Email: jianwutang@163.com.

References

  1. Akutsu N, et al. Association of glypican-3 expression with growth signaling molecules in hepatocellular carcinoma. World J Gastroenterol. 2010;16(28):3521–3528. doi: 10.3748/wjg.v16.i28.3521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bao L, et al. MicroRNA-21 suppresses PTEN and hSulf-1 expression and promotes hepatocellular carcinoma progression through AKT/ERK pathways. Cancer Lett. 2013;337(2):226–236. doi: 10.1016/j.canlet.2013.05.007. [DOI] [PubMed] [Google Scholar]
  3. Bayoglu IV, et al. Prognostic value of mesothelin expression in patients with triple negative and HER2-positive breast cancers. Biomed Pharmacother. 2015;70:190–195. doi: 10.1016/j.biopha.2015.01.019. [DOI] [PubMed] [Google Scholar]
  4. Chang M-C, et al. Mesothelin inhibits paclitaxel-induced apoptosis through the PI3K pathway. Biochem J. 2009;424:449–458. doi: 10.1042/BJ20082196. [DOI] [PubMed] [Google Scholar]
  5. Chuang PT, McMahon AP. Vertebrate hedgehog signalling modulated by induction of a hedgehog-binding protein. Nature. 1999;397(6720):617–621. doi: 10.1038/17611. [DOI] [PubMed] [Google Scholar]
  6. Chuang P-T, Kawcak T, McMahon AP. Feedback control of mammalian hedgehog signaling by the hedgehog-binding protein, Hip1, modulates Fgf signaling during branching morphogenesis of the lung. Genes Dev. 2003;17(3):342–347. doi: 10.1101/gad.1026303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cui XN, et al. Identification of differentially expressed genes in mouse hepatocarcinoma ascites cell line with low potential of lymphogenous metastasis. World J Gastroenterol. 2006;12(42):6893–6897. doi: 10.3748/wjg.v12.i42.6893. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Demir M, et al. Evaluation of new biomarkers in the prediction of malignant mesothelioma in subjects with environmental asbestos exposure. Lung. 2016;194(3):409–417. doi: 10.1007/s00408-016-9868-1. [DOI] [PubMed] [Google Scholar]
  9. Dhanasekaran R, et al. Activation of the transforming growth factor-β/SMAD transcriptional pathway underlies a novel tumor-promoting role of sulfatase 1 in hepatocellular carcinoma. Hepatology. 2015;61(4):1269–1283. doi: 10.1002/hep.27658. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dieterich LC, Detmar M. Tumor lymphangiogenesis and new drug development. Adv Drug Deliv Rev. 2015;99:148–160. doi: 10.1016/j.addr.2015.12.011. [DOI] [PubMed] [Google Scholar]
  11. Gibot L, et al. Cell-based approach for 3D reconstruction of lymphatic capillaries in vitro reveals distinct functions of HGF and VEGF-C in lymphangiogenesis. Biomaterials. 2016;78:129–139. doi: 10.1016/j.biomaterials.2015.11.027. [DOI] [PubMed] [Google Scholar]
  12. Gopal G, et al. Endo-sulfatase Sulf-1 protein expression is down-regulated in gastric cancer. Asian Pac J Cancer Prev: APJCP. 2012;13(2):641–646. doi: 10.7314/APJCP.2012.13.2.641. [DOI] [PubMed] [Google Scholar]
  13. Hou L, et al. Molecular mechanism about lymphogenous metastasis of hepatocarcinoma cells in mice. World J Gastroenterol. 2001;7(4):532–536. doi: 10.3748/wjg.v7.i4.532. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Huangfu D, Anderson KV. Signaling from Smo to ci/Gli: conservation and divergence of hedgehog pathways from drosophila to vertebrates. Development. 2006;133(1):3–14. doi: 10.1242/dev.02169. [DOI] [PubMed] [Google Scholar]
  15. Katoh Y, Katoh M. Hedgehog target genes: mechanisms of carcinogenesis induced by aberrant hedgehog signaling activation. Curr Mol Med. 2009;9(7):873–886. doi: 10.2174/156652409789105570. [DOI] [PubMed] [Google Scholar]
  16. Khurana A, et al. HSulf-1 modulates FGF-2 and hypoxia mediated migration and invasion of breast cancer cells. Cancer Res. 2011;71(6):2152–2161. doi: 10.1158/0008-5472.CAN-10-3059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Lai J, Chien J, Staub J, Avula R, Greene EL, Matthews TA, Smith DI, Kaufmann SH, Roberts LR, Shridhar V. Loss of HSulf-1 up-regulates heparin-binding growth factor signaling in cancer. J Biol Chem. 2003;278(25):23107–23117. doi: 10.1074/jbc.M302203200. [DOI] [PubMed] [Google Scholar]
  18. Lai JP, Chien J, Strome SE, Staub J, Montoya DP. HSulf-1 modulates HGF-mediated tumor cell invasion and signaling in head and neck squamous carcinoma. Oncogene. 2004;23(7):1439–1447. doi: 10.1038/sj.onc.1207258. [DOI] [PubMed] [Google Scholar]
  19. Lai, J. et al., 2004b. HSulf-1 modulates HGF-mediated tumor cell invasion and signaling in head and neck squamous carcinoma., (October 2003), pp. 1439–1447 [DOI] [PubMed]
  20. Lai JP, et al. The tumor suppressor function of human sulfatase 1 (SULF1) in carcinogenesis. J Gastrointest Cancer. 2008;39:149–158. doi: 10.1007/s12029-009-9058-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Li HF, Ling MY, Xie Y, Xie H. Establishment of a lymph node metastatic model of mouse hepatocellular carcinoma Hca-F cells in C3H/Hej mice. Oncol Res. 1998;10(11–12):569–573. [PubMed] [Google Scholar]
  22. Li J, et al. Enhanced levels of Hsulf-1 interfere with heparin-binding growth factor signaling in pancreatic cancer. Mol Cancer. 2005;4:14. doi: 10.1186/1476-4598-4-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Li J, et al. HSulf-1 inhibits cell proliferation and invasion in human gastric cancer. Cancer Sci. 2011;102(10):1815–1821. doi: 10.1111/j.1349-7006.2011.02024.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Liu H, Fu X, Ji W, Liu K, Bao L, Yan Y, Wu M, Yang J, Su C. Human sulfatase-1 inhibits the migration and proliferation of SMMC-7721 hepatocellular carcinoma cells by downregulating the growth factor signaling. Hepatol Res. 2013;43(5):516–525. doi: 10.1111/j.1872-034X.2012.01080.x. [DOI] [PubMed] [Google Scholar]
  25. Liu L, et al. hSulf-1 inhibits cell proliferation and migration and promotes apoptosis by suppressing stat3 signaling in hepatocellular carcinoma. Oncol Lett. 2014;7:963–969. doi: 10.3892/ol.2014.1848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lou X, et al. Human sulfatase 1 exerts anti-tumor activity by inhibiting the AKT/CDK4 signaling pathway in melanoma. Oncotarget. 2016;7(51):84486–84495. doi: 10.18632/oncotarget.12996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Ma H-Y, et al. HSulf-1 suppresses cell growth and down-regulates hedgehog signaling in human gastric cancer cells. Oncol Lett. 2011;2(6):1291–1295. doi: 10.3892/ol.2011.407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mahmoud S, et al. Over expression of sulfatase-1 in murine hepatocarcinoma Hca-F cell line downregulates mesothelin and leads to reduction in lymphatic metastasis, both in vitro and in vivo. Oncotarget. 2016;7:46. doi: 10.18632/oncotarget.11933. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Mondal S, et al. HSulf-1 deficiency dictates a metabolic reprograming of glycolysis and TCA cycle in ovarian cancer. Oncotarget. 2015;6(32):33705–33719. doi: 10.18632/oncotarget.5605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Narita K, Chien J, Mullany SA, Staub J, Qian X, Lingle WL, Shridhar V. Loss of HSulf-1 expression enhances autocrine signaling mediated by amphiregulin in breast cancer. J Biol Chem. 2007;282(19):14413–14420. doi: 10.1074/jbc.M611395200. [DOI] [PubMed] [Google Scholar]
  31. Nathanson SD (2003) Insights into the mechanisms of lymph node metastasis, pp. 413–423 [DOI] [PubMed]
  32. Østerlund T, Kogerman P. Hedgehog signalling: how to get from Smo to ci and Gli. Trends Cell Biol. 2006;16(4):176–180. doi: 10.1016/j.tcb.2006.02.004. [DOI] [PubMed] [Google Scholar]
  33. Pascale RM, Calvisi DF, Feo F. Sulfatase 1: a new Jekyll and Hyde in hepatocellular carcinoma? Transl Gastroenterol Hepatol. 2016;1:43–43. doi: 10.21037/tgh.2016.05.04. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Prieve, M.G. & Moon, R.T., 2003. Stromelysin-1 and mesothelin are differentially regulated by Wnt-5a and Wnt-1 in C57mg mouse mammary epithelial cells., 10, pp. 1–10 [DOI] [PMC free article] [PubMed]
  35. Roy D, et al. Loss of HSulf-1 promotes altered lipid metabolism in ovarian cancer. Cancer Metab. 2014;2(1):13. doi: 10.1186/2049-3002-2-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Song B, Tang JW, Wang B, Cui XN, Hou L, Sun L, Mao LM, Zhou CH, Du Y, Wang LH, Wang HX, Zheng RS, Sun L. Identify lymphatic metastasis-associated genes in mouse hepatocarcinoma cell lines using gene chip. World J Gastroenterol. 2005;11(10):1463–1472. doi: 10.3748/wjg.v11.i10.1463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Song PP, et al. Controversies regarding and perspectives on clinical utility of biomarkers in hepatocellular carcinoma. World J Gastroenterol. 2016;22(1):262–274. doi: 10.3748/wjg.v22.i1.262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Suvendu Das MS. Lymphatic vessel activation in cancer. Ann N Y Acad Sci. 2008;1131:235–241. doi: 10.1196/annals.1413.021. [DOI] [PubMed] [Google Scholar]
  39. Szatmári T, Ötvös R, Hjerpe A, Dobra K. Syndecan-1 in cancer: implications for cell signaling, differentiation, and prognostication. Dis Markers. 2015;2015:13. doi: 10.1155/2015/796052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Tang Z, Qian M, Ho M. The role of mesothelin in tumor progression and targeted therapy. Anti Cancer Agents Med Chem. 2013;13(2):276–280. doi: 10.2174/1871520611313020014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Torre LA, et al. Global cancer statistics, 2012. CA Cancer J Clin. 2015;65(2):87–108. doi: 10.3322/caac.21262. [DOI] [PubMed] [Google Scholar]
  42. Vecsler M, Lazar I, Tzur A. Using standard optical flow cytometry for synchronizing proliferating cells in the G1 phase. PloS One. 2013;8(12):e83935. doi: 10.1371/journal.pone.0083935. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Wang Y, et al. Mesothelin promotes invasion and metastasis in breast cancer cells. J Int Med Res. 2012;40:2109–2116. doi: 10.1177/030006051204000608. [DOI] [PubMed] [Google Scholar]
  44. Yang XP, et al. Human sulfatase-1 improves the effectiveness of cytosine deaminase suicide gene therapy with 5-fluorocytosine treatment on hepatocellular carcinoma cell line hepg2 in vitro and in vivo. Chin Med J. 2015;128(10):1384–1390. doi: 10.4103/0366-6999.156795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Yoshimatsu Y, Miyazaki H, Watabe T. Roles of signaling and transcriptional networks in pathological lymphangiogenesis ☆. Adv Drug Deliv Rev. 2016;99:161–171. doi: 10.1016/j.addr.2016.01.020. [DOI] [PubMed] [Google Scholar]
  46. Zhang H, Newman DR, Sannes PL. HSULF-1 inhibits ERK and AKT signaling and decreases cell viability in vitro in human lung epithelial cells. Respir Res. 2012;13(1):69. doi: 10.1186/1465-9921-13-69. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Cell Communication and Signaling are provided here courtesy of The International CCN Society

RESOURCES