Skip to main content
eLife logoLink to eLife
. 2018 Jun 14;7:e35518. doi: 10.7554/eLife.35518

Tenectin recruits integrin to stabilize bouton architecture and regulate vesicle release at the Drosophila neuromuscular junction

Qi Wang 1, Tae Hee Han 1, Peter Nguyen 1, Michal Jarnik 2, Mihaela Serpe 1,
Editor: Talila Volk3
PMCID: PMC6040883  PMID: 29901439

Abstract

Assembly, maintenance and function of synaptic junctions depend on extracellular matrix (ECM) proteins and their receptors. Here we report that Tenectin (Tnc), a Mucin-type protein with RGD motifs, is an ECM component required for the structural and functional integrity of synaptic specializations at the neuromuscular junction (NMJ) in Drosophila. Using genetics, biochemistry, electrophysiology, histology and electron microscopy, we show that Tnc is secreted from motor neurons and striated muscles and accumulates in the synaptic cleft. Tnc selectively recruits αPS2/βPS integrin at synaptic terminals, but only the cis Tnc/integrin complexes appear to be biologically active. These complexes have distinct pre- and postsynaptic functions, mediated at least in part through the local engagement of the spectrin-based membrane skeleton: the presynaptic complexes control neurotransmitter release, while postsynaptic complexes ensure the size and architectural integrity of synaptic boutons. Our study reveals an unprecedented role for integrin in the synaptic recruitment of spectrin-based membrane skeleton.

Research organism: D. melanogaster

eLife digest

Nerve cells or neurons can communicate with each other by releasing chemical messengers into the gap between them, the synapse. Both neurons and synapses are surrounded by a network of proteins called the extracellular matrix, which anchors, protects and supports the synapse. The matrix also helps to regulate the dynamic communication across the synapses and consequently neurons.

Little is known about the proteins of the extracellular matrix, in particular about the ones involved in structural support. This is especially important for the so-called neuromuscular junctions, where neurons stimulate muscle contraction and trigger vigorous movement. Receptor proteins on cell surfaces, such as integrins, can bind to the extracellular matrix proteins to anchor the cells and are important for all cell junctions, including synaptic junctions. But because of their many essential roles during development, it was unclear how integrins modulate the activity of the synapse.

To investigate this further, Wang et al. studied the neuromuscular junctions of fruit flies. The experiments revealed that both muscle and neurons secrete a large protein called Tenectin, which accumulates into the small space between the neuron and the muscle, the synaptic cleft. This protein can bind to integrin and is necessary to support the neuromuscular junction structurally and functionally.

Wang et al. discovered that Tenectin works by gathering integrins on the surface of the neuron and the muscle. In the neuron, Tenectin forms complexes with integrin to regulate the release of neurotransmitters. In the muscle, the complexes provide support to the synaptic structures. However, when Tenectin was experimentally removed, it only disrupted the integrins at the neuromuscular junction, without affecting integrins in other regions of the cells, such as the site where the muscle uses integrins to attach to the tendon. Moreover, without Tenectin an important intracellular scaffolding meshwork that lines up and reinforces cell membranes was no longer organized properly at the synapse.

A next step will be to identify the missing components between Tenectin/integrin complexes on the surface of neurons and the neurotransmitter release machinery inside the cells. The extracellular matrix and its receptors play fundamental roles in the development and function of the nervous system. A better knowledge of the underlying mechanisms will help us to better understand the complex interplay between the synapse and the extracellular matrix.

Introduction

The extracellular matrix (ECM) and its receptors impact every aspect of neuronal development, from axon guidance and migration to formation of dendritic spines and neuromuscular junction synaptic junctions and function. The heavily glycosylated ECM proteins provide anchorage and structural support for cells, regulate the availability of extracellular signals, and mediate intercellular communications (Reichardt and Prokop, 2011). Transmembrane ECM receptors include integrins, syndecans and the dystrophin-associated glycoprotein complex (Bökel and Brown, 2002; Häcker et al., 2005; Waite et al., 2009). Integrins in particular are differentially expressed and have an extensive repertoire, controlling multiple processes during neural development. In adults, integrins regulate synaptic stability and plasticity (Morini and Becchetti, 2010; McGeachie et al., 2011). However, integrin roles in synapse development have been obscured by their essential functions throughout development. How integrins are selectively recruited at synaptic junctions and how they engage in specific functions during synapse development and homeostasis remain unclear.

One way to confer specificity to ECM/integrin activities is to deploy specialized ECM ligands for the synaptic recruitment and stabilization of selective heterodimeric integrin complexes (Reichardt and Tomaselli, 1991). For example, at the vertebrate NMJ, three laminins containing the β2 subunit (laminin 221, 421 and 521, that are heterotrimers of α2/4/5, β2 and γ1 subunits) are deposited into the synaptic cleft and basal lamina by skeletal muscle fibers and promote synaptic differentiation. However, only laminin 421 interacts directly with presynaptic integrins containing the α3 subunit and anchors a complex containing the presynaptic Cavα and cytoskeletal and active zone-associated proteins (Carlson et al., 2010). Studies with peptides containing the RGD sequence, recognized by many integrin subtypes, have implicated integrin in the morphological changes and reassembly after induction of long-term potentiation (LTP) (reviewed in [McGeachie et al., 2011]). Several integrin subunits (α3, α5, α8, β1 and β2) with distinct roles in the consolidation of LTP have been identified, but the relevant ligands remain unknown.

Drosophila neuromuscular junction (NMJ) is a powerful genetic system to examine the synaptic functions of ECM components and their receptors. In flies, a basal membrane surrounds the synaptic terminals only in late embryos; during development, the boutons ‘sink’ into the striated muscle, away from the basal membrane (Prokop et al., 1998). The synaptic cleft relies on ECM to withstand the mechanical tensions produced by the muscle contractions. The ECM proteins, including laminins, tenascins/teneurins (Ten-a and -m) and Mind-the-gap (Mtg), interact with complexes of five integrin subunits (αPS1, αPS2, αPS3, βPS, and βν) (Broadie et al., 2011). The αPS1, αPS2 and βPS subunits localize to pre- and post-synaptic compartments and have been implicated in NMJ growth (Beumer et al., 1999; Beumer et al., 2002). The αPS3 and βν are primarily presynaptic and control activity-dependent plasticity (Rohrbough et al., 2000). The only known integrin ligand at the fly NMJ is Laminin A, which is secreted from the muscle and signals through presynaptic αPS3/βν and Focal adhesion kinase 56 (Fak56) to negatively regulate the activity-dependent NMJ growth (Tsai et al., 2012). Teneurins have RGD motifs, but their receptor specificities remain unknown (Mosca et al., 2012). Mtg secreted from the motor neurons influences postsynaptic βPS accumulation (Rushton et al., 2009), but that may be indirectly due to an essential role for Mtg in the organization of the synaptic cleft and the formation of the postsynaptic fields (Rohrbough et al., 2007; Rushton et al., 2012). The large size of these proteins and the complexity of ECM-integrin interactions made it difficult to recognize relevant ligand-receptor units and genetically dissect their roles in synapse development.

Here, we report the functional analysis of Tenectin (Tnc), an integrin ligand secreted from both motor neurons and muscles; Tnc accumulates at synaptic terminals and functions in cis to differentially engage presynaptic and postsynaptic integrin. We uncovered tnc, which encodes a developmentally regulated RGD-containing integrin ligand (Fraichard et al., 2006; Fraichard et al., 2010), in a screen for ECM candidates that interact genetically with neto, a gene essential for NMJ assembly and function (Kim et al., 2012). We found that Tnc selectively recruits the αPS2/βPS integrin at synaptic locations, without affecting integrin anchoring at muscle attachment sites. Dissection of Tnc functions revealed pre- and postsynaptic biologically active cis Tnc/integrin complexes that function to regulate neurotransmitter release and postsynaptic architecture. Finally, we exploited the remarkable features of this selective integrin ligand to uncover a novel synaptic function for integrin, in engaging the spectrin-based membrane skeleton.

Results

Tnc localizes at synaptic terminals

To search for novel ECM proteins important for NMJ development we set up a synthetic lethality screen that took advantage of the 50% lethality of an allele with suboptimal levels of Neto, neto109 (Kim et al., 2012). Neto, an obligatory subunit of ionotropic glutamate receptor (iGluR) complexes, controls the distribution and function of iGluRs as well as the assembly and organization of postsynaptic structures (Han et al., 2015; Kim et al., 2015; Ramos et al., 2015). Using this lethality screen we have previously uncovered genetic interactions between neto and several BMP pathway components (Sulkowski et al., 2014; Sulkowski et al., 2016). Lowering the dose of Mtg, an ECM protein known to organize the synaptic cleft (Rohrbough et al., 2007), induced 95% lethality (n = 286) in neto109/Y;; mtg1/+ animals, further validating our strategy. We focused on ECM candidates (Broadie et al., 2011) and identified a set of overlapping deficiencies (Df(3R)BSC-318,,–492, −494, and −655) that drastically increased the lethality of neto109 hemizygotes (from 50% for neto109/Y up to 82% for neto109/Y;; Df/+). Among the common loci disrupted by these deficiencies was tnc, a gene coding for a large mucin-type protein conserved in many insects but with no obvious mammalian homologue (Figure 1A–B) (Fraichard et al., 2006; Syed et al., 2008; Fraichard et al., 2010; Syed et al., 2012).

Figure 1. Tnc is expressed in neurons and muscles and concentrates at the synaptic cleft.

(A–B) Diagram of the tnc gene and the Tnc protein domains: vWFC (orange), Pro/Thr/Ser-rich, mucin specific domains (gray), and RGD motifs (red). The antigen for the anti-Tnc antibody is marked in green. (C–E) Western blot analyses of lysates from larval brains or muscles and transiently transfected S2 cells. Tnc can be detected in control but not in tnc mutants (C) and is reduced by knockdown of tnc in neurons or muscle (E). Tnc is efficiently secreted in the S2 cell media (S) compared with the cell pellet (P). (F–J) Confocal images of NMJ4 boutons of indicated genotypes stained for Tnc (green) and HRP (magenta). Low levels of Tnc surround synaptic boutons in control but not tnc mutant NMJs (F–G). Expression of Tnc in neurons but not in the muscles induces accumulation of Tnc-positive puncta in and around the NMJ boutons. The small puncta (asterisks) appear to be extracellular, as they are still present in detergent-free staining conditions (I), whereas the large aggregates (arrows) likely correspond to intracellular secretory compartments. Scale bars: 5 μm. Genotypes: tncEP(or 82)/Df (tncEP(or 82)/Df(3R)BSC655); N > tncRNAi (BG380-Gal4/+;UAS-tncRNAi/+); M > tncRNAi (UAS-tncRNAi/G14-Gal4); N > tnc (UAS-tnc/+; elav-Gal4/+); M > tnc (UAS-tnc/BG487-Gal4).

Figure 1.

Figure 1—figure supplement 1. Tnc distribution in embryonic and larval tissues.

Figure 1—figure supplement 1.

(A–B) Confocal images of control (A) and tnc mutant (B) stage 16 embryos stained for Tnc (green) and FasII (red). Tnc signals colocalize with neuronal marker FasII in control, but are not detectable in tnc mutant embryos. (C–D) Representative images of FasII-positive longitudinal axon tracks in the CNS of stage 17 embryos. tnc mutants have no apparent fasciculation defects. (E) Quantification of relative Tnc signals at NMJ4 shown in Figure 1F–H and J. (F–I) Low magnification confocal images of muscle 4 NMJ and nerve bundles stained for Tnc (green) and HRP (magenta). Tnc signals are concentrated at NMJ and in muscle nuclei (arrowhead). When overexpressed in the neurons, Tnc accumulates along the motor neuron axon (arrow) and at synaptic terminals. Muscle expressed Tnc is detectable throughout the muscle but is not enhance at the NMJs. Relative Tnc signals at the NMJ are quantified in (E). Scale bars: 20 μm. Genotypes: tncEP/Df (tncEP/Df(3R)BSC655); N > tnc (UAS-tnc/+; elav-Gal4/+); M > tnc (UAS-tnc/BG487-Gal4).
Figure 1—figure supplement 2. Addition of an HA tag does not change the distribution of overexpressed Tnc.

Figure 1—figure supplement 2.

(A–D) Confocal images of NMJ4 boutons of indicated genotypes stained for HA (green) and HRP (magenta). Similar to Tnc, neural expression of Tnc-HA induces accumulation of HA-positive puncta inside (arrows) and outside (asterisks) the NMJ boutons. When overexpressed with strong muscle promoters, Tnc-HA is no longer detectable at the NMJs (D). Scale bars: 5 μm. Genotypes: N > tnc HA (UAS-tnc-HA/+; elav-Gal4/+); M > tnc HA (UAS-tnc-HA/+; 24B-Gal4/+).

Tnc is a secreted molecule with five vWFC (von Willebrand factor type-C) protein interaction domains separated by two PTS-rich regions. In mucins, the PTS domains are highly O-glycosylated and form gel-like structures. Tnc has one RGD and several more RGD-like motifs that have been implicated in interaction with integrin (Fraichard et al., 2010). During development, Tnc is secreted in the lumen of several epithelial organs, including foregut, hindgut and trachea. Tnc is also expressed in the embryonic CNS. Using a polyclonal anti-Tnc antibody (Materials and methods) we found that Tnc signals are strongly enriched in the neuropile, in the proximity of the anti-Fasciclin II (FasII) positive axons (Figure 1—figure supplement 1A,B and [Fraichard et al., 2006]). The Tnc signals were absent in the CNS of a tnc mutant (tncEP- P[EPgy2]EY03355), predicted to disrupt both known tnc transcripts (Syed et al., 2012). These mutant embryos had a normal FasII pattern indicating no obvious CNS defects during late embryogenesis (Figure 1—figure supplement 1C–D). The tncEP mutant showed partial lethality (11.6% of expected homozygous progenies were viable, n = 303), which was not enhanced in heteroallelic combinations (12.2% viability for tncEP/Df, n = 392) suggesting that this mutant is equivalent to a genetic null. We also generated a small deletion mutant (tnc82) by FRT-induced recombination. These animals die as homozygous pharate adults (100% lethality, n = 221) but produce some heteroallelic escapers (17.5% viability for tnc82/Df, n = 389).

Western blot analysis revealed a Tnc-positive band of ~300 kD (the calculated MW for Tnc is 299 kD) in extracts from brains and body-wall muscles of control larvae (Figure 1C). This band was undetectable in tnc hetero-allelic combinations, tncEP/Df and tnc82/Df. A band of similar size was found in S2 cells transfected with a Tnc expression construct and was enriched in the conditioned media, indicating that Tnc is efficiently secreted in cell culture (Figure 1D, Material and methods). Neuron specific RNAi knockdown reduced Tnc levels in larval brains to 43% of the control group; this generated very strong phenotypes (below) suggesting that the residual band could reflect additional Tnc-expressing cells in the larval brain. The muscle-specific knockdown reduced the muscle Tnc levels to 19% of the control (Figure 1E).

During larval stages, we found Tnc positive signals throughout the muscles with weak accumulation at the NMJ (Figure 1F and Figure 1—figure supplement 1F). Under the same imaging conditions, the signals were significantly reduced in tncEP/Df mutants (Figure 1G and Figure 1—figure supplement 1G, quantified in Figure 1—figure supplement 1E). Such weak NMJ immunoreactivities were previously reported for proteins secreted in the synaptic cleft (Rushton et al., 2009). To further confirm the specificity of Tnc signals, we overexpressed Tnc in motor neurons (elav-Gal4) or muscles (BG487-Gal4) and examined the NMJs (Figure 1H–J and Figure 1—figure supplement 1H–I). Paneuronal expression of Tnc induced strong accumulation of Tnc-positive signals at synaptic terminals, as well as along the motor neuron axons. At these NMJs, Tnc-labeled puncta were concentrated at the edge of anti-horseradish peroxidase (HRP)-stained boutons (Jan and Jan, 1982). Most of these signals were also observed in the absence of detergents, suggesting that Tnc is secreted in the synaptic terminal. In contrast, muscle overexpression of tnc showed increased Tnc-positive signals throughout the muscle; at synaptic terminals these signals appeared diffuse and farther away from the neuronal membrane. Thus, excess muscle Tnc may not be properly targeted and/or stabilized at synaptic terminals and may have detrimental effects on Tnc-mediated functions. We repeated these results using independent HA-tagged tnc transgenes and staining with anti-HA antibodies (Figure 1—figure supplement 2). Both tagged and untagged transgenes rescued the viability of tnc mutants (see below), indicating that Tnc functions are unaffected by addition of the tag. As above, expression of tnc-HA in neurons but not in muscles induced high accumulation of HA-positive puncta, accessible without detergent, around the synaptic boutons, indicating extracellular distribution (Figure 1—figure supplement 2A–D). Thus, Tnc is expressed in both motor neurons and muscles and appears to accumulate at the ECM surrounding synaptic terminals.

tnc mutants have impaired NMJ physiology

To investigate a possible role for Tnc in the function of the nervous system and/or the musculature, we examined the morphology and physiology of tnc mutants. During larval stages, both tnc mutants (tncEP/Df and tnc82/Df) had largely normal NMJ, with minimally increased bouton numbers (Figure 2—figure supplement 1A–B). A closer examination revealed smaller boutons, with less clear bouton-interbouton delimitations (details below). The few adult escapers did not fly and exhibited climbing defects (Figure 2—figure supplement 1C). Such phenotypes are consistent with previously reported flightless adults generated by RNAi-mediated Tnc knockdown (Fraichard et al., 2010).

We next recorded the evoked excitatory junction potentials (EJPs) and spontaneous miniature excitatory junction potentials (mEJPs) from muscle 6 of third instar larvae (Figure 2A–E). The mEJPs amplitude was normal in tnc mutants. However, the mean frequency of mEJPs was significantly reduced in tnc mutants compared with the control (w1118, 2.67 ± 0.14 Hz vs. tncEP/Df, 1.68 ± 0.13 Hz, p=0.0001, and tnc82/Df, 2.11 ± 0.14 Hz, p=0.0322, Figure 2D). tnc mutations caused 23% and 18% reduction in evoked EJPs amplitude of tncEP/Df and tnc82/Df animals, respectively (w1118, 26.30 ± 0.99 mV vs. tncEP/Df, 20.15 ± 1.26 mV, p=0.0042, and tnc82/Df, 21.53 ± 1.38 mV, p=0.0375, Figure 2E). Moreover, tnc mutants showed a significant decrease in quantal content (w1118, 29.05 ± 1.81 vs. tncEP/Df, 21.44 ± 1.60 and tnc82/Df, 21.53 ± 1.38, Figure 2F). Since we found no change in the resting potential and input resistance in mutant animals, the decrease in EJPs amplitude and quantal content was probably not caused by abnormal passive membrane properties in the muscle. Instead, the reduction of quantal content could be due to a decreased number of vesicle release sites or reduced probability of release. The reduced mEJP frequency is in agreement with reduced quantal content due to fewer release sites. To evaluate the vesicle release probability, we measured the paired-pulse ratio (PPR) using the EJP amplitudes evoked by two stimuli separated by duration of 50 ms (Wong et al., 2014). At 0.5 mM extracellular Ca2+ concentration, the control larvae showed mild short-term depression following paired-pulse stimulation (PPR < 1, Figure 2G–H), indicating a relatively high initial probability of vesicle release; the second stimulus, provided before the resting Ca2+ returned to baseline, lead to the exocytosis of fewer synaptic vesicles than the first stimulus. In contrast, the tnc mutant NMJs showed elevated facilitation and significantly increased PPR (w1118, 0.80 ± 0.03 vs. tncEP/Df, 1.21 ± 0.08, p=0.0231, and tnc82/Df, 1.16 ± 0.09, p=0.0295). The higher the ratio of EJP amplitudes following the first and second pulses, the lower is the probability of release. Thus, tnc mutants have significantly decreased probability of vesicle release.

Figure 2. Reduced vesicle release probability at tnc mutant NMJs.

(A–B) Representative traces of spontaneous (A) and evoked (B) neurotransmitter release recorded from muscle 6 of indicated genotypes at 0.5 mM Ca2+. (C–F) Summary bar graphs showing the mean amplitude (C) and frequency (D) of mEJPs, the mean amplitude of EJPs (E) and the quantal content (F). The mEJPs amplitude is normal in tnc mutants, but the mEJPs frequency, EJPs amplitude and quantal content are reduced in both tnc allelic combinations. Resting potential: w1118 −61.30 ± 0.26 mV, tncEP/Df −61.27 ± 0.38 mV, tnc82/Df −61.85 ± 0.97 mV; input resistance: w1118 7.39 ± 0.40 MΩ, tncEP/Df 7.52 ± 0.72 MΩ, tnc82/Df 6.74 ± 0.24 MΩ. (G) Representative traces for paired-pulse stimulation in larvae of indicated genotypes. Paired stimuli (200 μsec, 1.9 V) were separated by duration of 50 ms. (H) Quantification of the paired-pulse ratio (% change in the amplitude of the second EJP (b) to that of the first EJP (a)) in larvae of indicated genotypes. The number of NMJs examined is indicated under each bar. Bars indicate mean ± SEM. **p<0.01, *p<0.05. Scale bars: (A): 1.5 mV- 500 ms; (B): 10 mV- 400 ms; (G): 4 mV- 50 ms.

Figure 2.

Figure 2—figure supplement 1.

Figure 2—figure supplement 1.

NMJ morphology in control and tnc mutant larvae
(A) Confocal images of third instar NMJ (muscle 4, A4) stained with HRP antibody.
tnc mutants had relatively normal NMJ morphology and only subtle changes in bouton numbers (quantified in B). (C) Climbing assay for 7 days-old adult escapers of indicated genotypes. The number of animals examined is indicated in each bar. Scale bars: 20 μm. Genotype: tncEP(or 82)/Df (tncEP (or 82)/Df(3R)BSC655)..

Neuronal Tnc modulates neurotransmitter release

Since Tnc is expressed in both pre- and post-synaptic compartments, we next examined which Tnc pool(s) is required for NMJ function. We found that tnc knockdown in motor neurons resulted in mEJPs with significantly reduced frequency as compared to the controls (tncRNAi transgene with no driver, or driver alone) (control, 2.69 ± 0.2 Hz vs. N > tncRNAi, 1.31 ± 0.10 Hz p=0.0001, and M > tncRNAi, 2.4 ± 0.17 Hz p=0.4434) (Figure 3A–C, and Figure 3—figure supplement 1). Similar results were obtained with a second RNAi line (GD14952) confirming that these phenotypes are specific to tnc depletion (Figure 3—figure supplement 1). In contrast, tnc knockdown in muscles had no effect on mEJPs frequency or amplitude. Thus, neuronal but not muscle Tnc is required for normal neurotransmitter release.

Figure 3. Presynaptic Tnc and integrin are critical for neurotransmitter release.

(A–L) Representative traces and summary bar graph for mEJPs and EJPs recorded at 0.8 mM Ca2+ from muscle 6 of indicated genotypes. The number of samples examined is indicated in each bar. (A–C) Neuronal knockdown of tnc significantly reduces the mEJPs frequency. (D–F) Neuronal but not muscle expression of Tnc can rescue the mEJPs frequency and EJP amplitude at tnc mutant NMJs. (G–L) The mean mEJPs frequency is dramatically reduced when mys/βPS integrin or if/αPS2 are knocked down in the neurons. Knockdown of if/αPS2 also induces slight reduction of the mean mEJPs amplitude and occasionally muscle attachment defects. (M–O) The trans-heterozygotes (mys/+;; tnc/+) show enhancement of phenotypes compared with individual heterozygotes, indicating that tnc and mys interact genetically. Bars indicate mean ±SEM. ns, not significant (p>0.05), ***p<0.001,***p<0.001 *p<0.05. Genotypes: N > tncRNAi (BG380-Gal4/+; UAS-tncRNAi/+); M > tncRNAi (UAS-tncRNAi/+; 24B-Gal4/+); tnc rescue control (UAS-tnc/+;tncEP/Df(3R)BSC655); N > tnc, tncEP/Df (UAS-tnc/+;tncEP/elav-Gal4,Df(3R)BSC655); M > tnc, tncEP/Df (UAS-tnc/+; tncEP/24B-Gal4, Df(3R)BSC655); N > mysRNAi (BG380-Gal4/+; UAS-Dcr-2/+; UAS-mysRNAi/+); M > mysRNAi (UAS-Dcr-2/+; UAS-mysRNAi/24B-Gal4); N > if RNAi (BG380-Gal4/+; UAS-if RNAi/UAS-Dcr-2); M > if RNAi (UAS-if RNAi/UAS-Dcr-2; 24B-Gal4/+).

Figure 3.

Figure 3—figure supplement 1. Additional control recordings.

Figure 3—figure supplement 1.

(A–B) Representative traces and summary bar graph for mEJPs frequency and amplitude recorded at 0.8 mM Ca2+ from muscle 6 of indicated genotypes. The number of samples examined is indicated in each bar. (C) Diagram of the fragments within the two UAS-tncRNAi lines utilized here relative to the known tnc transcripts. Bars indicate mean ± SEM. ns, not significant (p>0.05), ***p<0.001. Genotypes: N > tncRNAiRNAi-V (BG380-Gal4/+; UAS-tncRNAi-V/UAS-Dcr-2); M > tncRNAi (UAS-tncRNAi-V/UAS-Dcr-2; 24B-Gal4/+).

Expression of Tnc in neurons but not in muscles also rescued the mEJPs frequency and EJPs amplitude defects observed in tnc mutants (Figure 3D–F). Similar to tnc mutants, mutants carrying only a tnc transgene but no driver showed reduced mEJP frequency and EJP amplitude (compare Figure 3D–F and Figure 2). Expression of the tnc transgene in neurons, but not in muscles of tnc mutants restored the mEJPs frequency (w1118, 1.97 ± 0.27 Hz vs. N > tnc; tncEP/Df, 1.56 ± 0.18 Hz p=0.07 and M > tnc; tncEP/Df, 1.20 ± 0.16 Hz p=0.0019) and EJPs amplitude (w1118, 71.51 ± 2.39 mV vs. N > tnc; tncEP/Df, 70.1 ± 2.08 mV p=0.198 and M > tnc; tncEP/Df, 45.03 ± 3.67 mV p<0.0001) to levels that are no longer significantly different from the w1118 control. Together, these data indicate that neuron-derived Tnc regulates normal neurotransmitter release at the NMJ.

Previous studies suggest that Tnc functions as a ligand for αPS2/βPS integrin during wing morphogenesis (Fraichard et al., 2010). Drosophila integrins have been implicated in NMJ growth and synaptic function (Keshishian et al., 1996), with the βPS-containing complexes primarily in the postsynaptic compartment (Prokop et al., 1998; Beumer et al., 1999; Koper et al., 2012). If Tnc functions by recruiting integrin at the NMJ, then presynaptic but not postsynaptic βPS or αPS2 should similarly modulate the neurotransmitter release. Indeed, neuronal knockdown of myospheroid (mys), which encodes the βPS integrin subunit, significantly reduced the mEJPs frequency compared to control (mysRNAi transgene with no driver) (Figure 3G–H). In contrast, muscle knockdown of mys had no detectable effect on mEJPs frequency (control, 0.95 ± 0.14 Hz vs. N > mysRNAi, 0.47 ± 0.05 Hz p=0.0044 and M > mysRNAi, 1.00 ± 0.07 Hz p=0.9142) or amplitude. Similarly, neuronal but not muscle knockdown of inflated (if), which codes for αPS2 integrin, significantly reduced the mEJPs frequency compared to control (ifRNAi transgene with no driver) (Figure 3J–L) (control, 1.62 ± 0.51 Hz vs. N > ifRNAi, 0.99 ± 0.23 Hz p=0.0041 and M > ifRNAi, 1.67 ± 0.42 Hz p=0.9662). The ifRNAi transgene appeared stronger than mysRNAi and generated larval lethality and, occasionally, muscle attachment defects; using these transgenes we observed diminished mEJP amplitude compared to control (Figure 3L). Overall, the reduction of presynaptic αPS2/βPS mirrored the mEJP frequency deficits observed for tnc neuronal knockdown suggesting that neuron-derived Tnc functions as a ligand for presynaptic αPS2/βPS to modulate neurotransmitter release. Postsynaptic αPS2/βPS integrin does not appear to influence neurotransmitter release. Alternatively, a role for postsynaptic αPS2/βPS may be obscured by partial knockdowns and essential functions for these genes in the muscle.

If Tnc recruits integrin to modulate neurotransmitter release, then tnc and mys (or if) should interact genetically. We tested this prediction by examining the trans-heterozygote animals (mys/+;; tnc/+). Indeed, these trans-heterozygotes exhibited severe mEJP deficits that resembled tnc mutants, whereas individual heterozygote larvae (mys/+ or tnc/+) showed normal mEJPs frequency and amplitude (Figure 3M–O). This indicates that tnc and mys function together to modulate neurotransmitter release.

Muscle Tnc recruits postsynaptic integrin

If Tnc recruits and/or stabilizes βPS integrin at synaptic terminals, then Tnc should co-localize with βPS and form Tnc/integrin complexes at synaptic locations and perturbations of Tnc should alter the recruitment of βPS integrin at larval NMJ. Indeed, the βPS signals were dramatically reduced at tnc mutant NMJs (Figure 4A–D). In these analyses the βPS immunoreactivities concentrated at perisynaptic locations, surrounding the control boutons, consistent with previous observations that the muscle pool constitutes the major fraction of βPS at synaptic terminals (Beumer et al., 1999). Interestingly, the βPS levels remained unchanged at the muscle attachment sites; we also observed no detachment of the muscle fibers or defects in costamere organization (Maartens and Brown, 2015). This indicates that loss of Tnc selectively impairs the recruitment of βPS integrin at synaptic terminals. The anti-Tnc antibodies marked discrete puncta at the edge of the HRP- labeled boutons in a region strongly stained by anti-βPS antibodies, but Tnc was not detectable at the muscle attachment sites (Figure 4E–F). This suggests that Tnc and βPS may directly associate at synaptic terminals. Our attempts to co-immunoprecipitate Tnc/integrin complexes from larval carcasses failed; instead, we tested for their close juxtaposition at the NMJ using a proximity ligation assay (PLA), which indicates a less than 40 nm distance between two proteins (Wang et al., 2015). As shown in Figure 4G–H, PLA signals between Tnc and βPS were detected at control but not at tnc mutant NMJs. These PLA signals were tightly packed around the synaptic boutons, unlike the Tnc or βPS immunoreactivities, which spread into the postsynaptic specializations, suggesting that Tnc and βPS form complexes in the close proximity of the synaptic terminal. Such complexes could influence the presynaptic neurotransmitter release, as described above, but could also function in the postsynaptic compartment, where most of the perisynaptic βPS resides (see below).

Figure 4. tnc mutants have reduced perisynaptic αPS2/βPS integrin.

(A–D) Confocal images of control NMJ4 boutons and NMJ 6/7 muscle fields of indicated genotypes stained for βPS (green) and HRP (magenta). Compared to control (w1118), tnc mutant have dramatically decreased βPS signals at the NMJs (quantified in P), but normal levels at the muscle attachment sites (arrows). (E–F) Confocal images of control NMJ4 boutons stained with Tnc (yellow), βPS (green) and HRP (magenta). Like βPS, Tnc concentrates at the periphery of HRP-marked boutons (asterisks), but unlike βPS, Tnc is not present at the muscle attachment sites. (G–H’) Distribution of Tnc (yellow), βPS (green), PLA signals (cyan) (G’–H’), and HRP (magenta) in control and tnc mutant boutons. PLA signals are only observed at control NMJs and localize circumferentially to the boutons, indicating that Tnc and βPS are in close proximity at the synaptic cleft. (I–P) Confocal images of NMJ4 boutons and NMJ6/7 muscle fields of indicated genotypes stained for αPS2 (I–L) or βPS (M–O) (green), and HRP (magenta). Similar to βPS, αPS2 signals are dramatically reduced at tnc mutant NMJs (quantified in P), but are normal at the muscle attachment sites (arrows). Tissue specific tnc knockdown indicates that postsynaptic Tnc controls the βPS accumulation at synaptic locations, whereas neuron-derived Tnc appears to limit it (M–O). The number of NMJs examined is indicated in each bar. Bars indicate mean ± SEM. ***p<0.001, *p<0.05. Scale bars: (A, E, G, G’, I and M) 5 μm; (B, F and J) 20 μm. Genotypes: tncEP/Df (tncEP/Df(3R)BSC655); N > tncRNAi (BG380-Gal4/+; UAS-tncRNAi/+); M > tncRNAi (UAS-tncRNAi/+; 24B-Gal4/+)..

Figure 4.

Figure 4—figure supplement 1. Comparison of various synaptic proteins in control and tnc mutant NMJs.

Figure 4—figure supplement 1.

(A–F) Confocal images of third instar NMJ4 boutons from control and tnc mutants stained for αPS1, pFAK, or FasII (green), and HRP (magenta). tnc mutant NMJs have normal levels of αPS1 and pFAK, but significantly increased FasII signals (quantified in G). The number of samples examined is indicated in each bar. Bars indicate mean ± SEM. ns (p>0.05), **p<0.01, ns (p>0.05). Scale bars: 5 μm.
Figure 4—figure supplement 2. The inhibitory effect of neuron-derived Tnc on muscle Tnc.

Figure 4—figure supplement 2.

(A–D) Confocal images of third instar NMJ4 boutons from control and various tnc manipulations stained for Tnc (green) and HRP (magenta). While the knockdown of tnc in muscles reduces the Tnc levels at the NMJ by 37%, the neuronal knockdown of tnc leads to a significant increase in the Tnc NMJ levels, suggesting an inhibitory effect of neuron-derived Tnc onmuscle Tnc. The number of samples examined is indicated in each bar. Bars indicate mean ± SEM. ns (p>0.05), **p<0.01, ***p<0.001. Scale bars: (A) 5 μm in boutons. Genotypes: N > tncRNAi (BG380-Gal4/+; UAS-tncRNAi/+); M > tncRNAi (UAS-tncRNAi/+; 24B-Gal4/+)..

Since different integrin heterodimers provide spatial and temporal specificities, we next examined the distribution of integrin α-subunit(s) at tnc boutons. We found that αPS2 but not αPS1 levels were selectively reduced at tnc mutant NMJs (Figure 4I–K and Figure 4—figure supplement 1A–B), consistent with the RGD-containing Tnc being a ligand for αPS2/βPS (Fraichard et al., 2010). In addition, the levels of phosphorylated Fak were normal at tnc mutant NMJs (Figure 4—figure supplement 1C–D) suggesting that Tnc does not influence the LanA-induced αPS3/βν activation of the Fak signaling pathway (Tsai et al., 2008; Tsai et al., 2012). The synaptic abundance of βPS integrin subunit was inversely correlated with the synaptic accumulation of FasII, a homophilic adhesion molecule required for synapse stabilization and growth (Schuster et al., 1996a; Schuster et al., 1996b; Beumer et al., 2002). We found that FasII synaptic levels were increased by 40% (p<0.05, n = 28) in tnc mutants compared with the controls (Figure 4—figure supplement 1E–F). This increase resembles the elevated levels of FasII reported at mys mutant NMJs, and indicates that loss of Tnc recapitulates some of the phenotypes reported for selective mys mutants (Beumer et al., 2002).

Since secreted Tnc accumulates at synaptic terminals, both neuron- and muscle-derived Tnc could potentially recruit βPS. However, we found that tnc knockdown in muscles, but not in neurons, reduced the synaptic βPS levels (Figure 4M–O, quantified in P). In fact, tnc knockdown in neurons induced a significant increase of βPS synaptic levels, suggesting that neuron-derived Tnc limits the accumulation of predominantly postsynaptic βPS. This unexpected result prompted us to examine the distribution of Tnc itself in RNAi experiments (Figure 4—figure supplement 2). Compared to the control (tncRNAi transgene with no driver), tnc knockdown in motor neurons produced a significant increase (by 28%, p=0.0044, n = 27) of synaptic Tnc levels; this result is consistent with the apparent increase in Tnc net levels in muscle extracts from N > tncRNAi larvae (Figure 1E, right panel). Thus, neuron-derived Tnc limits the accumulation of muscle-derived Tnc at synaptic terminals. In contrast, tnc knockdown in muscle diminished the synaptic Tnc levels by 37% (p<0.0001, n = 30). This partial reduction may reflect an inefficient RNAi treatment and/or a complementary increase in the neuron-derived Tnc. Nonetheless our data indicate that muscle Tnc is required in cis for the postsynaptic recruitment of βPS and that neuron-derived Tnc limits the accumulation of both Tnc and βPS postsynaptically (see below).

To determine the function of Tnc in the muscle we first tested whether Tnc influences the assembly and organization of postsynaptic iGluR fields by examining the levels and distribution of various postsynaptic components. Drosophila NMJ utilizes two types of iGluRs, type-A and -B, which require the essential auxiliary protein Neto for their distribution and function. Lack of Tnc did not alter the intensities of GluRIIA and GluRIIB synaptic signals or the IIA/IIB ratio (Figure 5—figure supplement 1). This result is consistent with the normal mini amplitude observed at tnc mutant NMJs (Figure 2). Neto itself appeared properly recruited at Tnc-depleted synapses (Figure 5—figure supplement 1). In addition to iGluRs, Neto is critical for the recruitment of p21-activated kinase, PAK, a postsynaptic protein that stabilizes type-A receptors at PSDs (Ramos et al., 2015). We found that PAK signals are normal at Tnc-deprived NMJs, even though the βPS levels are reduced (Figure 5—figure supplement 1). This suggests that Neto controls PAK recruitment at synaptic terminals; alternatively, a very low level of βPS may suffice in recruiting/stabilizing PAK at synaptic terminals.

In the course of these experiments, we noted that tnc mutant NMJs have smaller boutons and often poorly defined bouton/interbouton boundaries. To characterize these defects, we first examined the distribution of HRP-marked neuronal membranes and Discs large (Dlg), a PDZ (PSD-95/Dlg/Zona occludens-1) domain-containing scaffolding protein (Budnik et al., 1996). Dlg localizes perisynaptically to the subsynaptic reticulum (SSR), a stack of membrane folds that surrounds the type I boutons (Guan et al., 1996). In the absence of Tnc, the type Ib boutons appeared significantly smaller and had diminished Dlg signals (Figure 5A–B, quantified in F-G). tnc knockdown in neurons induced a slight increase in the Dlg signals and no change in the bouton area, whereas tnc knockdown in muscles significantly decreased both the Dlg synaptic levels and the size of the type Ib boutons (Figure 5C–E). Similar reduction in bouton size has been reported for selective mys mutants (Beumer et al., 1999), suggesting that postsynaptic Tnc/integrin complexes control bouton size.

Figure 5. tnc mutants have smaller boutons and reduced SSR.

(A–E) Confocal images and analyses of third instar NMJ4 boutons of indicated genotypes stained for Dlg (green) and HRP (magenta). Compared to control, tnc mutant NMJs have smaller boutons and reduced perisynaptic Dlg levels (quantified in F–G). Knockdown of tnc in muscles but not in motor neurons recapitulates the mutant defects. (H–J) Electron micrographs of type Ib boutons. The neuronal compartment is labeled in magenta; the active zones (AZ, arrows), mitochondria (m), and subsynaptic reticulum (SSR, brackets) are indicated. The tnc mutants have sparse SSR with reduced density of the membrane layers (quantified in I). The tnc synapses appear normal (insert detail) but they reside in relatively distorted boutons. The number of samples examined is indicated in each bar. Bars indicate mean ±SEM. ns (p>0.05), *p<0.05, ***p<0.001. Scale bars: (A) 20 μm, 5 μm in boutons; (E) 2 μm, 200 nm in details. Genotypes: N > tncRNAi (BG380-Gal4/+; UAS-tncRNAi/+); M > tncRNAi (UAS-tncRNAi/+; 24B-Gal4/+)..

Figure 5.

Figure 5—figure supplement 1. tnc mutants have normal PSDs.

Figure 5—figure supplement 1.

(A–D) Confocal images of NMJ4 boutons from third instar control larvae and tnc mutants stained for GluRIIB or PAK (green), GluRIIA or Neto (red) and HRP (blue). tnc mutant NMJs have normal levels of synaptic glutamate receptors and PSD components (PAK and Neto) (quantified in E). The number of samples examined is indicated in each bar. Bars indicate mean ± SEM. ns (p>0.05). Scale bars: 3 μm.

In electron micrographs, type Ib control boutons are surrounded by a thick SSR (Figure 5H, quantified in 5I); presynaptic T-bars and electron-dense membranes mark individual synapses. The synapses appeared to have normal organization at tnc mutant boutons, with electron-dense synaptic membranes separated by a dense synaptic cleft (Figure 5J). However, the mutant boutons had irregular shapes and were surrounded by sparse SSR, with wider spaces between the membrane layers. These ultrastructural defects are consistent with the observed morphological phenotypes and indicate that muscle Tnc regulates the SSR thickness and bouton architecture.

tnc mutants have disrupted spectrin-based membrane skeleton

The tnc phenotypes may reflect increased adhesion due to elevated FasII levels (Figure 4—figure supplement 1). Alternatively, bouton architecture could be disrupted when muscles contract in the absence of a properly reinforced synaptic skeleton, including the microtubule-based and the cortical membrane skeleton. We found no microtubule defects at tnc mutant NMJs (Figure 6A–B). At the presynaptic arbor, the mature microtubule bundles that traverse the NMJ branches can be visualized with antibodies against the microtubule-associated protein Futsch. These microtubules remained organized in smooth sheaths and loops in tnc mutant larvae, similar to the control.

Figure 6. Diminished cortical skeleton at tnc mutant NMJs.

(A–B) Confocal images of NMJ4 boutons stained for Futsch (green) and HRP (magenta) reveal normal presynaptic Futsch-positive loops and microtubules bundles at tnc mutant NMJs. (C) Western blot analysis of lysates from larval carcasses show normal levels of α-Spectrin in tnc mutants. (D–I) Confocal images of NMJ4 boutons for the indicated genotypes stained for α-Spectrin (D–E), or Adducin (G–H) (green) and HRP (magenta), (quantified in F and I). α-Spectrin levels are dramatically decreased at tnc mutant NMJs; the reduction of Adducin is less drastic, but significant. The number of NMJs examined is indicated in each bar. Bars indicate mean ± SEM. ns (p>0.05), ***p<0.001. Scale bars: 5 μm.

Figure 6.

Figure 6—figure supplement 1. Tnc/integrin-mediated spectrin recruitment.

Figure 6—figure supplement 1.

(A–H) Confocal images of third instar NMJ4 boutons from control and various tnc and mys/βPS manipulations stained for α-Spectrin (green) and HRP (magenta). Neuronal knockdown of tnc significantly increases the α-Spectrin levels; muscle knockdown mildly decreases the α-Spectrin signals (quantified in D). Thus synaptic α-Spectrin generally follows the levels of synaptic Tnc (compare with Figure 4—figure supplement 2). The recruitment of α-Spectrin appears to be dependent on Tnc/integrin complexes, since muscle knockdown of mys/βPS drastically reduces α-Spectrin accumulation at synaptic terminals (quantified in H). The number of NMJs examined is indicated in each bar. Bars indicate mean ±SEM. ns (p>0.05), ***p<0.001, **p<0.01. Scale bars: 5 μm. Genotypes: N > tncRNAi (BG380-Gal4/+; UAS-tncRNAi/+); M > tncRNAi (UAS-tncRNAi/+; 24B-Gal4/+); N > mys RNAi (BG380-Gal4/+; UAS-mys RNAi/UAS-Dcr-2); M > mys RNAi (UAS-mys RNAi/UAS-Dcr-2; 24B-Gal4/+).

In contrast, loss of tnc severely disrupted the α-Spectrin accumulation at the NMJs (Figure 6C–F). The net levels of α-Spectrin were normal in extracts from tnc larval muscles, as determined by Western blot analysis, but the synaptic abundance of α-Spectrin at tnc NMJs was reduced to 37% from control levels (p<0.001, n = 21). Since α-Spectrin is essential for the integrity of the SSR (Pielage et al., 2006), loss of synaptic α-Spectrin is consistent with the sparse SSR observed at tnc mutant NMJs. Moreover, α- and β-spectrin mutant embryos have reduced neurotransmitter release and diminished EJPs amplitudes without any apparent defects in postsynaptic receptor fields (Featherstone et al., 2001); these defects are reminiscent of Tnc-deprived NMJs. Interestingly, the distorted shapes of tnc mutant boutons resemble the less individuated boutons seen in α-spectrinR22S larvae, which are impaired for spectrin tetramerization (Khanna et al., 2015). Tetramerization is required for formation of the spectrin-based membrane skeleton (SBMS) but is not required for viability in Drosophila, whereas spectrins are essential genes (Lee et al., 1993; Pielage et al., 2005; Pielage et al., 2006). A key protein involved in the organization of SBMS is Adducin (Bennett and Baines, 2001). Drosophila adducin gene encodes several isoforms, all but one detectable with the anti-Adducin antibody 1B1 (Wang et al., 2014). Using this antibody, we found that Adducin is also diminished at tnc mutant terminals (Figure 6G–I). These data suggest that Tnc is required for the proper recruitment of SBMS at the NMJ.

Similar to βPS, the accumulation of α-Spectrin at synaptic terminals appeared to be limited by neuronal Tnc and promoted by muscle-derived Tnc, as indicated by knockdown analyses (Figure 6—figure supplement 1A–D). Moreover, the changes in synaptic α-Spectrin levels followed the variations in integrin levels at synaptic terminals, since manipulations of mys/(βPS) elicited a similar profile for the synaptic α-Spectrin (Figure 6—figure supplement 1E–H). Together our data suggest that the postsynaptic Tnc/integrin complexes function to recruit the SBMS at synaptic terminals; this activity seems restricted by neuron-derived Tnc, which appears to limit the accumulation and function of postsynaptic complexes. Complete loss of Tnc triggers severe reduction of integrin and α-Spectrin at synaptic terminals, consistent with the observed disruption of bouton architecture.

Overexpression of Tnc disrupts postsynaptic βPS integrin and spectrin

Since neuron-derived Tnc recruits βPS integrin in the motor neurons to modulate neurotransmitter release (Figure 3), we next examined whether muscle Tnc functions similarly in cis to recruit postsynaptic integrin and SBMS and ensure bouton integrity. For this rescue experiment we used a wide range of Tnc levels and monitored both βPS accumulation and postsynaptic function (Ib bouton area) (Figure 7A–G). Paneuronal expression of Tnc rescued the postsynaptic βPS accumulation at tnc mutant NMJs; however, these animals had small, tnc-like boutons. Thus, neuron-derived Tnc can engage postsynaptic βPS to form non-productive complexes that cannot restore the bouton architecture. When low levels of Tnc were provided in the muscle using a weak promoter and low rearing temperatures (Figure 7D), βPS accumulation was rescued to levels exceeding the control and bouton size was fully restored. In contrast, high levels of Tnc induced massive lethality and exacerbated the loss of βPS at tnc mutant NMJs; these larvae had poorly defined boutons, with almost tubular NMJ branches (Figure 7E). Together these results indicate that only low levels of muscle Tnc could rescue the distribution and function of postsynaptic Tnc/integrin complexes, while excess muscle Tnc is toxic. On the other hand, neuron-derived Tnc can recruit and/or stabilize integrin but cannot form fully functional complexes. In support of this interpretation, we found that only low levels of muscle Tnc could fully restore the accumulation of α-Spectrin at tnc mutant NMJs (Figure 7H–M); neuronal Tnc induced only a modest increase in synaptic α-Spectrin levels.

Figure 7. Tnc expression restores the synaptic accumulation of βPS at tnc mutant NMJs.

(A–M) Confocal images of NMJ4 boutons of indicated genotypes stained for βPS integrin (A–E) or α-Spectrin (H–L) (green) and HRP (magenta). The animals were reared at 25°C unless marked otherwise. When expressed in neurons, high levels of Tnc could restore the accumulation of βPS at tnc mutant NMJs (quantified in F). However, in these animals the boutons remain small, resembling the tnc mutant boutons (quantified in G). For the muscle rescue, Tnc levels were controlled using two different promoters and rearing the animals at 18°C (low expression) or 25°C (moderate). Low levels of muscle Tnc produce substantial accumulation of βPS integrin at tnc NMJs, above the control levels, and fully rescued the boutons size; high level of muscle Tnc further decreased the βPS accumulation at tnc NMJs. The α-Spectrin synaptic levels are restored only when Tnc is provided at low levels in the muscle. The number of samples examined is indicated in each bar. Bars indicate mean ±SEM. ***p<0.001. Scale bars: 5 μm. Genotypes: control (UAS-tnc/+;tncEP/Df(3R)BSC655); N > tnc, tncEP/Df (UAS-tnc/+;tncEP/elav-Gal4, Df(3R)BSC655); M1 >tnc, tncEP/Df (BG487-Gal4/UAS-tnc; tncEP/Df(3R)BSC655); M2 >tnc, tncEP/Df (UAS-tnc/+; tncEP/24B-Gal4, Df(3R)BSC655)..

Figure 7.

Figure 7—figure supplement 1. Western blot analysis of protein lysates from brains or muscles of third instar larvae of indicated genotypes stained for Tnc (green) (predicted MW is 299 kD), and Tubulin (red).

Figure 7—figure supplement 1.

The polyclonal anti-Tnc antibodies label one specific band in all samples, except for muscle extracts from larvae with excess muscle Tnc (lane 8). For lane 8, the short exposure captures apparently multiple Tnc-positive species (arrows). (*) non-specific staining. Genotypes: N > tnc (UAS-tnc/+; elav-Gal4/+); M > tnc (UAS-tnc/+; 24B-Gal4/+)..

The fact that the trans Tnc/integrin complexes cannot rescue the bouton size suggests that the cis and trans complexes have different activities. This could be due to different processing or post-translational modifications of Tnc in motor neurons vs. muscles, which have been reported to modulate the activity of ligand-integrin complexes (Reichardt and Tomaselli, 1991). Our Western blot analyses did not provide clear evidence for different post-translational modifications for neuron- and muscle-derived Tnc, although the large Tnc-specific band appeared to include multiple species only when Tnc was overexpressed in the muscle (Figure 7—figure supplement 1). Alternatively, neuron- and muscle-derived Tnc may be packaged differently and/or associate with molecules that influence their activities. Indeed, Tnc has multiple vWFC domains and RGD-like motifs that could enable a large repertoire of protein interactions.

Our rescue results may also reflect different distributions for neuron- and muscle-derived Tnc: While neuron-secreted Tnc accumulates at synaptic terminals, muscle-secreted Tnc likely distributes throughout the muscle membrane and may sequester integrin away from NMJ locations, further reducing the βPS accumulation at synaptic terminals. To test this possibility, we overexpressed Tnc in an otherwise wild-type genetic background and examined the βPS signals at perisynaptic vs. muscle attachment sites. In these experiments we observed no changes in βPS levels and distribution at muscle attachment sites or costameres (not shown). However, βPS recruitment at larval NMJ was drastically reduced when Tnc was overexpressed in either neurons or muscles (Figure 8A–E). Neuronal excess of Tnc produced a reduction of βPS synaptic levels (to 54% from control, p=0.0002, n = 23), and activities, as reflected by the reduction of bouton size compared with the control (transgene only) (Figure 8F). Excess Tnc in the muscles practically abolished the perisynaptic βPS signals. With strong muscle drivers (24B-Gal4 in Figure 8D, or G14-Gal4 in Figure 8—figure supplement 1), these larvae showed ribbon-like NMJs with no interbouton/bouton delimitations exceeding the severity of defects observed at tnc mutant NMJs (not shown). A significant number of these animals died during larval and pupal stages and only 46% (n = 211) of third instar larvae developed into adult flies.

Figure 8. Excess Tnc disrupts the βPS accumulation at synaptic terminals.

(A–D) Confocal images of NMJ4 boutons of indicated genotypes stained for βPS (green) and HRP (magenta) (quantified in E). Excess Tnc induces drastic reductions of synaptic βPS levels compared with controls. Compared with the transgene alone control (B), neuronal Tnc significantly reduces the bouton area (quantified in F). Overexpression of Tnc in the muscle completely disrupts the NMJ bouton-interbouton boundaries. (G–H’) Confocal images of third instar NMJ4 boutons stained for Tnc (Cyan), βPS (green) and HRP (magenta). A pulse of tnc expression in larval muscles (in larvae reared at 18°C and shifted at 25°C for 8 hr) increases the levels of Tnc at synaptic terminals and diminishes the postsynaptic βPS signals. The remaining βPS immunoreactivities appear as thin lines (between arrows) localized inside the boutons. The number of samples examined is indicated in each bar. Bars indicate mean ±SEM. ns (p>0.05), ***p<0.001, **p<0.01. Scale bars: 5 μm. Genotypes: N > tnc (UAS-tnc/+;elav-Gal4/+); M1 >tnc (UAS-tnc/BG487-Gal4); M2 >tnc (UAS-tnc/+;24B-Gal4/+).

Figure 8.

Figure 8—figure supplement 1. Deleterious effects of excess muscle Tnc.

Figure 8—figure supplement 1.

(A–D) Confocal images of NMJ4 boutons stained for α-Spectrin (A–B) or Adducin (C–D) (in green) and HRP (magenta) (quantified in E). Excess Tnc in the muscle disrupts the spectrin-rich membrane skeleton. The number of samples examined is indicated in each bar. Bars indicate mean ± SEM. ns (p>0.05), ***p<0.001. Scale bars: 5 μm. Genotypes: M > tnc (UAS-tnc/G14-Gal4).

The toxicity of excess Tnc during development prompted us to examine the distribution of βPS after a short (8 hr) pulse of Tnc expression in the muscle, using BG487-Gal4 to induce moderate, gradient muscle expression (Figure 8G–H’). This pulse triggered an increase in Tnc immunoreactivities, which distributed diffusely around the synaptic terminals. Importantly the βPS signals were also drastically diminished, particularly at postsynaptic locations. The βPS signals were no longer concentrated around the synaptic boutons, and instead appeared as thin lines inside the boutons, along the HRP-marked neuronal membrane. Thus, it appears that excess Tnc in the muscle gradually disrupted the postsynaptic βPS accumulation, revealing a small but clear pool of presynaptic βPS; further Tnc overexpression in the muscle completely disrupted both the Tnc and βPS synaptic accumulation and altered the boutons morphology. This dose dependent depletion of Tnc and βPS synaptic signals indicates that excess Tnc may form large aggregates that may be physically excluded from the intercellular space and dispersed away from the synaptic terminals. Alternatively, excess Tnc may trap integrin in the secretory compartment and/or overload a limiting step for the synaptic targeting and recruitment of Tnc/integrin complexes. We favor the former possibility because (i) Tnc itself diffused away from the synaptic terminal when in mild excess, (ii) Tnc has been previously implicated in the formation of large aggregates that fill the lumen of epithelial organs (Syed et al., 2012), and (iii) simple disruption of Tnc trafficking and targeting within the muscle cannot explain the loss of presynaptic integrin accumulation and function (Figure 8D–E and not shown).

To our knowledge this is the first example where genetic manipulations completely abolished the synaptic accumulation of βPS integrin. These larvae also exhibited drastically reduced levels of synaptic α-Spectrin and Adducin (Figure 8—figure supplement 1). Together these results indicate that optimal levels of secreted Tnc are required for proper βPS accumulation at the NMJ, which ensures normal NMJ morphology and function. These experiments also uncovered a novel function for βPS integrin in anchoring α-Spectrin at synaptic locations and coupling the ECM of the synaptic cleft (Tnc) with the spectrin-based membrane skeleton.

Tnc engages integrin and spectrin at the cell membrane

To examine whether Tnc directed the recruitment of integrin and spectrin complexes at the cell membrane, we took advantage of our ability to produce full-length Tnc and Tnc-HA proteins in S2 and S2R + insect cells. Secreted Tnc-HA was concentrated from S2 conditioned media, affinity coupled to Neutravidin beads of 1 μm diameter, then presented to S2R + cells, which express relatively high levels of integrin and spectrin. Unlike control beads (coated with an unrelated HA-tagged protein), Tnc-HA-coupled beads induced a local accumulation of βPS at the periphery of S2R + cells, in the close proximity of the beads (Figure 9A–B). This local recruitment of βPS was not caused by mechanical stress, since control beads, either alone or in clusters, did not trigger βPS accumulation. The βPS recruitment was dose-dependent, as beads with variable Tnc-HA levels elicited proportional βPS accumulation (not shown). The Tnc-coupled beads triggered local recruitment of αPS2 but not αPS1 integrin subunit at the surface of S2R+ cells (Figure 9C–D, and not shown). This is consistent with our NMJ observations (Figure 4) and with previous reports on small Tnc fragments mediating αPS2/βPS-dependent spreading of S2 cells via RGD and RGD-like motifs (Fraichard et al., 2010). Moreover, the Tnc-HA-coupled beads induced similar accumulation of α-Spectrin and Adducin at the bead-cell membrane interfaces (Figure 9E–J). Thus Tnc triggers the local recruitment of α-Spectrin and Adducin at the cell membrane. Whether this recruitment is mediated either directly by integrin or indirectly, via other integrin activated scaffolds, remains to be determined. Our attempts to knockdown βPS in S2R + cells, and establish a requirement for integrin for Tnc-induced α-Spectrin recruitment, were hampered by an incomplete RNAi knockdown. Nonetheless, our data establish that Tnc provides a powerful means to recruit and/or stabilize integrin and cortical skeleton components at synaptic terminals.

Figure 9. Tnc directs accumulation of integrin and spectrin at the cell membrane.

(A–H) Phase contrast and confocal microscopy images of S2R + cells presented with control (Tld-HA-) and Tnc-HA-coated beads and stained for βPS, αPS2, α-Spectrin or Adducin (in red), HA (green), and DAPI (blue). Arrows indicate control and arrowheads point to Tnc-HA-coated beads, enlarged in details on the right. The Tnc-HA-coupled beads, but not the control, induce strong accumulation of βPS at the bead-cell membrane interfaces, as indicated in the lateral projections, along the dotted lines. The accumulation of αPS2, α-Spectrin or Adducin is also significant in the proximity of Tnc-HA-coupled beads, which appear yellow, in contrast to control beads that remain green. Scale bars: 5 μm, 1 μm in details.

Figure 9.

Figure 9—figure supplement 1. Cell expressing Tnc have elevated levels of βPS.

Figure 9—figure supplement 1.

(A–B) S2R + cells transfected with Tnc-HA stained for HA (green), βPS (red) and DAPI (blue) and analyzed by confocal microscopy. Comparing with control, cells expressing Tnc-HA have overall elevated βPS levels; the frequency and distribution of Tnc-HA and βPS-positive aggregates suggest that Tnc may aid the surface expression of βPS. Scale bars: 20 μm.

Although extracellular Tnc binds integrin on cell surfaces, our genetic analyses indicate that in vivo Tnc functions in cis. This suggests that Tnc positively affects the surface delivery and/or stabilization of βPS integrin. We tested this possibility by following Tnc and βPS levels and distribution in S2R + cells transiently transfected with Tnc (Figure 9—figure supplement 1). In this system, Tnc or Tnc-HA were efficiently secreted and accumulated in the media. Inside the cells, Tnc marked large aggregates, likely corresponding to secretory compartments. We found that βPS levels were significantly elevated in cells expressing Tnc; also, βPS co-localized with Tnc in large intracellular aggregates, suggesting that (a) Tnc promotes βPS secretion, and that (b) βPS and Tnc likely associate during intracellular trafficking. It is also possible that excess Tnc may trap βPS inside the secretory compartment, although Tnc appeared to be efficiently secreted and βPS levels were elevated throughout the Tnc-positive cells. Binding to Tnc may stabilize βPS at the cell surface through clustering of integrin complexes and/or by conformational changes and activation of integrins (Liddington and Ginsberg, 2002). In both cases, Tnc binding could reduce the rate of βPS integrin endocytosis as well as overall turnover (López-Ceballos et al., 2016), which may explain the elevated levels of βPS observed in Tnc-expressing cells.

Discussion

The ECM proteins and their receptors have been implicated in NMJ development, but their specific roles have been difficult to assess because of their early development functions and the complexity of membrane interactions they engage. In this study, we have shown that Tnc is a selective integrin ligand that enables distinct pre- and post-synaptic integrin activities mediated at least in part through the local engagement of the spectrin-based cortical skeleton. First, Tnc depletion altered NMJ development and function and correlated with selective disruption of αPS2/βPS integrin and spectrin accumulation at synaptic terminals. Second, manipulation of Tnc and integrin in neurons demonstrated that presynaptic Tnc/integrin modulate neurotransmitter release (Figure 3); spectrin mutations showed similar disruptions of the presynaptic neurotransmitter release (Featherstone et al., 2001). Third, postsynaptic Tnc influenced the development of postsynaptic structures (bouton size and SSR complexity), similar to integrin and spectrin (Figures 3 and 4 and [Beumer et al., 1999; Pielage et al., 2006]). Fourth, presynaptic Tnc/integrin limited the accumulation and function of postsynaptic Tnc/integrin complexes (Figures 4, 5, 7 and 8). Fifth, secreted Tnc bound integrin complexes at cell membranes, but only the cis complexes were biologically active (Figures 7 and 9); trans Tnc/integrin complexes can form but cannot function at synaptic terminals and instead exhibited dominant-negative activities (Figures 7 and 8). These observations support our model that Tnc is a tightly regulated component of the synaptic ECM that functions in cis to recruit αPS2/βPS integrin and the spectrin-based membrane skeleton at synaptic terminals and together modulate the NMJ development and function.

Tnc expands the repertoire of ECM synaptic functions

Tnc appears to fulfill unique, complementary functions with the other known synaptic ECM proteins at the Drosophila NMJ. Unlike Mtg, which organizes the active zone matrix and the postsynaptic domains (Rohrbough et al., 2007; Rushton et al., 2009), Tnc does not influence the recruitment of iGluRs and other PSD components. LanA ensures a proper adhesion between the motor neuron terminal and muscle (Koper et al., 2012) and also acts retrogradely to suppress the crawling activity-dependent NMJ growth (Tsai et al., 2012). The latter function requires the presynaptic βν integrin subunit and phosphorylation of Fak56 via a pathway that appears to be completely independent of Tnc. Several more classes of trans-synaptic adhesion molecules have been implicated in either the formation of normal size synapses, for example Neurexin/Neuroligin, or in bridging the pre- and post-synaptic microtubule-based cytoskeleton, such as Teneurins (Banovic et al., 2010; Mosca et al., 2012). However, genetic manipulation of Tnc did not perturb synapse assembly or microtubule organization, indicating that Tnc functions independently from these adhesion molecules. Instead, Tnc appears to promote expression and stabilization of αPS2/βPS complexes, which in turn engage the spectrin-based membrane skeleton (SBMS) at synaptic terminals. On the presynaptic side these complexes modulate neurotransmitter release. On the postsynaptic side, the Tnc-mediated integrin and spectrin recruitment modulates bouton morphology. A similar role for integrin and spectrin in maintaining tissue architecture has been reported during oogenesis; egg chambers with follicle cells mutant for either integrin or spectrin produce rounder eggs (Bateman et al., 2001; Ng et al., 2016).

Our data are consistent with a local function for the Tnc/βPS-recruited SBMS at synaptic terminals; this is distinct from the role of spectrin in endomembrane trafficking and synapse organization (Kizhatil et al., 2007; Lorenzo et al., 2010; Tjota et al., 2011). Embryos mutant for spectrins have reduced neurotransmitter release (Featherstone et al., 2001), a phenotype shared by larvae lacking presynaptic Tnc or βPS integrin (Figures 3 and 4). However, Tnc perturbations did not induce synapse retraction and axonal transport defects as seen in larvae with paneuronal α- or β- spectrin knockdown (not shown) (Pielage et al., 2005). Spectrins interact with ankyrins and form a lattice-like structure lining neuronal membranes in axonal and interbouton regions (Koch et al., 2008; Pielage et al., 2008; Goellner and Aberle, 2012). We found that Tnc manipulations did not affect the distribution of Ankyrin two isoforms (Ank2-L and Ank2-XL) in axons or at the NMJ (not shown); also loss of ankyrins generally induces boutons swelling, whereas Tnc perturbations shrink the boutons and erode bouton-interbouton boundaries. Like tnc, loss of spectrins in the striated muscle shows severe defects in SSR structure ([Pielage et al., 2006] and Figure 5). Lack of spectrins also disrupts synapse assembly and the recruitment of glutamate receptors (Pielage et al., 2005; Pielage et al., 2006). In contrast, manipulations of tnc had no effect on PSD size and composition (Figure 5—figure supplement 1). Instead, tnc perturbations in the muscle led to boutons with altered size and individualization and resembled the morphological defects seen in spectrin tetramerization mutants, spectrinR22S (Khanna et al., 2015). spectrinR22S mutants have more subtle defects than tnc, probably because spectrin is properly recruited at NMJs but fails to crosslink and form a cortical network. Spectrins are also recruited to synaptic locations by Teneurins, a pair of transmembrane molecule that form trans-synaptic bridges and influence NMJ organization and function (Mosca et al., 2012). Drosophila Ten-m has an RGD motif; we found that βPS levels were decreased by 35% at ten-mMB mutant NMJs (not shown). Thus, Ten-m may also contribute to the recruitment of integrin and SBMS at the NMJ, a function likely obscured by the predominant role both play in cytoskeleton organization.

We have previously reported that α-Spectrin is severely disrupted at NMJs with suboptimal levels of Neto, such as neto109- a hypomorph with 50% lethality (Kim et al., 2012). These mutants also had sparse SSR, reduced neurotransmitter release, as well as reduced levels of synaptic βPS ([Kim et al., 2012] and not shown). In this genetic background, lowering the dose of tnc should further decrease the capacity to accumulate integrin and spectrin at synaptic terminals and enhance the lethality. This may explain the increased synthetic lethality detected in our genetic screen.

Tnc and NMJ development

In flies or vertebrates, the ECM proteins that comprise the synaptic cleft at the NMJ are not fully present when motor neurons first arrive at target muscles. Shortly thereafter, the neurons, muscles and glia begin to synthesize, secrete and deposit ECM proteins. At the vertebrate NMJ, deposition of the ECM proteins forms a synaptic basal lamina that surrounds each skeletal myofiber and creates a ~ 50 nm synaptic cleft. In flies, basal membrane contacts the motor terminal in late embryos, but is some distance away from the synaptic boutons during larval stages (Prokop et al., 1998). Nonetheless, the NMJ must withstand the mechanical tensions produced by muscle contractions. Our data suggest that Tnc is an ideal candidate to perform the space filling, pressure inducing functions required to engage integrin (Pines et al., 2012) and establish a dynamic ECM-cell membrane network at synaptic terminals. First, Tnc is a large mucin with extended PTS domains that become highly O-glycosylated, bind water and form gel-like complexes that can extend and induce effects similar to hydrostatic pressure (Syed et al., 2008). In fact, Tnc fills the lumen of several epithelial tubes and forms a dense matrix that acts in a dose-dependent manner to drive diameter growth. Second, the RGD and RGD-like motifs of Tnc have been directly implicated in αPS2/βPS-dependent spreading of S2 cells (Fraichard et al., 2010). Third, secreted Tnc appears to act close to the source (Syed et al., 2012), presumably because of its size and multiple interactions. In addition to the RGD motifs, Tnc also contains five complete and one partial vWFC domains, that mediate protein interactions and oligomerization in several ECM proteins including mucins, collagens, and thrombospondins (Bork, 1991). The vWFC domains are also found in growth factor binding proteins and signaling modulators such as Crossveinless-2 and Kielin/Chordin (Lin et al., 2005; Wharton and Serpe, 2013) suggesting that Tnc could also influence the availability of extracellular signals. Importantly, Tnc expression is hormonally regulated during development by ecdysone (Fraichard et al., 2010). Tnc does not influence integrin responsiveness to axon guidance cues during late embryogenesis; unlike integrins, the tnc mutant embryos have normal longitudinal axon tracks (Figure 1—figure supplement 1 and [Stevens and Jacobs, 2002]). Instead, Tnc synthesis and secretion coincide with the NMJ expansion and formation of new bouton structures during larval stages. Recent studies have reported several mucin-type O-glycosyltransferases that modulate integrin signaling and intercellular adhesion in neuronal and non-neuronal tissues, including the Drosophila NMJ (Tran and Ten Hagen, 2013; Dani et al., 2014). Tnc is likely a substrate for these enzymes that may further regulate Tnc activities.

Uncover novel integrin functions via selective ligands

In flies as in vertebrates, integrins play essential roles in almost all aspects of synaptic development. Early in development, integrins have been implicated in axonal outgrowth, pathfinding and growth cone target selection (Myers et al., 2011). In adult flies, loss of αPS3 integrin activity is associated with the impairment of short-term olfactory memory (Grotewiel et al., 1998). In vertebrates, integrin mediates structural changes involving actin polymerization and spine enlargement to accommodate new AMPAR during LTP, and ‘lock in’ these morphological changes conferring longevity for LTP (McGeachie et al., 2011). Thus far, integrin functions at synapses have been derived from compound phenotypes elicited by use of integrin mutants, RGD peptides, or enzymes that modify multiple ECM molecules (Rohrbough et al., 2000; McGeachie et al., 2011; Dani et al., 2014). Such studies have been complicated by multiple targets for modifying enzymes and RGD peptides and by the essential functions of integrin in cell adhesion and tissue development.

In contrast, manipulations of Tnc, which affects the selective recruitment of αPS2/βPS integrin at synaptic terminals, have uncovered novel functions for integrin and clarified previous proposals. We demonstrate that βPS integrin is dispensable for the recruitment of iGluRs at synaptic sites and for PSD maintenance. We reveal an unprecedented role for integrin in connecting the ECM of the synaptic cleft with spectrin, in particular to the spectrin-based membrane skeleton. These Tnc/integrin/spectrin complexes are crucial for the integrity and function of synaptic structures. Our studies uncover the ECM component Tnc as a novel modulator for NMJ development and function; these studies also illustrate how manipulation of a selective integrin ligand could be utilized to reveal novel integrin functions and parse the many roles of integrins at synaptic junctions.

Materials and methods

Fly stocks

To generate the tnc82 allele, transposons PBac[RB]e01245 and PBac[WH]f00323 were mobilized by FRT-induced recombination as previously described (Parks et al., 2004; Thibault et al., 2004). The UAS-tnc lines were generated by insertion of the tnc cDNA in pUAST vector and germline transformation (BestGene, Inc.). The following fly lines were obtained from the Bloomington Stock Center: the P-element lines tncEP (P[EPgy2]EY03355) and ten-m mutant Mi[ET1]Ten-mMB10734 (Bellen et al., 2004); the deficiency lines Df(3R)BSC-318,,–492, −494, and −655 (Parks et al., 2004); and the TRIP lines UAS-tncRNAi (P[TRIP.HMC05051] attP40), and UAS-mysRNAi (P[TRIP.JF02819] attP2), and UAS-if RNAi (P[TRiP.HMS01872]attP40). Additional tnc, mys and if RNAi lines showed similar phenotypes, but were not reported here because of mild effects (such as for UAS-tncRNAi line from Vienna Drosophila RNAi Center, P[GD14952]v42326), or aberrant muscle development (in the case of mys and if knockdown). Other fly stocks used in this study were previously described: neto109 (Kim et al., 2012); UAS-Dlg (Budnik et al., 1996); 24B-Gal4, elav-Gal4, G14-Gal4, BG487-Gal4.

Full-length cDNA for tnc was assembled in pRM-Tlr plasmid (Serpe and O'Connor, 2006) from the following elements: (1) a synthetic PinAI/SalI fragment joining the Tolloid-related signal peptide with the 5’ of tnc CDS; (2) SalI 7 kb fragment isolated from BACPAC CH322-177A22 (Venken et al., 2009); (3) SalI/XhoI PCR product covering the 3’ of tnc CDS. We used this plasmid to introduce two HA tags in two steps: (1) replace the SalI 7 kb fragment with a pair of primers that introduced 2xHA tags separated by a SalI site; (2) reintroduce SalI kb fragment. The primers used here were:

For-5’-Phos- TCGAGCTATCCCTATGACGTCCCGGACTATGCACAGTCGACTACCCGTACGATGTGCCCGATTACGCAC and Rev: 5’-Phos-

TCGAGTGCGTAATCGGGCACATCGTACGGGTAGTCGACTGTGCATAGTCCGGGACGTCATAGGGATAGC. All constructs were verified by DNA sequencing. UAS-tnc lines were generated by insertion of the tnc cDNA in pUAST and germline transformation (BestGene, Inc.).

To measure the climbing ability, a custom device to fractionate populations based on negative geotaxis was used (Benzer, 1967). The flies were placed in the first tube (numbered 0) and left to recover for 2 hr. The fractionation consisted of sequential cycles of tapping down the flies, and moving the flies that climbed above the threshold in 15 s to the next tube. The climbing index was calculated by the formula (1xN1 + 2xN2 + 3xN3 + 4xN4 + 5xN5)/N, where Nr is the number of flies in fraction r, and N is the total number of flies.

Protein and tissue culture analyses

Drosophila S2 and S2R+ cells were used for expression of recombinant proteins and immunohistochemistry as described previously (Serpe et al., 2008). For protein analysis, wandering third instar larvae were dissected, and brains or the body wall (muscle and cuticle) were isolated. The tissues were mechanically disrupted and lysed in lysis buffer (50 mM Tris-HCl, 150 mM NaCl, 1% Triton X-100, 1% deoxycholate, protease inhibitor cocktail (Roche) for 30 min on ice. The lysates were separated by SDS-PAGE on 4–12% NuPAGE gels (Invitrogen) and transferred onto PVDF membranes (Millipore). The rabbit polyclonal anti-Tnc antibodies were generated as previously described (Fraichard et al., 2006) against a synthetic peptide (APVQEYTEIQQYSEGC) (Pacific Immunology Corp.) and affinity purified. Primary antibodies were used at the following dilutions: rabbit anti-Tnc 1:1,000; anti-Tubulin (Sigma-Aldrich), 1:1000; mouse anti-α-Spectrin (3A9), 1:50. Immune complexes were visualized using secondary antibodies coupled with IR-Dye 700 or IR-Dye 800 followed by scanning with the Odyssey infrared imaging system (LI-COR® Biosciences).

Neutravidin beads of 1 μm diameter (Life Technologies) were washed in PBS and preloaded for 30 min at room temperature (RT) with biotin conjugated anti-HA antibody (clone 3F10, Roche). An unrelated HA-tagged protein, Tolloid (Tld), was used as a control (Serpe and O'Connor, 2006). Tld-HA and Tnc-HA were concentrated from S2 conditioned media using Amicon Ultra filters (10 kDa) and bound to the preloaded beads overnight. The beads were washed with PBS and presented for 1.5 hr to S2R + cells cultured on chambered coverglass (Thermo Fisher) at 26°C. Cells were next fixed with 4% PFA for 20 min and stained using standard procedures as described below.

Immunohistochemistry

Wandering third instar larvae were dissected as described previously in ice-cooled Ca2+-free HL-3 solution (Stewart et al., 1994; Budnik et al., 2006). Embryos were collected and fixed using standard procedures (Patel, 1994). Primary antibodies from Developmental Studies Hybridoma Bank were used at the following dilutions: mouse anti-GluRIIA (8B4D2), 1:100; mouse anti-Dlg (4F3), 1:1000; mouse anti-Brp (Nc82), 1:200; mouse anti-α-Spectrin (3A9), 1:50; mouse anti-FasII (1D4), 1:10; mouse anti-Futsch (22C10), 1:100; mouse anti-Adducin (1B1), 1:50; mouse anti-βPS integrin (CF.6G11) 1:10; mouse anti-αPS1 integrin (DK.1A4) 1:10; mouse anti-αPS2 integrin (CF.2C7) 1:10. Other primary antibodies were utilized as follow: rabbit anti-Tnc 1:100; rat anti-HA (3F10) (Lu and Roche, 2012) 1:500; rabbit anti-FAK (phospho Y397) (Abcam, ab39967), 1:100; rabbit anti-GluRIIB, 1:2000; rabbit anti-GluRIIC, 1:1000 (Ramos et al., 2015); rabbit anti-PAK, 1:5000 (a gift from Nicholas Harden) (Conder et al., 2004); 1:1000; rat anti-Neto, 1:1000 (Kim et al., 2012); and Cy5- conjugated goat anti-HRP, 1:1000 (Jackson ImmunoResearch Laboratories, Inc.). Alexa Fluor (AF) 405-, AF488-, AF568-, and AF647- conjugated secondary antibodies (Molecular Probes) were used at 1:200. All samples were mounted in ProLong Gold (Invitrogen).

Samples of different genotypes were processed simultaneously and imaged under identical confocal settings in the same imaging session with a laser scanning confocal microscope (CarlZeiss LSM780). All images were collected as 0.2 μm optical sections and the z-stacks were analyzed with Imaris software (Bitplane). To quantify fluorescence intensities synaptic ROI areas surrounding anti-HRP immunoreactivities were selected and the signals measured individually at NMJs (muscle 4, segment A3) from ten or more different larvae for each genotype (number of samples is indicated in the graph bar). The signal intensities were calculated relative to HRP volume and subsequently normalized to control. Boutons were counted in preparations double labeled with anti-HRP and anti-Dlg. Bouton size was estimated by using the ImageJ software. All quantifications were performed while blinded to genotype. The numbers of samples analyzed are indicated inside the bars. Statistical analyses were performed using the Student t-test with a two-tailed distribution and a two-sample unequal variance. Error bars in all graphs indicate standard deviation ±SEM. ***p<0.001, **p<0.005, *p<0.05, ns- p>0.05.

Proximity Ligation Assay (PLA)

PLA was performed following published protocols (Wang et al., 2015). In brief, wandering third instar larvae were dissected, fixed and incubated with primary antibodies (anti-Tnc and anti-βPS integrin) overnight at 4°C. To detect the markers, the samples were incubated with AF-conjugated secondary antibodies (anti-rabbit- AF488, anti-mouse-AF405 and anti-HRP-AF647) for 1 hr in the dark. For PLA, the samples were washed with Wash Buffer A (DUO 92101 Kit, Sigma), incubated first with PLA probe anti-mouse MINUS and PLA probe anti-rabbit PLUS (1:5 dilution) for 2 hr at 37°C, then with 200 μl Ligation solution for 1 hr at 37°C, and finally with Amplification solution for 2 hr at 37°C. After washes in Wash Buffer B, the samples were mounted in ProLong Gold (Invitrogen) and examined by confocal imaging.

Electrophysiology

The standard larval body wall muscle preparation first developed by Jan and Jan (1976) (Jan and Jan, 1976) was used for electrophysiological recordings (Zhang and Stewart, 2010). Wandering third instar larvae were dissected in physiological saline HL-3 saline (Stewart et al., 1994), washed, and immersed in HL-3 containing 0.5 or 0.8 mM Ca2+ using a custom microscope stage system (Ide, 2013). The nerve roots were cut near the exiting site of the ventral nerve cord so that the motor nerve could be picked up by a suction electrode. Intracellular recordings were made from muscle 6, abdominal segment 3 and 4. Data were used when the input resistance of the muscle was >5 MΩ and the resting membrane potential was between −60 mV and −70 mV. The input resistance of the recording microelectrode (backfilled with 3 M KCl) ranged from 20 to 25 MΩ. Muscle synaptic potentials were recorded using Multiclamp 700B amplifiers (Molecular Devices) and Axon Clamp 2B amplifier (Axon Instruments) and analyzed using pClamp 10 software. Following motor nerve stimulation with a suction electrode (200 μsec, 1.9 V), evoked EJPs were recorded. Four to six EJPs evoked by low frequency of stimulation (0.1 Hz) were averaged. For mini recordings, TTX (1 μM) was added to prevent evoked release (Stewart et al., 1994). To calculate mEJP mean amplitudes, 100 events from each 10 or more NMJs (only one NMJ per animal was used) were measured and averaged using the Mini Analysis program (Synaptosoft). Minis with a slow rise and falling time arising from neighboring electrically coupled muscle cells were excluded from analysis (Gho, 1994; Zhang et al., 1998). Paired stimuli (200 μsec, 1.9 V, 0.05 Hz) were applied with a suction electrode at 50 ms inter-stimulus intervals. The amplitude of the eEJP was determined as an average from 5 to 8 steady consecutive sweeps. The paired-pulse ratio (PPR) was expressed as the amplitude ratio of the second synaptic response to the first synaptic response (Zhang and Stewart, 2010). Quantal content was calculated by dividing the mean EJP by the mean mEJP after correction of EJP amplitude for nonlinear summation according to previously described methods (Stevens, 1976; Feeney et al., 1998). Corrected EJP amplitude = E[Ln[E/(E - recorded EJP)]], where E is the difference between reversal potential and resting potential. The reversal potential used in this correction was 0 mV (Feeney et al., 1998; Lagow et al., 2007). Statistical analysis was performed with KaleidaGraph 4.5 (Synergy Software) using ANOVA followed by a Tukey post hoc test. Differences were considered significant at p<0.05. Data are presented as mean ±SEM.

Electron microscopy

Wandering third instar larvae were dissected in physiological saline HL-3 saline and fixed for 30 min on dissection plate in fixation buffer (0.1 M Sodium Cacodylate buffer, pH7.2; 2 mM MgCl2; 1% glutaraldehyde; 4% paraformaldehyde). The samples were trimmed to include only the abdominal segments A2 and A3, transferred in a 1.5 mL Eppendorf tube, fixed overnight at 4 ˚C, then washed extensively with 0.1 M Sodium Cacodylate buffer with 132 mM Sucrose, pH 7.2. The samples were further processed and analyzed according to published protocols (Ramachandran and Budnik, 2010) at the Microscopy and Imaging Facility, NICHD.

Acknowledgements

This work was supported by the Intramural Research Program at the NICHD, NIH. We thank Bing Zhang, Graham Thomas, Herman Aberle, Kelly Ten Hagen, Ed Giniger, and Alan Hinnebusch for helpful discussions and suggestions. We are grateful to Nicholas Harden for antibodies. We thank Tom Brody, Rosario Vicidomini and Lindsey Friend for comments on this manuscript. Electron microscopy was in part performed at the Microscopy and Imaging Core of NICHD, NIH with the assistance of Chip Dye. We also thank the Bloomington Stock Center at the University of Indiana for fly stocks and the Developmental Studies Hybridoma Bank at the University of Iowa for antibodies.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Mihaela Serpe, Email: mihaela.serpe@nih.gov.

Talila Volk, Weizmann Institute of Science, Israel.

Funding Information

This paper was supported by the following grants:

  • NIH Office of the Director Z01 HD008914 to Qi Wang, Tae Hee Han, Peter Nguyen, Mihaela Serpe.

  • NIH Office of the Director Z01 HD008869 to Qi Wang, Tae Hee Han, Peter Nguyen, Mihaela Serpe.

Additional information

Competing interests

No competing interests declared.

Author contributions

Conceptualization, Formal analysis, Investigation, Visualization, Methodology, Writing—original draft, Writing—review and editing.

Formal analysis, Investigation, Visualization, Writing—original draft.

Data curation, Validation, Investigation, Methodology.

Investigation, Visualization.

Conceptualization, Supervision, Investigation, Writing—original draft, Project administration, Writing—review and editing.

Additional files

Transparent reporting form
DOI: 10.7554/eLife.35518.023

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files.

References

  1. Banovic D, Khorramshahi O, Owald D, Wichmann C, Riedt T, Fouquet W, Tian R, Sigrist SJ, Aberle H. Drosophila neuroligin 1 promotes growth and postsynaptic differentiation at glutamatergic neuromuscular junctions. Neuron. 2010;66:724–738. doi: 10.1016/j.neuron.2010.05.020. [DOI] [PubMed] [Google Scholar]
  2. Bateman J, Reddy RS, Saito H, Van Vactor D. The receptor tyrosine phosphatase Dlar and integrins organize actin filaments in the Drosophila follicular epithelium. Current Biology. 2001;11:1317–1327. doi: 10.1016/S0960-9822(01)00420-1. [DOI] [PubMed] [Google Scholar]
  3. Bellen HJ, Levis RW, Liao G, He Y, Carlson JW, Tsang G, Evans-Holm M, Hiesinger PR, Schulze KL, Rubin GM, Hoskins RA, Spradling AC. The BDGP gene disruption project: single transposon insertions associated with 40% of Drosophila genes. Genetics. 2004;167:761–781. doi: 10.1534/genetics.104.026427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bennett V, Baines AJ. Spectrin and ankyrin-based pathways: metazoan inventions for integrating cells into tissues. Physiological Reviews. 2001;81:1353–1392. doi: 10.1152/physrev.2001.81.3.1353. [DOI] [PubMed] [Google Scholar]
  5. Benzer S. Behavioral mutants of drosophila isolated by countercurrent distribution. PNAS. 1967;58:1112–1119. doi: 10.1073/pnas.58.3.1112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Beumer K, Matthies HJ, Bradshaw A, Broadie K. Integrins regulate DLG/FAS2 via a CaM kinase II-dependent pathway to mediate synapse elaboration and stabilization during postembryonic development. Development. 2002;129:3381–3391. doi: 10.1242/dev.129.14.3381. [DOI] [PubMed] [Google Scholar]
  7. Beumer KJ, Rohrbough J, Prokop A, Broadie K. A role for PS integrins in morphological growth and synaptic function at the postembryonic neuromuscular junction of Drosophila. Development. 1999;126:5833–5846. doi: 10.1242/dev.126.24.5833. [DOI] [PubMed] [Google Scholar]
  8. Bork P. Shuffled domains in extracellular proteins. FEBS Letters. 1991;286:47–54. doi: 10.1016/0014-5793(91)80937-X. [DOI] [PubMed] [Google Scholar]
  9. Bökel C, Brown NH. Integrins in development: moving on, responding to, and sticking to the extracellular matrix. Developmental Cell. 2002;3:311–321. doi: 10.1016/S1534-5807(02)00265-4. [DOI] [PubMed] [Google Scholar]
  10. Broadie K, Baumgartner S, Prokop A. Extracellular matrix and its receptors in Drosophila neural development. Developmental Neurobiology. 2011;71:1102–1130. doi: 10.1002/dneu.20935. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Budnik V, Gorczyca M, Prokop A. Selected methods for the anatomical study of Drosophila embryonic and larval neuromuscular junctions. International Review of Neurobiology. 2006;75:323–365. doi: 10.1016/S0074-7742(06)75015-2. [DOI] [PubMed] [Google Scholar]
  12. Budnik V, Koh YH, Guan B, Hartmann B, Hough C, Woods D, Gorczyca M. Regulation of synapse structure and function by the Drosophila tumor suppressor gene dlg. Neuron. 1996;17:627–640. doi: 10.1016/S0896-6273(00)80196-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Carlson SS, Valdez G, Sanes JR. Presynaptic calcium channels and α3-integrins are complexed with synaptic cleft laminins, cytoskeletal elements and active zone components. Journal of Neurochemistry. 2010;115:654–666. doi: 10.1111/j.1471-4159.2010.06965.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Conder R, Yu H, Ricos M, Hing H, Chia W, Lim L, Harden N. dPak is required for integrity of the leading edge cytoskeleton during Drosophila dorsal closure but does not signal through the JNK cascade. Developmental Biology. 2004;276:378–390. doi: 10.1016/j.ydbio.2004.08.044. [DOI] [PubMed] [Google Scholar]
  15. Dani N, Zhu H, Broadie K. Two protein N-acetylgalactosaminyl transferases regulate synaptic plasticity by activity-dependent regulation of integrin signaling. Journal of Neuroscience. 2014;34:13047–13065. doi: 10.1523/JNEUROSCI.1484-14.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Featherstone DE, Davis WS, Dubreuil RR, Broadie K. Drosophila alpha- and beta-spectrin mutations disrupt presynaptic neurotransmitter release. The Journal of Neuroscience. 2001;21:4215–4224. doi: 10.1523/JNEUROSCI.21-12-04215.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Feeney CJ, Karunanithi S, Pearce J, Govind CK, Atwood HL. Motor nerve terminals on abdominal muscles in larval flesh flies, Sarcophaga bullata: comparisons with Drosophila. The Journal of Comparative Neurology. 1998;402:197–209. doi: 10.1002/(SICI)1096-9861(19981214)402:2<197::AID-CNE5>3.0.CO;2-Q. [DOI] [PubMed] [Google Scholar]
  18. Fraichard S, Bouge AL, Chauvel I, Bouhin H. Tenectin, a novel extracellular matrix protein expressed during Drosophila melanogaster embryonic development. Gene Expression Patterns. 2006;6:772–776. doi: 10.1016/j.modgep.2006.01.007. [DOI] [PubMed] [Google Scholar]
  19. Fraichard S, Bougé AL, Kendall T, Chauvel I, Bouhin H, Bunch TA. Tenectin is a novel alphaPS2betaPS integrin ligand required for wing morphogenesis and male genital looping in Drosophila. Developmental Biology. 2010;340:504–517. doi: 10.1016/j.ydbio.2010.02.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gho M. Voltage-clamp analysis of gap junctions between embryonic muscles in Drosophila. The Journal of Physiology. 1994;481:371–383. doi: 10.1113/jphysiol.1994.sp020446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Goellner B, Aberle H. The synaptic cytoskeleton in development and disease. Developmental Neurobiology. 2012;72:111–125. doi: 10.1002/dneu.20892. [DOI] [PubMed] [Google Scholar]
  22. Grotewiel MS, Beck CD, Wu KH, Zhu XR, Davis RL. Integrin-mediated short-term memory in Drosophila. Nature. 1998;391:455–460. doi: 10.1038/35079. [DOI] [PubMed] [Google Scholar]
  23. Guan B, Hartmann B, Kho YH, Gorczyca M, Budnik V. The Drosophila tumor suppressor gene, dlg, is involved in structural plasticity at a glutamatergic synapse. Current Biology. 1996;6:695–706. doi: 10.1016/S0960-9822(09)00451-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Han TH, Dharkar P, Mayer ML, Serpe M. Functional reconstitution of Drosophila melanogaster NMJ glutamate receptors. PNAS. 2015;112:6182–6187. doi: 10.1073/pnas.1500458112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Häcker U, Nybakken K, Perrimon N. Heparan sulphate proteoglycans: the sweet side of development. Nature Reviews. Molecular Cell Biology. 2005;6:530–541. doi: 10.1038/nrm1681. [DOI] [PubMed] [Google Scholar]
  26. Ide D. Electrophysiology tool construction. Current Protocols in Neuroscience. 2013;Chapter 6:Unit 6.26. doi: 10.1002/0471142301.ns0626s62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Jan LY, Jan YN. Properties of the larval neuromuscular junction in Drosophila melanogaster. The Journal of Physiology. 1976;262:189–214. doi: 10.1113/jphysiol.1976.sp011592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Jan LY, Jan YN. Antibodies to horseradish peroxidase as specific neuronal markers in Drosophila and in grasshopper embryos. PNAS. 1982;79:2700–2704. doi: 10.1073/pnas.79.8.2700. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Keshishian H, Broadie K, Chiba A, Bate M. The drosophila neuromuscular junction: a model system for studying synaptic development and function. Annual Review of Neuroscience. 1996;19:545–575. doi: 10.1146/annurev.ne.19.030196.002553. [DOI] [PubMed] [Google Scholar]
  30. Khanna MR, Mattie FJ, Browder KC, Radyk MD, Crilly SE, Bakerink KJ, Harper SL, Speicher DW, Thomas GH. Spectrin tetramer formation is not required for viable development in Drosophila. Journal of Biological Chemistry. 2015;290:706–715. doi: 10.1074/jbc.M114.615427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Kim YJ, Bao H, Bonanno L, Zhang B, Serpe M. Drosophila Neto is essential for clustering glutamate receptors at the neuromuscular junction. Genes & Development. 2012;26:974–987. doi: 10.1101/gad.185165.111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kim YJ, Igiesuorobo O, Ramos CI, Bao H, Zhang B, Serpe M. Prodomain removal enables neto to stabilize glutamate receptors at the Drosophila neuromuscular junction. PLoS Genetics. 2015;11:e1004988. doi: 10.1371/journal.pgen.1004988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Kizhatil K, Yoon W, Mohler PJ, Davis LH, Hoffman JA, Bennett V. Ankyrin-G and beta2-spectrin collaborate in biogenesis of lateral membrane of human bronchial epithelial cells. Journal of Biological Chemistry. 2007;282:2029–2037. doi: 10.1074/jbc.M608921200. [DOI] [PubMed] [Google Scholar]
  34. Koch I, Schwarz H, Beuchle D, Goellner B, Langegger M, Aberle H. Drosophila ankyrin 2 is required for synaptic stability. Neuron. 2008;58:210–222. doi: 10.1016/j.neuron.2008.03.019. [DOI] [PubMed] [Google Scholar]
  35. Koper A, Schenck A, Prokop A. Analysis of adhesion molecules and basement membrane contributions to synaptic adhesion at the Drosophila embryonic NMJ. PLoS One. 2012;7:e36339. doi: 10.1371/journal.pone.0036339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Lagow RD, Bao H, Cohen EN, Daniels RW, Zuzek A, Williams WH, Macleod GT, Sutton RB, Zhang B. Modification of a hydrophobic layer by a point mutation in syntaxin 1A regulates the rate of synaptic vesicle fusion. PLoS Biology. 2007;5:e72. doi: 10.1371/journal.pbio.0050072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Lee JK, Coyne RS, Dubreuil RR, Goldstein LS, Branton D. Cell shape and interaction defects in alpha-spectrin mutants of Drosophila melanogaster. The Journal of Cell Biology. 1993;123:1797–1809. doi: 10.1083/jcb.123.6.1797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Liddington RC, Ginsberg MH. Integrin activation takes shape. The Journal of Cell Biology. 2002;158:833–839. doi: 10.1083/jcb.200206011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Lin J, Patel SR, Cheng X, Cho EA, Levitan I, Ullenbruch M, Phan SH, Park JM, Dressler GR. Kielin/chordin-like protein, a novel enhancer of BMP signaling, attenuates renal fibrotic disease. Nature Medicine. 2005;11:387–393. doi: 10.1038/nm1217. [DOI] [PubMed] [Google Scholar]
  40. Lorenzo DN, Li MG, Mische SE, Armbrust KR, Ranum LP, Hays TS. Spectrin mutations that cause spinocerebellar ataxia type 5 impair axonal transport and induce neurodegeneration in Drosophila. The Journal of Cell Biology. 2010;189:143–158. doi: 10.1083/jcb.200905158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. López-Ceballos P, Herrera-Reyes AD, Coombs D, Tanentzapf G. In vivo regulation of integrin turnover by outside-in activation. Journal of Cell Science. 2016;129:2912–2924. doi: 10.1242/jcs.190256. [DOI] [PubMed] [Google Scholar]
  42. Lu W, Roche KW. Posttranslational regulation of AMPA receptor trafficking and function. Current Opinion in Neurobiology. 2012;22:470–479. doi: 10.1016/j.conb.2011.09.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Maartens AP, Brown NH. The many faces of cell adhesion during Drosophila muscle development. Developmental Biology. 2015;401:62–74. doi: 10.1016/j.ydbio.2014.12.038. [DOI] [PubMed] [Google Scholar]
  44. McGeachie AB, Cingolani LA, Goda Y. Stabilising influence: integrins in regulation of synaptic plasticity. Neuroscience Research. 2011;70:24–29. doi: 10.1016/j.neures.2011.02.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Morini R, Becchetti A. Integrin receptors and ligand-gated channels. Advances in Experimental Medicine and Biology. 2010;674:95–105. doi: 10.1007/978-1-4419-6066-5_9. [DOI] [PubMed] [Google Scholar]
  46. Mosca TJ, Hong W, Dani VS, Favaloro V, Luo L. Trans-synaptic Teneurin signalling in neuromuscular synapse organization and target choice. Nature. 2012;484:237–241. doi: 10.1038/nature10923. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Myers JP, Santiago-Medina M, Gomez TM. Regulation of axonal outgrowth and pathfinding by integrin-ECM interactions. Developmental Neurobiology. 2011;71:901–923. doi: 10.1002/dneu.20931. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Ng BF, Selvaraj GK, Santa-Cruz Mateos C, Grosheva I, Alvarez-Garcia I, Martín-Bermudo MD, Palacios IM. α-Spectrin and integrins act together to regulate actomyosin and columnarization, and to maintain a monolayered follicular epithelium. Development. 2016;143:1388–1399. doi: 10.1242/dev.130070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Parks AL, Cook KR, Belvin M, Dompe NA, Fawcett R, Huppert K, Tan LR, Winter CG, Bogart KP, Deal JE, Deal-Herr ME, Grant D, Marcinko M, Miyazaki WY, Robertson S, Shaw KJ, Tabios M, Vysotskaia V, Zhao L, Andrade RS, Edgar KA, Howie E, Killpack K, Milash B, Norton A, Thao D, Whittaker K, Winner MA, Friedman L, Margolis J, Singer MA, Kopczynski C, Curtis D, Kaufman TC, Plowman GD, Duyk G, Francis-Lang HL. Systematic generation of high-resolution deletion coverage of the Drosophila melanogaster genome. Nature Genetics. 2004;36:288–292. doi: 10.1038/ng1312. [DOI] [PubMed] [Google Scholar]
  50. Patel NH. Imaging neuronal subsets and other cell types in whole-mount Drosophila embryos and larvae using antibody probes. Methods in Cell Biology. 1994;44:445–487. doi: 10.1016/S0091-679X(08)60927-9. [DOI] [PubMed] [Google Scholar]
  51. Pielage J, Cheng L, Fetter RD, Carlton PM, Sedat JW, Davis GW. A presynaptic giant ankyrin stabilizes the NMJ through regulation of presynaptic microtubules and transsynaptic cell adhesion. Neuron. 2008;58:195–209. doi: 10.1016/j.neuron.2008.02.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Pielage J, Fetter RD, Davis GW. Presynaptic spectrin is essential for synapse stabilization. Current Biology. 2005;15:918–928. doi: 10.1016/j.cub.2005.04.030. [DOI] [PubMed] [Google Scholar]
  53. Pielage J, Fetter RD, Davis GW. A postsynaptic spectrin scaffold defines active zone size, spacing, and efficacy at the Drosophila neuromuscular junction. The Journal of Cell Biology. 2006;175:491–503. doi: 10.1083/jcb.200607036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Pines M, Das R, Ellis SJ, Morin A, Czerniecki S, Yuan L, Klose M, Coombs D, Tanentzapf G. Mechanical force regulates integrin turnover in Drosophila in vivo. Nature Cell Biology. 2012;14:935–943. doi: 10.1038/ncb2555. [DOI] [PubMed] [Google Scholar]
  55. Prokop A, Martín-Bermudo MD, Bate M, Brown NH. Absence of PS integrins or laminin A affects extracellular adhesion, but not intracellular assembly, of hemiadherens and neuromuscular junctions in Drosophila embryos. Developmental Biology. 1998;196:58–76. doi: 10.1006/dbio.1997.8830. [DOI] [PubMed] [Google Scholar]
  56. Ramachandran P, Budnik V. Electron microscopy of Drosophila larval neuromuscular junctions. Cold Spring Harbor Protocols. 2010;2010:pdb.prot5474. doi: 10.1101/pdb.prot5474. [DOI] [PubMed] [Google Scholar]
  57. Ramos CI, Igiesuorobo O, Wang Q, Serpe M. Neto-mediated intracellular interactions shape postsynaptic composition at the Drosophila neuromuscular junction. PLoS Genetics. 2015;11:e1005191. doi: 10.1371/journal.pgen.1005191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Reichardt LF, Prokop A. Introduction: the role of extracellular matrix in nervous system development and maintenance. Developmental Neurobiology. 2011;71:883–888. doi: 10.1002/dneu.20975. [DOI] [PubMed] [Google Scholar]
  59. Reichardt LF, Tomaselli KJ. Extracellular matrix molecules and their receptors: functions in neural development. Annual Review of Neuroscience. 1991;14:531–570. doi: 10.1146/annurev.ne.14.030191.002531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Rohrbough J, Grotewiel MS, Davis RL, Broadie K. Integrin-mediated regulation of synaptic morphology, transmission, and plasticity. The Journal of Neuroscience. 2000;20:6868–6878. doi: 10.1523/JNEUROSCI.20-18-06868.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Rohrbough J, Rushton E, Woodruff E, Fergestad T, Vigneswaran K, Broadie K. Presynaptic establishment of the synaptic cleft extracellular matrix is required for post-synaptic differentiation. Genes & Development. 2007;21:2607–2628. doi: 10.1101/gad.1574107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Rushton E, Rohrbough J, Broadie K. Presynaptic secretion of mind-the-gap organizes the synaptic extracellular matrix-integrin interface and postsynaptic environments. Developmental Dynamics. 2009;238:554–571. doi: 10.1002/dvdy.21864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Rushton E, Rohrbough J, Deutsch K, Broadie K. Structure-function analysis of endogenous lectin mind-the-gap in synaptogenesis. Developmental Neurobiology. 2012;72:1161–1179. doi: 10.1002/dneu.22006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Schuster CM, Davis GW, Fetter RD, Goodman CS. Genetic dissection of structural and functional components of synaptic plasticity. I. fasciclin II controls synaptic stabilization and growth. Neuron. 1996a;17:641–654. doi: 10.1016/S0896-6273(00)80197-X. [DOI] [PubMed] [Google Scholar]
  65. Schuster CM, Davis GW, Fetter RD, Goodman CS. Genetic dissection of structural and functional components of synaptic plasticity. II. fasciclin II controls presynaptic structural plasticity. Neuron. 1996b;17:655–667. doi: 10.1016/S0896-6273(00)80198-1. [DOI] [PubMed] [Google Scholar]
  66. Serpe M, O'Connor MB. The metalloprotease tolloid-related and its TGF-beta-like substrate Dawdle regulate Drosophila motoneuron axon guidance. Development. 2006;133:4969–4979. doi: 10.1242/dev.02711. [DOI] [PubMed] [Google Scholar]
  67. Serpe M, Umulis D, Ralston A, Chen J, Olson DJ, Avanesov A, Othmer H, O'Connor MB, Blair SS. The BMP-binding protein Crossveinless 2 is a short-range, concentration-dependent, biphasic modulator of BMP signaling in Drosophila. Developmental Cell. 2008;14:940–953. doi: 10.1016/j.devcel.2008.03.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Stevens A, Jacobs JR. Integrins regulate responsiveness to slit repellent signals. The Journal of Neuroscience. 2002;22:4448–4455. doi: 10.1523/JNEUROSCI.22-11-04448.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Stevens CF. A comment on Martin's relation. Biophysical Journal. 1976;16:891–895. doi: 10.1016/S0006-3495(76)85739-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Stewart BA, Atwood HL, Renger JJ, Wang J, Wu CF, Cf W. Improved stability of Drosophila larval neuromuscular preparations in haemolymph-like physiological solutions. Journal of Comparative Physiology A. 1994;175:179–191. doi: 10.1007/BF00215114. [DOI] [PubMed] [Google Scholar]
  71. Sulkowski M, Kim YJ, Serpe M. Postsynaptic glutamate receptors regulate local BMP signaling at the Drosophila neuromuscular junction. Development. 2014;141:436–447. doi: 10.1242/dev.097758. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Sulkowski MJ, Han TH, Ott C, Wang Q, Verheyen EM, Lippincott-Schwartz J, Serpe M. A novel, noncanonical bmp pathway modulates synapse maturation at the drosophila neuromuscular junction. PLoS Genetics. 2016;12:e1005810. doi: 10.1371/journal.pgen.1005810. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Syed ZA, Bougé AL, Byri S, Chavoshi TM, Tång E, Bouhin H, van Dijk-Härd IF, Uv A. A luminal glycoprotein drives dose-dependent diameter expansion of the Drosophila melanogaster hindgut tube. PLoS Genetics. 2012;8:e1002850. doi: 10.1371/journal.pgen.1002850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Syed ZA, Härd T, Uv A, van Dijk-Härd IF. A potential role for Drosophila mucins in development and physiology. PLoS One. 2008;3:e3041. doi: 10.1371/journal.pone.0003041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Thibault ST, Singer MA, Miyazaki WY, Milash B, Dompe NA, Singh CM, Buchholz R, Demsky M, Fawcett R, Francis-Lang HL, Ryner L, Cheung LM, Chong A, Erickson C, Fisher WW, Greer K, Hartouni SR, Howie E, Jakkula L, Joo D, Killpack K, Laufer A, Mazzotta J, Smith RD, Stevens LM, Stuber C, Tan LR, Ventura R, Woo A, Zakrajsek I, Zhao L, Chen F, Swimmer C, Kopczynski C, Duyk G, Winberg ML, Margolis J. A complementary transposon tool kit for Drosophila melanogaster using P and piggyBac. Nature Genetics. 2004;36:283–287. doi: 10.1038/ng1314. [DOI] [PubMed] [Google Scholar]
  76. Tjota M, Lee SK, Wu J, Williams JA, Khanna MR, Thomas GH. Annexin B9 binds to β(H)-spectrin and is required for multivesicular body function in Drosophila. Journal of Cell Science. 2011;124:2914–2926. doi: 10.1242/jcs.078667. [DOI] [PubMed] [Google Scholar]
  77. Tran DT, Ten Hagen KG. Mucin-type O-glycosylation during development. Journal of Biological Chemistry. 2013;288:6921–6929. doi: 10.1074/jbc.R112.418558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Tsai PI, Kao HH, Grabbe C, Lee YT, Ghose A, Lai TT, Peng KP, Van Vactor D, Palmer RH, Chen RH, Yeh SR, Chien CT. Fak56 functions downstream of integrin alphaPS3betanu and suppresses MAPK activation in neuromuscular junction growth. Neural Development. 2008;3:26. doi: 10.1186/1749-8104-3-26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Tsai PI, Wang M, Kao HH, Cheng YJ, Lin YJ, Chen RH, Chien CT. Activity-dependent retrograde laminin A signaling regulates synapse growth at Drosophila neuromuscular junctions. PNAS. 2012;109:17699–17704. doi: 10.1073/pnas.1206416109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Venken KJ, Carlson JW, Schulze KL, Pan H, He Y, Spokony R, Wan KH, Koriabine M, de Jong PJ, White KP, Bellen HJ, Hoskins RA. Versatile P[acman] BAC libraries for transgenesis studies in Drosophila melanogaster. Nature Methods. 2009;6:431–434. doi: 10.1038/nmeth.1331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  81. Waite A, Tinsley CL, Locke M, Blake DJ. The neurobiology of the dystrophin-associated glycoprotein complex. Annals of Medicine. 2009;41:344–359. doi: 10.1080/07853890802668522. [DOI] [PubMed] [Google Scholar]
  82. Wang S, Yoo S, Kim HY, Wang M, Zheng C, Parkhouse W, Krieger C, Harden N. Detection of in situ protein-protein complexes at the Drosophila larval neuromuscular junction using proximity ligation assay. Journal of Visualized Experiments. 2015:52139. doi: 10.3791/52139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  83. Wang SJ, Tsai A, Wang M, Yoo S, Kim HY, Yoo B, Chui V, Kisiel M, Stewart B, Parkhouse W, Harden N, Krieger C. Phospho-regulated Drosophila adducin is a determinant of synaptic plasticity in a complex with Dlg and PIP2 at the larval neuromuscular junction. Biology Open. 2014;3:1196–1206. doi: 10.1242/bio.20148342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Wharton KA, Serpe M. Fine-tuned shuttles for bone morphogenetic proteins. Current Opinion in Genetics & Development. 2013;23:374–384. doi: 10.1016/j.gde.2013.04.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  85. Wong CO, Chen K, Lin YQ, Chao Y, Duraine L, Lu Z, Yoon WH, Sullivan JM, Broadhead GT, Sumner CJ, Lloyd TE, Macleod GT, Bellen HJ, Venkatachalam K. A TRPV channel in Drosophila motor neurons regulates presynaptic resting Ca2+ levels, synapse growth, and synaptic transmission. Neuron. 2014;84:764–777. doi: 10.1016/j.neuron.2014.09.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  86. Zhang B, Koh YH, Beckstead RB, Budnik V, Ganetzky B, Bellen HJ. Synaptic vesicle size and number are regulated by a clathrin adaptor protein required for endocytosis. Neuron. 1998;21:1465–1475. doi: 10.1016/S0896-6273(00)80664-9. [DOI] [PubMed] [Google Scholar]
  87. Zhang B, Stewart B. Electrophysiological recording from Drosophila larval body-wall muscles. Cold Spring Harbor Protocols. 2010;2010:pdb.prot5487. doi: 10.1101/pdb.prot5487. [DOI] [PubMed] [Google Scholar]

Decision letter

Editor: Talila Volk1

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

[Editors’ note: a previous version of this study was rejected after peer review, but the authors submitted for reconsideration. The first decision letter after peer review is shown below.]

Thank you for submitting your work entitled "Tenectin recruits integrin to stabilize boutons and regulate vesicle release at the Drosophila neuromuscular junction" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Andreas Prokop (Reviewer #2).

Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife.

All three reviewers (see below their comments) expressed major criticism regarding the manuscript conclusions. The major comment is that the results are confusing and some time contradicting regarding the muscle, versus neuron-dependent function of Tenectin in recruiting integrins to the NMJ. In addition a direct versus indirect effect of Tenectin on the levels of Spectrins at the NMJ should be further validated. Many controls are also missing.

We hope you find our comments useful. If you address these comments and would like to make a fresh submission at eLife, rather than elsewhere, we will be happy to examine this afresh.

Reviewer #1:

This paper describes the expression and function of Tenectin at the larval NMJ. While there is a lot of information in the paper, it will primarily be of interest to specialists in fly neuromuscular system development.

There are also some problematical aspects to the data, as follows:

1) Maybe I am not understanding something here, but there seems to be an unresolved contradiction about cis vs. trans action of Tnc. They show that muscle, but not neuronal Tnc knockdown reduces βPS expression (Figure 4M) and from this (subsection “Muscle Tnc recruits postsynaptic integrin”, second paragraph) they conclude that it muscle Tnc acts in cis to recruit βPS, which is primarily expressed in muscles.

However, in Figure 6 they show that in a tnc mutant the loss of expression of βPS is restored by neuronal expression of Tnc, indicating that it is acting in trans (Figure 6D). When they express Tnc in muscles they lose βPS expression. The results in Figure 4 would predict that neuronal expression of Tnc in the mutant should not rescue, since neuronal knockdown does not affect βPS, and that muscle expression of Tnc should rescue, since muscle knockdown decreases βPS. Perhaps this is a Tnc overexpression phenotype. To test this, they should use weaker muscle drivers and reduce the temperature to reduce GAL4 activity, or make a direct muscle promoter>Tnc fusion. Unless I am missing something here, if they can express Tnc at physiological levels in the muscles in a tnc mutant, this should rescue βPS expression, not eliminate it.

2) The data in Figure 8 are not convincing. Looking at the high-mag views of the HA beads and placing them into the low-mag views of the cells, one can see that there is no accumulation of βPS, αPS2, or spectrin around the beads relative to their levels elsewhere in the cells. In fact the beads are in low-expression areas for all of these markers. Given this, one cannot believe that the levels of these markers are lower around the control beads. No high-mag views of the control beads are shown, and you can't even see these beads in the fluorescent images since they are not labeled. To do this experiment correctly, they need to use a different HA-tagged protein on the control beads, so that they can be seen in the fluorescent images, and show equivalent high-mag views of the beads so that it can be determined if there is really more integrin around the beads. This should also be quantitated by measuring fluorescence intensity in the bead regions in Tnc-HA vs. Control protein-HA beads.

3) Figure 8—figure supplement 1 is also unconvincing and incomplete. There is clearly a lot of βPS within the cell in Tnc-HA expressing cells, but levels at the cell surface are not clearly increased (at least the images shown do not demonstrate this). They could address this by staining live cells with anti-βPS without detergent. Maybe Tnc-HA is expressed at very high levels and sequesters βPS within a secretory compartment where it cannot be degraded, thus increasing its intracellular levels. This does not show that Tnc-HA acts in cis to increase integrin surface localization.

4) If they want to evaluate whether Tnc-HA induces βPS, they should make a stable S2 line expressing Tnc-HA, which is easily done using stable transformation vectors. If Tnc-HA expression is toxic they can drive it from a conditional promoter. Similarly, they can use stable transfection to knock down βPS with RNAi if the transient RNAi knockdown is inadequate (subsection “Tnc engages integrin and spectrin at the cell membrane”, first paragraph).

Reviewer #2:

This work by Wang and colleagues has some clear merits and high potential, but I do not recommend publication, but rather rejection with the option to re-submit. The main reason for this suggestion is the lack of clarity across the paper how experiments link together into new understanding. In my view there are seemingly contradicting results in this work that suggest a very intricate role and regulation of tnc, but have to be resolved before this manuscript can be considered for publication. The contradictions mainly consist in obscure effects observed upon pre- versus post-synaptic manipulations that require a far more refined experimental approach and logic dissection. Instead, data are being uncritically reported and the reader is left alone with a highly confusing message, if any message at all. There is potential in many of the data, but the authors failed to turn them into a readable and informative manuscript. Apart from these shortcomings there are a number of further issues that need clarification. See my detailed comments below.

Detailed comments:

The Introduction reads well and provides a sound overview of ECM at mammalian and Drosophila synapses. It would be helpful to mention the obvious gaps of understanding in the field and how this work addresses these gaps. A tip: do the authors know this review: Singhal, N., Martin, P. T. (2011). Role of extracellular matrix proteins and their receptors in the development of the vertebrate neuromuscular junction. Dev Neurobiol 71, 982-1005 – https://doi.org/10.1002/dneu.20953

Introduction or start of Results: It needs to be clearly stated that tnc has no mammalian homologue.

“Using a polyclonal anti-Tnc antibody (Materials and methods) we found that Tnc signals are concentrated during late embryogenesis in the ventral cord, near the pioneer, anti-Fasciclin II (FasII) positive axons (Figure 1—figure supplement 1A, B and (Fraichard et al., 2006)): For this statement, the resolution of analyses is far too low, and I do not think that this statement is important. Delete and stay with the statement that staining it is strongly enriched in the neuropile.

“In contrast, the Tnc CNS signals were absent in a tnc mutant (tncEPP[EPgy2]EY03355), predicted to disrupt both known tnc transcripts (Syed et al., 2012)”: Point out that Fas2 pattern is not disturbed in the mutant CNS. Obviously, there is not interaction with reported functions of integrins in this context:

Stevens and Jacobs, 2002; Broadie, Baumgartner and Prokop, 2011. Drosophila

Subsection “Tnc localizes at the synaptic cleft”, second paragraph: indicate the two tnc transcripts in Figure 1A.

Subsection “Tnc localizes at the synaptic cleft”, second paragraph and thereafter: the correct term is "hetero-allelic": if tncDf is a true deficiency you need to talk of a "hemizygous" condition.

Subsection “Tnc localizes at the synaptic cleft”, third paragraph”: At this early point, the pre-postsynaptic statement cannot be made. Tnc expression in the neuropile is in patches which might reflect staining around dendrites. Therefore, the expression/localisation in motorneuons may well be postsynaptic (equivalent to muscle expression in the periphery).

Subsection “Tnc localizes at the synaptic cleft”, third paragraph”: Does complete knock-down in the CNS get rid of all expression or is tnc only expressed in motorneurons but not very efficiently knocked down? Along these lines, given potentially expected different driver strengths in CNS and muscles, the conclusions about where tnc is strongest expressed cannot be drawn from the knock-down data.

Subsection “Tnc localizes at the synaptic cleft”, last paragraph”: the staining does not look like being around nuclei, but seems suprisingly nuclear. If it were in Golgi or ER, it would have a broader expression.

Subsection “Tnc localizes at the synaptic cleft”, last paragraph”: the reduced staining is not very convincing. This needs to be quantified.

Subsection “Tnc localizes at the synaptic cleft”, last paragraph: either show and quantify the tnc over-expression data or take them out.

Figure 1—figure supplement 2 is not well described in its legend and is confusing. What nuclei are shown on the right? I guess it is muscle nuclei? But why is there no expression in those when driving tnc with 24B (bottom right image). Please, clarify, because at the moment this does not make sense. Expression data must be quantified across these experiments.

Subsection “tnc mutants have impaired NMJ physiology”, first paragraph: either show larval turning assay results or take the statement out.

Why were white flies chosen for climbing assays? At what age of flies were these experiments performed? An independent experiment with knock-down of tnc would be helpful.

Figure 2: indicate the statistical test used. Indicate in your sample number also how many events were included in the statistics: e.g. 200/13 (200 events from 13 NMJs).

Subsection “tnc mutants have impaired NMJ physiology”, last paragraph: mention that reduced mEJC frequency is also in agreement with reduced quantal content due to less release sites.

Subsection “tnc mutants have impaired NMJ physiology”, last paragraph: "as expected", provide references for this statement.

Subsection “tnc mutants have impaired NMJ physiology”, last paragraph: what interval length was used? This is not indicated in text or figure. Ideally, a plot with increasing length should be shown to illustrate that this is true short-term depression. In the graph indicate that you show the ratio of 1st/2nd pulse

Subsection “tnc mutants have impaired NMJ physiology”, last paragraph: It needs a clear explanation as to why short-term facilitation explains decreased probability. I can come up with my own speculations, but it is the task of the authors to make this clear.

“Both pre- and postsynaptic components modulate neurotransmitter release”: where does this statement come from? It is confusing without further explanation, especially since it is followed by posing this problem and since it opposes the title. Should this be the title of the section?

Subsection “Neuronal Tnc modulates neurotransmitter release”, first paragraph: why "interestingly"? Is this not expected if presynaptic expression leads to release at NMJs and mutants show reduced frequency? Please, build a logic and solid argumentation.

In all graphs, indicate absence of tested significance with a symbol, such as "ns". In this way it is clear which bars were assessed that the asterisks have not simply been forgotten to insert.

Subsection “Neuronal Tnc modulates neurotransmitter release”, last paragraph: the term "recruits" is not supported by the data; at this point you can merely state that tnc seems to act as a ligand for presynaptic integrin.

Figure 3G. I wonder whether only one set of experiments is sufficient here. Reproducing the data through knock-down of talin or inflated would clearly strengthen these observations.

Subsection “Muscle Tnc recruits postsynaptic integrin”, first paragraph: the co-localisation is not convincing and the authors must refine their argumentation. There is too much expression of integrin to make such a statement. Any correlation analyses of tnc would likely show overlap, but there is much expression of integrin that does not correlate. Even more, these data (double-labelling with HRP) clearly confirm previous observations that integrin localises also strongly to SSR, i.e. postsynaptic membrane. Most of the apparent overlap occurs therefore in areas that are irrelevant for the presynaptic function, as demonstrated by lack of effect upon postsynaptic integrin or tnc knock-down.

Figure 4: to address the presynaptic localisation of integrins, it would be very helpful to knock down integrins postsynaptically and see that staining remains in a sharp line only around boutons – which should then vanish in tnc mutant background. Please, combine G and H into one graph (both are normalised anyway)

Subsection “Muscle Tnc recruits postsynaptic integrin”, second paragraph: "secreted into the synaptic cleft"?

Subsection “Muscle Tnc recruits postsynaptic integrin”, second paragraph: loss of βPS upon muscle but not neuronal knock-down of tnc is in stark contrast to data in Figure 1—figure supplement 2 where only neuronal tnc sheds into the synaptic cleft. The stabilisation theory based on ligand binding does therefore not work.

Subsection “Muscle Tnc recruits postsynaptic integrin”, second paragraph: How can the authors suddenly favour postsynaptically derived Tnc, although all their data from before show a physiological relevance only for neuronal Tnc? I am completely lost at this point.

Subsection “Muscle Tnc recruits postsynaptic integrin”, last paragraph: "is required for the recruitment of PAK" – the statement as is, suggests a direct mechanism.

Subsection “Muscle Tnc recruits postsynaptic integrin”: the last sentence is too condensed.

Figure 5: I do not believe the EM data. How many muscles from how many independent animals were analysed? Were larvae processed in the same vial? Image quality is very poor and there is a clear osmolarity effect; from anti-FAK staining one gets the impression that SSR is smaller, yet here it is blown up in mutants. Analyses have to be performed in whole mounts with SSR markers (for example anti-DLG) and EM analyses have to be made more transparent to the reader and properly quantified. The odd shape of boutons looks not more than the section being almost tangential to the bouton. Shape statements are far easier made from whole mount stainings.

Subsection “tnc mutants have disrupted spectrin-based membrane skeleton”, third paragraph: there are no analyses of bouton sizes in the paper, which must be provided for mutant and upon pre- and post-synaptic knockdown of tnc.

Subsection “tnc mutants have disrupted spectrin-based membrane skeleton”: to my knowledge, loss of spectrin causes a cell-autonomous defect in neuronal terminals, i.e. the change in boutons is not caused by loss of spectrin in muscles. This does not fit with the argumentation of the authors.

Subsection “Overexpression of Tnc disrupts postsynaptic βPS integrin and spectrin”: the manuscript gets utterly confusing now, and the authors make no effort to shed light into this. It becomes close to unreadable. There seems to be a constant contradiction between pre- and postsynaptic requirements which are not resolved.

Subsection “Overexpression of Tnc disrupts postsynaptic βPS integrin and spectrin”, second paragraph: please, explain what the point of these experiments is? What do we learn? This is an artificial situation that does not tell us much.

Discussion, first paragraph: integrins are very well known to be locally activated through ligands, so I do not understand this claim.

Reviewer #3:

The manuscript "Tenectin recruits integrin to stabilize bouton architecture and regulate vesicle release at the Drosophila neuromuscular junction" represents an interesting investigation of the role of a secreted EMC protein at the NMJ. The manuscript provides novel information on the role of Tnc in recruiting the integrin complex (αPS2/βPS) to the NMJ along with spectrin and adducin. Overall the manuscript presents interesting and novel insights into the role of Tnc and integrin complexes at the NMJ. Much of the data and the quantitation was convincing and supported the conclusions. However there are a number of points that need to be addressed with the explanation of the data, some of the major conclusions drawn, a need for discussion of alternative hypotheses and the confirmation of the protein complex in vivo. These points are outlined below:

For the RNAi experiments only one tncRNAi line and one mysRNAi was used throughout. Neither of these lines have been previously published to be specific to Tnc or mys and thus this either needs to be proven or alternative previously verified lines used to ensure that there are not any off target effects. Specifically the experiments need at least two RNAi lines used for the Tnc and mys knockdown to ensure no off target effects or RNAi lines verified by others to be specific. The mysRNAi for instance is presumably a weaker one given that muscle knockdown of mys if strong would result in embryonic lethality.

In Figure 3 comparing mEJP Frequency for the tncEP/Dfwas less strongly affected compared to the N>tncRNAi in Figure 3E versus 3B. It is surprising that the RNAi would have a strong effect that the EP/Df combination especially given that in Figure 1 the protein levels were substantively reduced in the EP/Df but not the N>tncRNAi. This disconnect between levels of protein versus phenotypes need to be addressed in the text.

With the residual Tnc immunolabeling present in the tncEP/Df, it is logical to conclude that there is significantly more Tnc present in the N>tncRNAi NMJ. However the degree of reduction of Tnc at the NMJ is not shown with either N>tncRNAi or M>tncRNAi. This should be included or if not, explained. This becomes very relevant in Figure 4 as the effect of M>tncRNAi on the recruitment of αPS2βPS to the NMJ had a stronger effect than N>tncRNAi.

The degree of Tnc loss in the tncEP/Df combination in Figure 1G (and Figure 1—figure supplement 1D) was surprisingly not complete given that the allele seems to be a null. The immunolabeling in the image does not match the quantitation by Western seen in Figure 1C. The phrase "much reduced" in tncEP/Df could be quantified using the approaches utilized throughout the manuscript for all the other markers. The text should also address if this is truly the presence of residual Tnc at the NMJ (and the implications of this) or is this background?

The results from this manuscript suggest that αPS2βPS and Tnc may directly interact. The S2 cell experiment was a strong approach to understanding the associations of Tnc, the integrin complex, spectrin and adducin. A stronger and a necessary approach to investigating the association of these proteins was to prove that these occur in vivo using a proximity ligation assay (PLA) to determine where in the NMJ these associations happen. The advantage of this approach is that the tncEP/Df mutant would serve as a good control as would the different RNAi and overexpression approaches. The PLA experiment would also be able to address if the M>tnc expression was able to recruit the αPS2βPS complex to ectopic sites away from the NMJ. This would go a long way to support many of the conclusions and how a clear link at the NMJ between these protein complexes.

Further to this point, the link between integrins to spectrin and adducin is the key point of interest but other than the S2 cells there is little in the way to support a physical link between these components. It is equally possible that the loss of spectrin or adducin itself may lead to the loss of αPS2βPS from the NMJ. What happens to spectrin or adducin when αPS2 is reduced and vice versa?

For Figure 5 it is mentioned that "In the course of these experiments we noted that tnc mutant NMJs showed aberrant morphology with poorly defined bouton/interbouton boundaries and more tubular branches, particularly in the proximal region." Given that this is the first mention of these different phenotypes, an inclusion of some examples is warranted as prior indications from Figure 2—figure supplement 1 was there were little morphological changes.

For the TEM analysis comments such as "However, the mutant boutons were drastically distorted and no longer maintained normal round/oval shapes" and "This phenotype was highly penetrant and affected all type 1B neurons" should be supported by the number of boutons that were analyzed and the number of synapses/larvae analyzed in the text itself.

The distribution of Dlg should be shown (data not shown throughout the manuscript) and the quantitation provided, especially given the effects on adducin on Dlg at the NMJ. This later point should be addressed in the text as well.

The M>tncRNAi data with α-spectrin showed no decrease compared to the UAS-tncRNAi control. While the N>tncRNAishowed an upregulation. Yet the tncEP/Df displayed a reduction in α-spectrin. The manuscript needs to address these differences and provide a model to help guide through the different interpretations of these effects.

The manuscript makes the statement "Since neuron-derived Tnc recruits βPS integrin in the motor neurons to modulate neurotransmitter release (Figure 3…)" – this is a very strong statement given that N>tncRNAishowed a mild increase of the distribution of βPS to the NMJ (Figure 4L, 4N) and the effect on αPS2 is not shown. Figure 3 provides no evidence that the changes observed with N>tncRNAi are due to the loss of βPS. This would require a rescue experiment to provide a direct link.

The interpretations and conclusions for the role of neuronal or muscle driven Tnc need to be tempered. N>tnc rescued the degree of βPS present at the NMJ in the tncEP/Df mutant while M>tnc did not and this lead to the conclusion that neuronal Tnc is key to the recruitment of βPS. Yet N>tnc alone decreases the βPS at the NMJ (Figure 7C, 7E) compared to controls while N>tncRNAi knock down (Figure 4L, 4N) shows slight more βPS at the NMJ compared to control. This suggests that neuronal derived Tnc blocks integrin accumulation at the NMJ. On the muscle side of the equation M>tnc cannot rescue the tncEP/Df which isn't too surprising given that M>tnc removes all the tnc from the NMJ. Thus these experiment don't prove that neuronal derived Tnc is sufficient and necessary to recruit βPS. Especially given that Tnc knockdown in muscles but not in neurons reduced the amount of synaptic βPS.

Along these lines the tnc mutants with muscle overexpressed tnc had a dramatic reduction in βPS as well as the M>tnc in a wild type background. The panels from Figure 1J, Figure 1—figure supplement 1F and Figure 1—figure supplement 2F would suggest that overexpression of tnc may be significantly deleterious to the entire NMJ not just the distribution of βPS.

The authors state that expression of N>tnc in the tncEP/Df mutant was able to rescue the reduction in α-spectrin however the degree of increase in α-spectrin does not appear to be strong. For the quantitation (Figure 6J) it was not clear what was being compared –.…each experimental to control which would suggest that the N>tnc was significantly different from control (and didn't rescue to a great extent) –.…or each experimental to each other which would suggest that all three experimental were significant different from each other which didn't appear to be the case. For this type of multiple experiment analysis it would also be more relevant to carry out a One Way Anova with a post hoc multi-comparison test rather than a students' t-test.

It was also intriguing that the degree of rescue of Adducin and βPS immunolabeling at the NMJ was so much better than that for α-spectrin with the N>tnc. Given the strength of the statements made in the text is it possible the wrong data was included in Figure 6J?

The major conclusion from this section should be tempered to reflect that neuronal expression of Tnc can rescue the tncEP/Df spectrin, βPS and adducin levels. Whether M>Tnc is able or not will require a more measured approach to ensure that muscle expressed Tnc is present at the NMJ, that the muscles themselves are not deleteriously affected. This might be case given the stronger effects on βPS by the increased expression of Tnc in wild type muscles compared to the tncEP/Df muscles. These effects may simply by an increase the deleterious effects of Tnc expression and thus lead to a great disruption of NMJ morphology rather than an specific effect on "ligand redundancy and/or other mechanisms may allow for partial βPS and/or α-Spectrin synaptic accumulation". Would the increased expression of Tnc or any ECM component lead to disruption of muscles as a result from ER stress?

The statement "Unlike βPS, which was completely lost at these NMJs" is not supported by the images presented in Figure 4E, Figure 6B and 6E: βPS is not completely lost at these NMJs. The authors need to be more careful about making this type of absolute statement.

[Editors’ note: what now follows is the decision letter after the authors submitted for further consideration.]

Thank you for resubmitting your work entitled "Tenectin recruits integrin to stabilize bouton architecture and regulate vesicle release at the Drosophila NMJ" for further consideration at eLife. Your revised article has been favorably evaluated by K VijayRaghavan (Senior Editor), a Reviewing Editor, and three reviewers.

The manuscript has been improved and the reviewers were impressed by the quality and amount of data. However, there are some remaining issues that need to be addressed before acceptance, as outlined below:

Two of the reviewers requested to add controls, including additional RNAi lines for tenectin, and for the GAL4 used. This can be done speedily. Also, the genetic interaction between βPS and tenectin mutants would further support the results indicated by reviewer 1. Please see if you can do this.

Below, please find the specific comments of three reviewers.

Reviewer #1:

Wang et al. report an interesting finding on distinct pre-synaptic and post-synaptic roles for tenectin (Tnc), a selective integrin ligand, at the Drosophila neuromuscular junction (NMJ). Tnc in the neuron interacts with βPS/αPS2 integrin to control neurotransmitter release, whereas Tnc in the muscle interacts with post-synaptic αPS2/βPS integrin to regulate bouton morphology. By manipulating Tnc, they uncovered a novel role for integrin in recruiting the spectrin based membrane skeleton at the NMJ.

This paper will be of broad interest to the readership of eLife because it advances our understanding of NMJ development and synaptic physiology, as well as integrin/extracellular matrix biology. Although Tnc has been studied at the Drosophila NMJ, Wang et al. is among the first to reveal that Tnc has differential function in neurons and muscle. The data presented in this paper is thorough, with good controls and overall high-quality figures. However, I have two major concerns that should be addressed before publication. First, the inclusion of only one RNAi line targeting Tnc is insufficient, especially given the fact that the neuronal RNAi line only knocks down Tnc levels to 43% of control. The inclusion of at least two RNAi lines showing the same phenotype would both confirm and strengthen the author's conclusions. This is not a detail and needs to be addressed.

Second, the conclusion that αPS2, βPS, and Tnc function together to modulate neurotransmitter release (Figure 2) should be strengthened by genetic interaction experiments between βPS and Tnc indicating that either a) double mutants do not have a more severe phenotype, or b) trans-heterozygotes show enhancement of phenotype.

Reviewer #2:

Tenectin recruits integrin to stabilize bouton architecture and regulate vesicle release at the Drosophila NMJ' Wang et al.

In this manuscript the authors identify the mucin class protein tenectin as an ECM component of the Drosophila NMJ synapse from an interaction screen with Neto. The description of tenectin mutants is comprehensive, the technical quality of the data is high and the authors do identify interesting interactions with integrins. However ultimately little new insight is gained into the role of the ECM in synapse development or function beyond the identification of a new component. As such, the manuscript seems better suited to a more specialised neuroscience journal.

Reviewer #3:

The manuscript by Wang et al. reports a novel function of tenectin (tnc) at the neuromuscular junction (NMJ) in Drosophila. The authors have identified Tnc, a mucin-like protein in a genetic screen for regulators of Neto, that the Serpe lab has previously shown to be required at the NMJ. In this elegant study, the authors use a combination of physiology, immunostainings and genetic approaches to probe the pre- and post-synaptic roles of tnc at the NMJ. Their results show that tnc mutants have reduced mini frequency, EJPs and quantal content. Paired pulse facilitation experiments show that tnc mutants have lower release probability. Next, the authors use pre- and post-synaptic specific manipulations (knock-down and rescue) to show that tnc is required in neurons but not muscles for normal neurotransmitter release. They further show that presynaptic RNAi knock-down of α and β integrin genes phenocopy the tnc phenotypes and suggest that tnc may act as an integrin ligand. Next, the authors examine the effects of altering tnc levels pre- and post-synaptically on integrins and synaptic morphology at the NMJ and find that the source and dose of tnc are critical determinants of bouton architecture and synaptic function. S2 cell experiments nicely show the ability of Tnc to cluster integrins as also suggested by the PLA assay.

Overall, this is an interesting study that sheds key novel insights into the role of extracellular matrix ligands and receptors in shaping the NMJ architecture and function. Although in my opinion the spectrin connection does not add much to the story and the precise mechanism remains to be established (it may have to do with post-translational modifications, as suggested) this study is well executed, novel and of broad interest.

My only criticism is the absence of driver controls for phenotypic studies. While the authors use the UAS lines as background, which is fine, it is rather standard and important to control for any potential contributions of the GAL4 drivers to the phenotypes evaluated here.

eLife. 2018 Jun 14;7:e35518. doi: 10.7554/eLife.35518.026

Author response


[Editors’ note: the author responses to the first round of peer review follow.]

All three reviewers (see below their comments) expressed major criticism regarding the manuscript conclusions. The major comment is that the results are confusing and some time contradicting regarding the muscle, versus neuron-dependent function of Tenectin in recruiting integrins to the NMJ. In addition a direct versus indirect effect of Tenectin on the levels of Spectrins at the NMJ should be further validated. Many controls are also missing.

We hope you find our comments useful. If you address these comments and would like to make a fresh submission at eLife, rather than elsewhere, we will be happy to examine this afresh.

I would like to express my deep appreciation to all reviewers for their careful consideration of this manuscript and for their very useful comments and suggestions. The current extensively revised manuscript includes a set of completely new ideas that were generated because of the expert comments we received from our reviewers. We have built a new, more refined model for the pre- and post-synaptic Tnc functions by carefully addressing all the suggestions from the reviewers and by expanding our study to include many additional experiments and new types of assays.

As all the reviewers pointed out, this is a complex system, distributed asymmetrically between the pre- and post-synaptic compartments, and also sensitive to the source and the dose of Tnc.

1) To clarify the contributions of pre- and postsynaptic Tnc, we first searched for additional metrics to characterize the muscle-specific functions of Tnc. On the neuron side, Tnc-dependent activities are clearly measured using very sensitive electrophysiological recordings. We found that postsynaptic Tnc is not only required for normal postsynaptic specializations, such as subsynaptic reticulum (SSR), but also for normal bouton size. Loss of muscle Tnc produces significantly smaller synaptic boutons. Bouton size appears to be a very reliable and informative read-out for Tnc activities in the muscle and was utilized throughout this revised manuscript.

2) Secondly, to deliver very low, physiologic levels of Tnc in the muscle, we first screened our large collection of individual tnc transgenes. Since none of the 20 lines screened had sufficiently low expression levels, we had to utilize a battery of muscle specific drivers and low temperature rearing conditions. These manipulations allowed us to expand the dose-dependent experiments and provide a comprehensive set of analyses for the Tnc function and distribution in rescue and overexpression settings.

3) Using these refined analyses, we were able to show that although Tnc associates with integrin even in tissue culture settings, only the cis Tnc/integrin complexes appear to have normal activity in vivo. This is a big departure from our original interpretation that extracellular Tnc can bind to integrin on either side of the synaptic cleft and engage in compartment-specific activities.

In this revised manuscript we have carefully controlled the dose of Tnc to demonstrate that:

a) Endogenous levels of muscle Tnc rescued the accumulation and function (bouton size) of the muscle Tnc/integrin complexes at tnc NMJs.

b) In contrast, complexes formed by neuronal Tnc and muscle integrin partially accumulate at tnc mutant terminals, but these trans complexes did not function properly as they did not rescue the bouton size and the levels of synaptic α-Spectrin.

c) In addition, we have successfully visualized a presynaptic pool of integrin – as suggested by one reviewer.

4) Genetic manipulations of tnc, mys/βPS and if/αPS2 allowed us to assign these functions to the Tnc/integrin complexes and to establish that the synaptic accumulation of α-Spectrin is downstream these complexes.

5) The Tnc/integrin co-localization studies were greatly enhanced by new assays suggested by our reviewers, in particular the PLA.

6) The in vivo differences between cis and trans Tnc activities indicate that the motor neurons and the muscles secrete functionally different Tnc proteins, presumably with different posttranslational modifications. Our new Western blot analyses suggest the possibility of muscle specific processing, since a set of three faint bands are visible for Tnc overexpressed in muscle vs. mostly one band for neuronal Tnc.

7) As the reviewers predicted, refining our experimental approaches revealed an intricate regulation of the Tnc/integrin complexes. For example:

a) The neuron-derived Tnc and βPS integrin limit the synaptic accumulation of (i) muscle Tnc/integrin complexes, and (ii) α-Spectrin.

b) Excess neuronal Tnc appears to disperse the synaptic Tnc/integrin complexes (which are predominantly postsynaptic) and thus reduce the bouton size.

c) A short and weak pulse of tnc expression in the muscle induces elevated levels of synaptic Tnc and integrin; a longer pulse or constant muscle overexpression effectively disrupt the Tnc/integrin accumulation at synaptic terminals and produce aberrant NMJ morphology.

In summary, our revised model proposes that Tnc is a tightly regulated component of the synaptic ECM that functions in cis to recruit αPS2/βPS integrin and the spectrin-based membrane skeleton at synaptic terminals and together modulate the NMJ development and function. trans Tnc/integrin complexes can form but cannot function properly at synaptic terminals and instead appear to exhibit dominant-negative activities.

Once again, all these important insights were possible because of the thoughtful suggestions from our reviewers. We are very grateful for their consideration and help.

Reviewer #1:

This paper describes the expression and function of Tenectin at the larval NMJ. While there is a lot of information in the paper, it will primarily be of interest to specialists in fly neuromuscular system development.

We respectfully disagree with the reviewer as the nature and biology of integrin ligands is poorly understood across the animal kingdom. Although Tnc has no direct human homologue, Tnc is a typical mucin, with a highly recognizable organization (two large PTS domains, multiple vWFC and RGD-like motifs). Our discovery of a synaptic mucin that binds integrin and controls synapse development and function opens the door to probe for similar mechanisms that modulate integrin recruitment and function at synapses. Furthermore, this study reveals a completely novel connection between the spectrin-based membrane skeleton and the ECM/integrin complexes. This association may inform the current research on the highly ordered spectrin network observed in mammalian neurons and dendrites.

There are also some problematical aspects to the data, as follows:

1) Maybe I am not understanding something here, but there seems to be an unresolved contradiction about cis vs. trans action of Tnc. They show that muscle, but not neuronal Tnc knockdown reduces βPS expression (Figure 4M) and from this (subsection “Muscle Tnc recruits postsynaptic integrin”, second paragraph) they conclude that it muscle Tnc acts in cis to recruit βPS, which is primarily expressed in muscles.

However, in Figure 6 they show that in a tnc mutant the loss of expression of βPS is restored by neuronal expression of Tnc, indicating that it is acting in trans (Figure 6D). When they express Tnc in muscles they lose βPS expression. The results in Figure 4 would predict that neuronal expression of Tnc in the mutant should not rescue, since neuronal knockdown does not affect βPS, and that muscle expression of Tnc should rescue, since muscle knockdown decreases βPS. Perhaps this is a Tnc overexpression phenotype. To test this, they should use weaker muscle drivers and reduce the temperature to reduce GAL4 activity, or make a direct muscle promoter>Tnc fusion. Unless I am missing something here, if they can express Tnc at physiological levels in the muscles in a tnc mutant, this should rescue βPS expression, not eliminate it.

The reviewer is absolutely correct and our new experiments along this line (included in Figure 7) support this view: physiological levels of Tnc in the muscle indeed rescued the defects observed in a tnc mutant.

We have followed the reviewer’s advice and refined our rescue experiments by using additional weak promoters, such as BG487-Gal4, which has graded expression (a) along the anterior posterior axis and (b) in different muscle subsets. We further reduced the Tnc expression levels by means of low rearing temperatures. Using this weak promoter and rearing the animals at 18°C, we managed to reduce the levels of Tnc in the muscles to ~2 fold more than endogenous levels. In these conditions we observed complete muscle rescue.

We apologize for the confusing way in which we previously described this complicated system. As recommended by reviewers, we performed and included in this manuscript a large number of experiments to better characterize the presynaptic and postsynaptic functions of Tnc, to distinguish between cis vs. trans Tnc activities, and to clearly describe the dose-dependent phenomena. As summarized above, our revised analyses demonstrate that in vivo Tnc functions in cis. Neuron-derived Tnc could form only unproductive complexes in trans with the muscle integrin.

2) The data in Figure 8 are not convincing. Looking at the high-mag views of the HA beads and placing them into the low-mag views of the cells, one can see that there is no accumulation of βPS, αPS2, or spectrin around the beads relative to their levels elsewhere in the cells. In fact the beads are in low-expression areas for all of these markers. Given this, one cannot believe that the levels of these markers are lower around the control beads. No high-mag views of the control beads are shown, and you can't even see these beads in the fluorescent images since they are not labeled. To do this experiment correctly, they need to use a different HA-tagged protein on the control beads, so that they can be seen in the fluorescent images, and show equivalent high-mag views of the beads so that it can be determined if there is really more integrin around the beads. This should also be quantitated by measuring fluorescence intensity in the bead regions in Tnc-HA vs. Control protein-HA beads.

As the reviewer suggested, we repeated these experiments using control beads coupled with an unrelated HA-tagged protein. We also included high-magnification views of the control and experiment beads as requested by the reviewer. This new set of data is presented in Figure 8 and clearly illustrates the ability of Tnc-HA coated beads, but not control beads, to recruit integrin and α-Spectrin.

3) Figure 8—figure supplement 1 is also unconvincing and incomplete. There is clearly a lot of βPS within the cell in Tnc-HA expressing cells, but levels at the cell surface are not clearly increased (at least the images shown do not demonstrate this). They could address this by staining live cells with anti-βPS without detergent. Maybe Tnc-HA is expressed at very high levels and sequesters βPS within a secretory compartment where it cannot be degraded, thus increasing its intracellular levels. This does not show that Tnc-HA acts in cis to increase integrin surface localization.

We fully agree with the reviewer regarding the limitations of this experiment. Therefore, we toned down our interpretation and included the alternative possibility that the reviewer suggested.

4) If they want to evaluate whether Tnc-HA induces βPS, they should make a stable S2 line expressing Tnc-HA, which is easily done using stable transformation vectors. If Tnc-HA expression is toxic they can drive it from a conditional promoter. Similarly, they can use stable transfection to knock down βPS with RNAi if the transient RNAi knockdown is inadequate (subsection “Tnc engages integrin and spectrin at the cell membrane”, first paragraph).

Whether Tnc-HA also induces βPS transcriptional expression is likely via an indirect mechanism. This has very little relevance for the phenomena characterized here and therefore has not been pursued.

Reviewer #2:

This work by Wang and colleagues has some clear merits and high potential, but I do not recommend publication, but rather rejection with the option to re-submit. The main reason for this suggestion is the lack of clarity across the paper how experiments link together into new understanding. In my view there are seemingly contradicting results in this work that suggest a very intricate role and regulation of tnc, but have to be resolved before this manuscript can be considered for publication. The contradictions mainly consist in obscure effects observed upon pre- versus post-synaptic manipulations that require a far more refined experimental approach and logic dissection. Instead, data are being uncritically reported and the reader is left alone with a highly confusing message, if any message at all. There is potential in many of the data, but the authors failed to turn them into a readable and informative manuscript. Apart from these shortcomings there are a number of further issues that need clarification. See my detailed comments below.

We thank the reviewer very much for appreciating the clear merits and high potential of our work. As he pointed out, our findings uncovered a very intricate role and regulation of tnc that required a more refined experimental approach. In this expanded, revised manuscript, we have methodically addressed all the comments and suggestions of the reviewer and indeed come to a new appreciation about Tnc function and regulation. We hope this extensively revised manuscript clearly captures our current understanding and conveys our excitement about the phenomena that we have discovered and reported here.

Detailed comments:

The Introduction reads well and provides a sound overview of ECM at mammalian and Drosophila synapses. It would be helpful to mention the obvious gaps of understanding in the field and how this work addresses these gaps. A tip: do the authors know this review: Singhal, N., Martin, P. T. (2011). Role of extracellular matrix proteins and their receptors in the development of the vertebrate neuromuscular junction. Dev Neurobiol 71, 982-1005 – https://doi.org/10.1002/dneu.20953

As the reviewer recommended, we modified the last paragraphs in the Introduction to summarize the gaps in the field and our contributions. The revised Introduction includes the following sentences:

“In flies as in vertebrates, the ECM proteins and their potential receptors have important roles in synapse development, but their functions have been difficult to assess at the genetic level due to the complexity of interactions of these large proteins.”

“Here, we report the functional analysis of Tenectin (Tnc), an integrin ligand secreted from both motor neurons and muscles that accumulates at synaptic terminals and functions in cis to differentially engage presynaptic and postsynaptic integrin.”

Introduction or start of Results: It needs to be clearly stated that tnc has no mammalian homologue.

The of reviewer is correct in that Tnc has no clear mammalian. As suggested we have stated that early in the Results (subsection “Tnc localizes at synaptic terminals”, first paragraph). However, Tnc has a highly recognizable organization typical for all mucin-type proteins.

“Using a polyclonal anti-Tnc antibody (Materials and methods) we found that Tnc signals are concentrated during late embryogenesis in the ventral cord, near the pioneer, anti-Fasciclin II (FasII) positive axons (Figure 1—figure supplement 1A, B and (Fraichard et al., 2006)): For this statement, the resolution of analyses is far too low, and I do not think that this statement is important. Delete and stay with the statement that staining it is strongly enriched in the neuropile.

We made the recommended change (subsection “Tnc localizes at synaptic terminals”, second paragraph).

“In contrast, the Tnc CNS signals were absent in a tnc mutant (tncEP – P[EPgy2]EY03355), predicted to disrupt both known tnc transcripts (Syed et al., 2012)”: Point out that Fas2 pattern is not disturbed in the mutant CNS. Obviously, there is not interaction with reported functions of integrins in this context:

Stevens and Jacobs, 2002; Broadie, Baumgartner and Prokop, 2011.

We have extended our experiments to document the Fas2 pattern in control and tnc mutant embryo CNS (Figure 1—figure supplement 1C, D).

Subsection “Tnc localizes at the synaptic cleft”, second paragraph: indicate the two tnc transcripts in Figure 1A.

We have updated the Figure 1A to indicate the two tnc transcripts.

Subsection “Tnc localizes at the synaptic cleft”, second paragraph and thereafter: the correct term is "hetero-allelic": if tncDf is a true deficiency you need to talk of a "hemizygous" condition.

We have made this correction throughout the text.

Subsection “Tnc localizes at the synaptic cleft”, third paragraph”: At this early point, the pre-postsynaptic statement cannot be made. Tnc expression in the neuropile is in patches which might reflect staining around dendrites. Therefore, the expression/localisation in motorneuons may well be postsynaptic (equivalent to muscle expression in the periphery).

We removed this statement as recommended.

Subsection “Tnc localizes at the synaptic cleft”, third paragraph”: Does complete knock-down in the CNS get rid of all expression or is tnc only expressed in motorneurons but not very efficiently knocked down? Along these lines, given potentially expected different driver strengths in CNS and muscles, the conclusions about where tnc is strongest expressed cannot be drawn from the knock-down data.

We have revised these sentences and conclusions.

Subsection “Tnc localizes at the synaptic cleft”, last paragraph”: the staining does not look like being around nuclei, but seems suprisingly nuclear. If it were in Golgi or ER, it would have a broader expression.

The reviewer is right: There is a clear nuclear signal in the muscle nuclei. Upon further examination, we suspect that this signal is nonspecific, as the polyclonal Tnc antibodies label two more small bands in the larval muscle (see below). The intensities of these bands do not vary with the Tnc levels in the muscle.

We have revised the images to direct the reader’s focus on the NMJ structures and, when appropriate, on the muscle attachment sites.

Subsection “Tnc localizes at the synaptic cleft”, last paragraph”: the reduced staining is not very convincing. This needs to be quantified.

We have quantified these signals and reported the data in Figure 1—figure supplement 1E.

Subsection “Tnc localizes at the synaptic cleft”, last paragraph: either show and quantify the tnc over-expression data or take them out.

We have quantified these overexpression signals and reported the data in Figure 1—figure supplement 1E.

Figure 1—figure supplement 2 is not well described in its legend and is confusing. What nuclei are shown on the right? I guess it is muscle nuclei? But why is there no expression in those when driving tnc with 24B (bottom right image). Please, clarify, because at the moment this does not make sense. Expression data must be quantified across these experiments.

We apologize for the confusion; this supplemental figure is focused on NMJ branches and boutons of larvae expressing a tnc-HA transgene. We have provided a clearer description in the main text and in the revised figure legend.

Subsection “tnc mutants have impaired NMJ physiology”, first paragraph: either show larval turning assay results or take the statement out.

As suggested, we have removed these additional assay results.

Why were white flies chosen for climbing assays? At what age of flies were these experiments performed? An independent experiment with knock-down of tnc would be helpful.

These experiments were performed with 10 days-old adults; we have included this information in the figure legend. w1118 flies have been used as controls throughout this study.

We have repeated the climbing assay for knock-down of tnc in motor neurons and muscle. The resulting animals had relatively normal climbing behavior, presumably due to either incomplete RNAi and/or tissue specific restricted manipulations. We did not include these new analyses as they were not informative.

Figure 2: indicate the statistical test used. Indicate in your sample number also how many events were included in the statistics: e.g. 200/13 (200 events from 13 NMJs).

We have provided the technical details for the electrophysiology experiments in the Materials and methods section.

- To calculate mEJP mean amplitudes, 100 events from each 10 or more NMJs (only one NMJ per animal was used) and were measured and averaged using the Mini Analysis program (Synaptosoft).

- Statistical analysis was performed with KaleidaGraph 4.5 (Synergy Software) using ANOVA followed by a Tukey post hoc test.

Subsection “tnc mutants have impaired NMJ physiology”, last paragraph: mention that reduced mEJC frequency is also in agreement with reduced quantal content due to less release sites.

The reviewer is correct: reduced mEJP frequency is in agreement with reduced quantal content due to fewer release sites. As recommended, we have included this alternative possibility (subsection “tnc mutants have impaired NMJ physiology”, last paragraph). However, based on our PPR analyses, we favor the explanation that tnc electrophysiological defects are primarily due to significantly decreased probability of vesicle release.

Subsection “tnc mutants have impaired NMJ physiology”, last paragraph: "as expected", provide references for this statement.

We have provided the needed reference and expanded this paragraph to build a better explanation for these data.

Subsection “tnc mutants have impaired NMJ physiology”, last paragraph: what interval length was used? This is not indicated in text or figure. Ideally, a plot with increasing length should be shown to illustrate that this is true short-term depression. In the graph indicate that you show the ratio of 1st/2nd pulse.

Paired stimuli (200 µsec, 1.9 V) were separated by duration of 50 ms.

In this revised figure legend we have included detailed information as requested by the reviewer.

Subsection “tnc mutants have impaired NMJ physiology”, last paragraph: It needs a clear explanation as to why short-term facilitation explains decreased probability. I can come up with my own speculations, but it is the task of the authors to make this clear.

As mentioned above, we have entirely revised this paragraph to better explain our results and make our conclusions clear.

“Both pre- and postsynaptic components modulate neurotransmitter release”: where does this statement come from? It is confusing without further explanation, especially since it is followed by posing this problem and since it opposes the title. Should this be the title of the section?

As recommended by the reviewer, we have removed this sentence.

Subsection “Neuronal Tnc modulates neurotransmitter release”, first paragraph: why "interestingly"? Is this not expected if presynaptic expression leads to release at NMJs and mutants show reduced frequency? Please, build a logic and solid argumentation.

We re-wrote this section as suggested.

In all graphs, indicate absence of tested significance with a symbol, such as "ns". In this way it is clear which bars were assessed that the asterisks have not simply been forgotten to insert.

We have included “ns” marks throughout this revised manuscript.

Subsection “Neuronal Tnc modulates neurotransmitter release”, last paragraph: the term "recruits" is not supported by the data; at this point you can merely state that tnc seems to act as a ligand for presynaptic integrin.

We have made the change as requested.

Figure 3G. I wonder whether only one set of experiments is sufficient here. Reproducing the data through knock-down of talin or inflated would clearly strengthen these observations.

As recommended, we extended our analyses and indeed reproduced these findings for inflated (αPS2) knockdown in motor neurons and muscles. The new set of data is included in the main Figure 3J-L.

Subsection “Muscle Tnc recruits postsynaptic integrin”, first paragraph: the co-localisation is not convincing and the authors must refine their argumentation. There is too much expression of integrin to make such a statement. Any correlation analyses of tnc would likely show overlap, but there is much expression of integrin that does not correlate. Even more, these data (double-labelling with HRP) clearly confirm previous observations that integrin localises also strongly to SSR, i.e. postsynpatic membrane. Most of the apparent overlap occurs therefore in areas that are irrelevant for the presynaptic function, as demonstrated by lack of effect upon postsynaptic integrin or tnc knock-down.

We have strengthened our co-localization studies by expanding these analyses, and including a proximity ligation assay, as suggested by reviewer #3. These data have been added in the revised Figure 4.

As the reviewer noted, the Tnc distribution is more restricted than that of integrin. Based on Western blot and immunohistochemistry analyses of various tagged and untagged tnc transgenes, we suspect that our polyclonal antibodies against Tnc, raised against an N-terminal epitope, may recognize just a portion of the synaptic pool of Tnc; the N-terminal may be removed during post-translational processing. More data describing our polyclonal antibodies and suggesting the presence of post-translation processing of Tnc in the muscle have been included in an additional supplementary figure (Figure 7—figure supplement 1).

In the course of this study we tried (1) to generate antibodies using several internal Tnc epitopes, and (2) to reproduce the successful antibodies raised against the N-terminal epitope (Frainchard et al., 2006). We only succeeded in reproducing the previously published antibodies; other internal epitopes yielded very weak if any immunoreactivities.

Figure 4: to address the presynaptic localisation of integrins, it would be very helpful to knock down integrins postsynaptically and see that staining remains in a sharp line only around boutons – which should then vanish in tnc mutant background. Please, combine G and H into one graph (both are normalised anyway)

As the reviewer pointed out, our data confirm previous reports that βPS integrin localizes strongly to SSR/ postsynaptic membrane.

We tried to follow the reviewer’s suggestion to knock-down integrin in the muscle and reveal the presynaptic pool. However, depletion of integrins in the muscle severely affected the muscle development before the loss of postsynaptic βPS was evident. Instead, we performed a similar experiment by introducing a pulse of postsynaptic Tnc and monitoring the disappearance of βPS from synaptic locations.

In brief, we reared the BG487-Gal4/ UAS-tnc flies at 18°C then moved them at 25°C for 4h, 8h or 12h. We found that the levels of synaptic Tnc increased at these time points but the postsynaptic βPS levels decreased, revealing a clear pool of presynaptic βPS. The 8h time point results have been included in the revised Figure 8. When these flies have been maintained at 25°C for longer periods, we observed an apparently complete disruption of synaptic βPS, such as reported for chronic overexpression settings (Figure 8D).

Subsection “Muscle Tnc recruits postsynaptic integrin”, second paragraph: "secreted into the synaptic cleft"?

We have changed to “secreted at synaptic terminals”.

Subsection “Muscle Tnc recruits postsynaptic integrin”, second paragraph: loss of βPS upon muscle but not neuronal knock-down of tnc is in stark contrast to data in Figure 1—figure supplement 2 where only neuronal tnc sheds into the synaptic cleft. The stabilisation theory based on ligand binding does therefore not work.

We think that the stabilization theory is still valid but it is compounded here because of the source- and dose-dependent Tnc distribution and function. When Tnc is secreted from the neurons, it first accumulates and presumably stabilizes integrin at synaptic terminals; high excess Tnc disperses away from the synaptic terminal. This may reflect limiting presynaptic levels of integrin and non-productive postsynaptic trans Tnc/integrin complexes, which are not stabilized and retained at synaptic terminals.

Similarly for the muscle Tnc: a low pulse of Tnc expression induces an initial increase of synaptic Tnc and integrin (as shown in the revised Figure 8G-H’); further tnc expression a produces a striking reduction of Tnc/integrin signals at synaptic locations. We interpret this apparent dispersion as an inability of excess Tnc to be recruited/ stabilized at synaptic terminals. Consequently, Tnc accumulates elsewhere on the muscle membrane (or in the secretory compartment) where it may sequester the integrins.

Subsection “Muscle Tnc recruits postsynaptic integrin”, second paragraph: How can the authors suddenly favour postsynaptically derived Tnc, although all their data from before show a physiological relevance only for neuronal Tnc? I am completely lost at this point.

We apologize for the confusion. We revised the sentence to specify that postsynaptic Tnc is required for the structural integrity of synaptic boutons.

As the reviewer noted before, the predominant pool of integrin at synaptic terminals is postsynaptic. We wanted to document that postsynaptic integrin depends on Tnc for its distribution. In this revised manuscript, we have assigned a clear role for the cis Tnc/integrin postsynaptic complex in controlling bouton size and SSR integrity. Thus, Tnc-dependent complexes assemble in both pre- and post-synaptic compartments and perform distinct functions.

Subsection “Muscle Tnc recruits postsynaptic integrin”, last paragraph: "is required for the recruitment of PAK" – the statement as is, suggests a direct mechanism.

We replace this statement to “βPS integrin precedes the recruitment of PAK” as we wish to point out the difference in the sequence of events observed at the NMJ.

Subsection “Muscle Tnc recruits postsynaptic integrin”: the last sentence is too condensed.

As suggested, the sentence was split in two.

Figure 5: I do not believe the EM data. How many muscles from how many independent animals were analysed? Were larvae processed in the same vial? Image quality is very poor and there is a clear osmolarity effect; from anti-FAK staining one gets the impression that SSR is smaller, yet here it is blown up in mutants. Analyses have to be performed in whole mounts with SSR markers (for example anti-DLG) and EM analyses have to be made more transparent to the reader and properly quantified. The odd shape of boutons looks not more than the section being almost tangential to the bouton. Shape statements are far easier made from whole mount stainings.

We set up a new collaboration towards obtaining a new set of improved electron micrographs. Consequently, this manuscript has an additional author.

We also followed all the reviewer suggestions and included whole mount stainings with Dlg to further characterize the bouton phenotypes and the SSR defects. These data have been included in the revised Figure 5.

Subsection “tnc mutants have disrupted spectrin-based membrane skeleton”, third paragraph: there are no analyses of bouton sizes in the paper, which must be provided for mutant and upon pre- and post-synaptic knockdown of tnc.

We thank all reviewers for requesting extensive analyses of bouton sizes. These detailed analyses were instrumental in characterizing the postsynaptic function of Tnc/integrin complexes and helped us clarify critical aspects of this study.

In this revised manuscript we have included multiple analyses of bouton sizes for a wide variety of genotypes.

Subsection “tnc mutants have disrupted spectrin-based membrane skeleton”: to my knowledge, loss of spectrin causes a cell-autonomous defect in neuronal terminals, i.e. the change in boutons is not caused by loss of spectrin in muscles. This does not fit with the argumentation of the authors.

The effects of loss of spectrin in both neurons and muscles have been examined in a pair of papers from Graeme Davis laboratory: Pielage et al., 2005; Pielage et al., 2006.

They report:

1) “The most striking phenotype at NMJs that lack either post- synaptic α- or β-Spectrin is the disruption of the SSR.”

“The SSR is generally thinned above and below the synaptic bouton (orthogonal to the muscle surface) and stretched laterally (parallel to the muscle surface).”

2) “Bouton number is significantly reduced in animals lacking either α- or β-Spectrin, demonstrating that postsynaptic Spectrin is necessary for normal NMJ growth.”

These phenotypes are stronger but similar to those observed in our analyses. Also, although the size of the boutons is not measured, they report reduced NMJ growth and show images with smaller boutons.

Subsection “Overexpression of Tnc disrupts postsynaptic βPS integrin and spectrin”: the manuscript gets utterly confusing now, and the authors make no effort to shed light into this. It becomes close to unreadable. There seems to be a constant contradiction between pre- and postsynaptic requirements which are not resolved.

As outlined above, we have extensively revised this section, starting with clearly delineating the pre- and post-synaptic requirements for Tnc, and providing comprehensive dose-dependent analyses. Using these refined approaches, we showed that only the cis Tnc/integrin complexes have normal activities in vivo. This is a big departure from our original interpretation that extracellular Tnc can bind to integrin on either side of the synaptic cleft and engage in compartment-specific activities.

The reviewer was correct all along and helped us see that our original data pointed elsewhere. We are very grateful for his tremendous help.

Subsection “Overexpression of Tnc disrupts postsynaptic βPS integrin and spectrin”, second paragraph: please, explain what the point of these experiments is? What do we learn? This is an artificial situation that does not tell us much.

The reviewer is correct: these data are less informative and do not enhance our story. We have eliminated these experiments.

Discussion, first paragraph: integrins are very well known to be locally activated through ligands, so I do not understand this claim.

We have removed this sentence, as suggested.

Reviewer #3:

The manuscript "Tenectin recruits integrin to stabilize bouton architecture and regulate vesicle release at the Drosophila neuromuscular junction" represents an interesting investigation of the role of a secreted EMC protein at the NMJ. The manuscript provides novel information on the role of Tnc in recruiting the integrin complex (αPS2/βPS) to the NMJ along with spectrin and adducin. Overall the manuscript presents interesting and novel insights into the role of Tnc and integrin complexes at the NMJ. Much of the data and the quantitation was convincing and supported the conclusions. However there are a number of points that need to be addressed with the explanation of the data, some of the major conclusions drawn, a need for discussion of alternative hypotheses and the confirmation of the protein complex in vivo. These points are outlined below:

We thank the reviewer for the kind comments on the novelty and quality of our work and for the thoughtful suggestions and comments that greatly enhanced this manuscript. Because of the points that this reviewer raised we expanded our analyses and gained critical insights in the regulation of Tnc and Tnc-dependent complexes. In addition, the PLA experiments that this reviewer suggested strengthened our claim that Tnc and integrin share the same space at synaptic terminals.

For the RNAi experiments only one tncRNAi line and one mysRNAi was used throughout. Neither of these lines have been previously published to be specific to Tnc or mys and thus this either needs to be proven or alternative previously verified lines used to ensure that there are not any off target effects. Specifically the experiments need at least two RNAi lines used for the Tnc and mys knockdown to ensure no off target effects or RNAi lines verified by others to be specific. The mysRNAi for instance is presumably a weaker one given that muscle knockdown of mys if strong would result in embryonic lethality.

As the reviewer pointed out, we too were aware of off-targeting effects and thus tested multiple tnc-RNAi lines, including an additional line from Vienna (v42326). However, the Vienna line was very weak, as indicated by Western blots from tissue-specific knockdown animals. Similar to the Tnc-RNAi line selected for this study, M>tnc-v42326 induced a reduction of βPS synaptic levels (albeit much milder than M>tnc-TRIP), while N>tnc-v42326 induced robust increase of βPS levels. This behavior indicated that the phenotypes observed are due to Tnc knockdown and not to off-target effects. We have mentioned the multiple RNAi lines tested and the similar outcomes in the Materials and methods section.

We have specifically selected a weak mysRNAi line for this study, since strong knockdown of mys induces early lethality and/or profound defects in the muscle development and could be problematic when examining the NMJ development.

In addition, we have repeated the knockdown experiments and targeted if/α-PS2. In this case, we tested three available TRIP lines and found that two of them impaired the larval development when expressed in the muscle. We selected the one that allowed for apparently normal muscle development into third instar stages (BL-38958); this line reduced the synaptic αPS2 levels to ~55% of control NMJs, and α-Spectrin to ~65%. The results for if/αPS2 knock down have been reported in Figures 3J-L.

In Figure 3 comparing mEJP Frequency for the tncEP/Df was less strongly affected compared to the N>tncRNAi in Figure 3E versus 3B. It is surprising that the RNAi would have a strong effect that the EP/Df combination especially given that in Figure 1 the protein levels were substantively reduced in the EP/Df but not the N>tncRNAi. This disconnect between levels of protein versus phenotypes need to be addressed in the text.

(Figure 1) is likely due to Tnc expression in other brain cells. In this revised manuscript, we have refrained from discussing unrelated Tnc expression patterns because of the complexity of the phenomena already described here.

Since all our data indicate that the neuronal knock down of Tnc is very efficient and induces strong postsynaptic responses (see below), we alluded to this early on and mentioned additional Tnc-expressing cells in the brains with the following sentence:

“Neuron specific RNAi knockdown reduced the Tnc levels in larval brains to 43% of the control group; this generated very strong phenotypes (below) suggesting that the residual band could reflect additional Tnc-expressing cells in the larval brain.”

With the residual Tnc immunolabeling present in the tncEP/Df, it is logical to conclude that there is significantly more Tnc present in the N>tncRNAi NMJ. However the degree of reduction of Tnc at the NMJ is not shown with either N>tncRNAi or M>tncRNAi. This should be included or if not, explained. This becomes very relevant in Figure 4 as the effect of M>tncRNAi on the recruitment of αPS2βPS to the NMJ had a stronger effect than N>tncRNAi.

This request (together with a similar one from reviewer #2) prompted us to carefully quantify the synaptic Tnc in a number of settings, including the RNAi knockdown experiments. The RNAi results are now reported in a completely new figure (Figure 4—figure supplement 2).

Because of this careful quantification we uncovered a completely new layer of Tnc regulation, a push-pull mechanism, where removal of neuronal Tnc (in an otherwise wild-type background) induces a significant increase of the muscle-derived Tnc. This increased muscle Tnc triggers a downstream cascade that includes (a) increased integrin (Figure 4N), (b) increased Dlg (Figure 5D) and (c) increased α-Spectrin (Figure 6—figure supplement 1). We were also able to show that similar manipulations of βPS have exactly the same effect as Tnc on the synaptic α-Spectrin, that is, neuronal knockdown of βPS triggered almost doubled α-Spectrin levels (Figure 6—figure supplement 1).

The degree of Tnc loss in the tncEP/Df combination in Figure 1G (and Figure 1—figure supplement 1D) was surprisingly not complete given that the allele seems to be a null. The immunolabeling in the image does not match the quantitation by Western seen in Figure 1C. The phrase "much reduced" in tncEP/Df could be quantified using the approaches utilized throughout the manuscript for all the other markers. The text should also address if this is truly the presence of residual Tnc at the NMJ (and the implications of this) or is this background?

We have addressed this issue by including a careful quantification of the NMJ signals (Figure 1—figure supplement 1) as described above. Furthermore, we have provided a completely new figure (Figure 7—figure supplement 1) showing a Western blot of brain and muscle extracts of various genotypes labeled for Tnc. In the brain protein extracts, the Tnc antibodies label a single band of the expected size (300 kDa); in the muscle extracts, we detect two more bands that are independent of various tnc manipulations. This new data indicate that our Tnc antibodies show some non-specific staining in the muscle.

The results from this manuscript suggest that αPS2βPS and Tnc may directly interact. The S2 cell experiment was a strong approach to understanding the associations of Tnc, the integrin complex, spectrin and adducin. A stronger and a necessary approach to investigating the association of these proteins was to prove that these occur in vivo using a proximity ligation assay (PLA) to determine where in the NMJ these associations happen. The advantage of this approach is that the tncEP/Df mutant would serve as a good control as would the different RNAi and overexpression approaches. The PLA experiment would also be able to address if the M>tnc expression was able to recruit the αPS2βPS complex to ectopic sites away from the NMJ. This would go a long way to support many of the conclusions and how a clear link at the NMJ between these protein complexes.

Further to this point, the link between integrins to spectrin and adducin is the key point of interest but other than the S2 cells there is little in the way to support a physical link between these components. It is equally possible that the loss of spectrin or adducin itself may lead to the loss of αPS2βPS from the NMJ. What happens to spectrin or adducin when αPS2 is reduced and vice versa?

We thank the reviewer very much for this suggestion. Indeed, we have successfully exploited the PLA assay to document the close proximity of Tnc and βPS at synaptic terminals. These new data are included in Figure 4G-H’.

As mentioned above, we have performed and included some epistasis experiments in this revised manuscript. For example, neuronal knockdown of Tnc triggered a significant increase in postsynaptic Tnc, β-PS and α-Spectrin (Figure 4, Figure 4—figure supplement 2, Figure 6—figure supplement 1). Similarly, neuronal knockdown of βPS triggered almost doubling of the α-Spectrin synaptic levels (Figure 6—figure supplement 1). Muscle knockdowns of βPS or αPS2 were less informative for weak RNAi lines (Figure 6—figure supplement 1 and not shown), and induced overall defective muscle morphology and compound phenotypes for strong RNAi settings.

For Figure 5 it is mentioned that "In the course of these experiments we noted that tnc mutant NMJs showed aberrant morphology with poorly defined bouton/interbouton boundaries and more tubular branches, particularly in the proximal region." Given that this is the first mention of these different phenotypes, an inclusion of some examples is warranted as prior indications from Figure 2—figure supplement 1 was there were little morphological changes.

For the TEM analysis comments such as "However, the mutant boutons were drastically distorted and no longer maintained normal round/oval shapes" and "This phenotype was highly penetrant and affected all type 1B neurons" should be supported by the number of boutons that were analyzed and the number of synapses/larvae analyzed in the text itself.

As emphasized above, the request to document in details the NMJ morphology turned into a tremendously informative readout for the Tnc function in the muscle. In particular, the bouton size and the SSR density appear to be a direct consequence of the activity of postsynaptic Tnc/integrin complexes. Loss of muscle Tnc invariably led to smaller boutons with reduced SSR structures and Dlg signals; these defects could only be rescued by the cis Tnc/integrin postsynaptic complexes.

As indicated in the response to reviewer #2, we have now included a new set of EM data with extensive quantifications.

The distribution of Dlg should be shown (data not shown throughout the manuscript) and the quantitation provided, especially given the effects on adducin on Dlg at the NMJ. This later point should be addressed in the text as well.

We thank the reviewer for this suggestion. as careful quantifications of the Dlg levels greatly contributed to the readout for the Tnc function in the muscle.

The M>tncRNAi data with α-spectrin showed no decrease compared to the UAS-tncRNAi control. While the N>tncRNAi showed an upregulation. Yet the tncEP/Df displayed a reduction in α-spectrin. The manuscript needs to address these differences and provide a model to help guide through the different interpretations of these effects.

As outlined above, we have extensively revised this manuscript using compartment specific and dose-dependent analyses. Using these refined approaches, we showed that only the cis Tnc/integrin complexes are biologically functional in vivo, whereas the trans Tnc/integrin complexes exhibit dominant-negative activities. This is a significant departure from our previous interpretation that extracellular Tnc can bind to integrin on either side of the synaptic cleft and engage in compartment-specific activities.

In this model, the differences between α-spectrin levels in tnc mutants and N>tncRNAi reflect an inhibitory role for neuronal Tnc onto the muscle Tnc/integrin complexes (and consequently spectrin recruitment).

The reviewers were correct all along and rightly confused by our original interpretation. We are very grateful for their tremendous help in sorting out this complex system.

The manuscript makes the statement "Since neuron-derived Tnc recruits βPS integrin in the motor neurons to modulate neurotransmitter release (Figure 3)" – this is a very strong statement given that N>tncRNAi showed a mild increase of the distribution of βPS to the NMJ (Figure 4L, 4N) and the effect on αPS2 is not shown. Figure 3 provides no evidence that the changes observed with N>tncRNAi are due to the loss of βPS. This would require a rescue experiment to provide a direct link.

This claim is now further supported by several new pieces of data:

1) Figure 3 now includes a similar effect (reduced mini frequency) when if/αPS2 was knocked down in the neurons but not in the muscle. Thus both integrin subunits, αPS2 and βPS, are required in the neuron for normal mini frequency.

2) Genetic manipulations suggested by reviewer #2 allowed us to visualize a presynaptic pool of βPS (Figure 8H).

The reviewer is correct: the ideal experiment would require some rescue. But since only the cis Tnc/integrin complexes appear to be biologically active, overexpression of neuronal βPS and/or αPS2 are not expected to rescue the mini defects of tnc mutants.

The interpretations and conclusions for the role of neuronal or muscle driven Tnc need to be tempered. N>tnc rescued the degree of βPS present at the NMJ in the tncEP/Df mutant while M>tnc did not and this lead to the conclusion that neuronal Tnc is key to the recruitment of βPS. Yet N>tnc alone decreases the βPS at the NMJ (Figure 7C, 7E) compared to controls while N>tncRNAi knock down (Figure 4L, 4N) shows slight more βPS at the NMJ compared to control. This suggests that neuronal derived Tnc blocks integrin accumulation at the NMJ. On the muscle side of the equation M>tnc cannot rescue the tncEP/Df which isn't too surprising given that M>tnc removes all the tnc from the NMJ. Thus these experiment don't prove that neuronal derived Tnc is sufficient and necessary to recruit βPS. Especially given that Tnc knockdown in muscles but not in neurons reduced the amount of synaptic βPS.

The reviewer is absolutely correct and examining these points in more detail made us depart from our original thinking that extracellular Tnc can bind to integrin on either side of the synaptic cleft and engage in compartment-specific activities. Moreover, as the reviewer noted, neuronal derived Tnc limits the integrin accumulation at the NMJ. We have expanded our data set to further characterize this regulation and, as detailed above, found that removal of neuronal Tnc induces a significant increase of the muscle-derived Tnc. The elevated Tnc muscle levels next induce an increase in the synaptic accumulation of (a) integrin (Figure 4N), (b) Dlg (Figure 5D) and (c) α-Spectrin (Figure 6—figure supplement 1).

Along these lines the tnc mutants with muscle overexpressed tnc had a dramatic reduction in βPS as well as the M>tnc in a wild type background. The panels from Figure 1J, Figure 1—figure supplement 1F and Figure 1—figure supplement 2F would suggest that overexpression of tnc may be significantly deleterious to the entire NMJ not just the distribution of βPS.

The reviewer correctly noted the toxic effect of excess muscle Tnc. We have refined these analyses by examining a wide range of Tnc doses in muscles rescue (Figure 7) and overexpression (Figure 8) experiments.

The authors state that expression of N>tnc in the tncEP/Df mutant was able to rescue the reduction in α-spectrin however the degree of increase in α-spectrin does not appear to be strong. For the quantitation (Figure 6J) it was not clear what was being compared – each experimental to control which would suggest that the N>tnc was significantly different from control (and didn't rescue to a great extent) – or each experimental to each other which would suggest that all three experimental were significant different from each other which didn't appear to be the case. For this type of multiple experiment analysis it would also be more relevant to carry out a One Way Anova with a post hoc multi-comparison test rather than a students' t-test.

It was also intriguing that the degree of rescue of Adducin and βPS immunolabeling at the NMJ was so much better than that for α-spectrin with the N>tnc. Given the strength of the statements made in the text is it possible the wrong data was included in Figure 6J?

The major conclusion from this section should be tempered to reflect that neuronal expression of Tnc can rescue the tncEP/Df spectrin, βPS and adducin levels. Whether M>Tnc is able or not will require a more measured approach to ensure that muscle expressed Tnc is present at the NMJ, that the muscles themselves are not deleteriously affected. This might be case given the stronger effects on βPS by the increased expression of Tnc in wild type muscles compared to the tncEP/Df muscles. These effects may simply by an increase the deleterious effects of Tnc expression and thus lead to a great disruption of NMJ morphology rather than an specific effect on "ligand redundancy and/or other mechanisms may allow for partial βPS and/or α-Spectrin synaptic accumulation". Would the increased expression of Tnc or any ECM component lead to disruption of muscles as a result from ER stress?

As the reviewer noted, neuronal Tnc did not really rescue of the α-spectrin levels at tnc mutant NMJs. In the revised manuscript, we further exploit this observation together with the size of type Ib boutons to argue that trans Tnc/integrin complexes could form but are not biologically active.

We have revised extensively the rescue experiments and provided expanded data analyses, including graded expression levels for muscle Tnc. As the reviewer indicated, we have now convincing evidence that excess Tnc levels in the muscle induces deleterious effects; we have revised the text accordingly.

The statement "Unlike βPS, which was completely lost at these NMJs" is not supported by the images presented in Figure 4E, Figure 6B and 6E: βPS is not completely lost at these NMJs. The authors need to be more careful about making this type of absolute statement.

We have revised this incorrect statement.

[Editors' note: the author responses to the re-review follow.]

Reviewer #1:

Wang et al. report an interesting finding on distinct pre-synaptic and post-synaptic roles for tenectin (Tnc), a selective integrin ligand, at the Drosophila neuromuscular junction (NMJ). Tnc in the neuron interacts with βPS/αPS2 integrin to control neurotransmitter release, whereas Tnc in the muscle interacts with post-synaptic αPS2/βPS integrin to regulate bouton morphology. By manipulating Tnc, they uncovered a novel role for integrin in recruiting the spectrin based membrane skeleton at the NMJ.

This paper will be of broad interest to the readership of eLife because it advances our understanding of NMJ development and synaptic physiology, as well as integrin/extracellular matrix biology. Although Tnc has been studied at the Drosophila NMJ, Wang et al. is among the first to reveal that Tnc has differential function in neurons and muscle. The data presented in this paper is thorough, with good controls and overall high-quality figures. However, I have two major concerns that should be addressed before publication. First, the inclusion of only one RNAi line targeting Tnc is insufficient, especially given the fact that the neuronal RNAi line only knocks down Tnc levels to 43% of control. The inclusion of at least two RNAi lines showing the same phenotype would both confirm and strengthen the author's conclusions. This is not a detail and needs to be addressed.

Second, the conclusion that αPS2, βPS, and Tnc function together to modulate neurotransmitter release (Figure 2) should be strengthened by genetic interaction experiments between βPS and Tnc indicating that either a) double mutants do not have a more severe phenotype, or b) trans-heterozygotes show enhancement of phenotype.

We are deeply grateful to this reviewer for the thoughtful consideration of our work and for her/his generous help in improving the overall presentation of our findings, and their biological relevance. Although Tnc has been studied in the context of epithelial tube morphogenesis and development of male genitalia, this is the first study reporting Tnc distribution and function at the Drosophila NMJ.

In the revised manuscript, we have addressed both reviewer’s concerns, as follows:

1) As the reviewer emphasized, because of frequent off targeted effects, one must always test two different RNAi lines. We have previously tested a second RNAi line and observed similar, though relatively milder phenotypes. Here we have expanded these knockdown experiments and included a complete set of electrophysiological recordings in a new supplementary figure (Figure 3—figure supplement 1). Together these data confirmed that we are observing Tnc-specific phenotypes.

2) The reviewer is absolutely correct, we should see a genetic interaction between tnc and αPS2 or βPS. Indeed, we tested the trans-heterozygotes (mys/+;; tnc/+) and observed severe defects that resembled the tnc mutant phenotypes, even though when tested separately both heterozygotes have no detectable defects. We have included these additional experiments in the main Figure 3M-O.

Reviewer #2:

Tenectin recruits integrin to stabilize bouton architecture and regulate vesicle release at the Drosophila NMJ' Wang et al.

In this manuscript the authors identify the mucin class protein tenectin as an ECM component of the Drosophila NMJ synapse from an interaction screen with Neto. The description of tenectin mutants is comprehensive, the technical quality of the data is high and the authors do identify interesting interactions with integrins. However ultimately little new insight is gained into the role of the ECM in synapse development or function beyond the identification of a new component. As such, the manuscript seems better suited to a more specialised neuroscience journal.

We respectfully disagree with reviewer #2: Tnc is a strikingly selective integrin ligand that allowed for unprecedented insights into our understanding of integrin recruitment and function at synaptic locations. Our genetic manipulations produce sharp phenotypes that uncovered novel pre- and post-synaptic functions for integrin. Also, a new signaling pathway that couples ECM/integrin with the spectrin-based membrane skeleton emerges from this work. Integrin and spectrin have pleiotropic roles in both pre- and post-synaptic compartments, and local, synaptic disruption of integrin or spectrin have not been previously possible. Our discovery provides the means to explore their local functions and to define a synaptic role for the spectrin-based membrane skeleton, a topic of intense research in neural development.

Reviewer #3:

The manuscript by Wang et al. reports a novel function of tenectin (tnc) at the neuromuscular junction (NMJ) in Drosophila. The authors have identified Tnc, a mucin-like protein in a genetic screen for regulators of Neto, that the Serpe lab has previously shown to be required at the NMJ. In this elegant study, the authors use a combination of physiology, immunostainings and genetic approaches to probe the pre- and post-synaptic roles of tnc at the NMJ. Their results show that tnc mutants have reduced mini frequency, EJPs and quantal content. Paired pulse facilitation experiments show that tnc mutants have lower release probability. Next, the authors use pre- and post-synaptic specific manipulations (knock-down and rescue) to show that tnc is required in neurons but not muscles for normal neurotransmitter release. They further show that presynaptic RNAi knock-down of α and β integrin genes phenocopy the tnc phenotypes and suggest that tnc may act as an integrin ligand. Next, the authors examine the effects of altering tnc levels pre- and post-synaptically on integrins and synaptic morphology at the NMJ and find that the source and dose of tnc are critical determinants of bouton architecture and synaptic function. S2 cell experiments nicely show the ability of Tnc to cluster integrins as also suggested by the PLA assay.

Overall, this is an interesting study that sheds key novel insights into the role of extracellular matrix ligands and receptors in shaping the NMJ architecture and function. Although in my opinion the spectrin connection does not add much to the story and the precise mechanism remains to be established (it may have to do with post-translational modifications, as suggested) this study is well executed, novel and of broad interest.

My only criticism is the absence of driver controls for phenotypic studies. While the authors use the UAS lines as background, which is fine, it is rather standard and important to control for any potential contributions of the GAL4 drivers to the phenotypes evaluated here.

We thank very much the reviewer for the generous comments and support for our work.

As the reviewer requested, we have revised the manuscript to include the characterization of the drivers. These additional data are included in Figure 3—figure supplement 1.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Transparent reporting form
    DOI: 10.7554/eLife.35518.023

    Data Availability Statement

    All data generated or analysed during this study are included in the manuscript and supporting files.


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES