Skip to main content
Biotechnology Reports logoLink to Biotechnology Reports
. 2018 Jun 5;19:e00262. doi: 10.1016/j.btre.2018.e00262

Molecular cloning and characteristics analysis of Pmtgfbr1 from Pinctada fucata martensii

Ruijuan Hao a, Zhe Zheng a, Xiaodong Du a,b, Qingheng Wang a,b,, Junhui Li a,, Yuewen Deng a,b, Weiyao Chen a
PMCID: PMC6041369  PMID: 30003053

Highlights

  • This study obtains the full length of Pmtgfbr1 of the pearl oyster P. fucata martensii.

  • Pmtgfbr1 possesses the conserved domain of Tgfbr1.

  • Pmtgfbr1 holds negatively effect on the growth of P. fucata martensii.

Keywords: Pmtgfbr1, Growth traits, Correlation analysis, Pinctada fucata martensii

Abstract

Pinctada fucata martensii is cultured for pearl production. Growth improvement has received considerable research interest. Transforming growth factor β type Ⅰ receptor (TβR-I), which is involved in signals transmission of transforming growth factor beta (TGF-β), participates in cell proliferation and growth. In this study, we characterized a Tgfbr1 gene which encoded TβR-I from P. fucata martensii (Pmtgfbr1). Pmtgfbr1 cDNA contains an open reading frame of 1569 bp and encodes a polypeptide of 522 amino acids (aa). Pmtgfbr1 possesses a typical TβR-I structure (extracellular receptor ligand domain, transmembrane domain, and cytoplasmic tyrosine kinase catalytic domain). Pmtgfbr1 is expressed in all the studied tissues and exhibited the highest expression level in the adductor muscle. Moreover, Pmtgfbr1 exhibited the lower expression level in the larger group (L) than that in the smaller group (S) and is negatively correlated with growth traits (P < 0.01). Our results indicated that Pmtgfbr1 is a candidate functional gene associated with growth traits.

1. Introduction

The transforming growth factor β(TGF-β) superfamily comprises bone morphogenetic proteins, activins, TGF-βs, and other related factors [1,2]. It has attracted considerable research attention because of the abilities of its members to regulate cell migration, adhesion, proliferation, differentiation, and death throughout the entire lifespan of an organism [[3], [4], [5]]. TGF-β family members transmit signals through signaling systems that involve types I and II serine/threonine kinase receptors [[6], [7], [8]]. In receptor activation, the TGF-β type I receptor (TβR-I) mainly acts downstream of the TGF-β type Ⅱ receptor (TβR-II) and sometimes determines the specificity of intracellular signals [9,10].

Given the importance of TGF-β signaling for cell bioprocesses [1], it is a potential target of strategies for the control of human cancer progression, suppression of tumors, and regulation of animal growth [[11], [12], [13]]. TβR-I, TβR-II, and Smad protein genes have been widely studied in numerous species [[14], [15], [16]] especially in the oysters [[17], [18], [19], [20], [21]] which represents the existence of TGF-β pathway in bivalves. Polymorphic TGF-β receptors from Crassostrea gigas could serve as markers for genes associated with fast growth and be applied in oyster breeding [22]. In Zhikong scallop, Tgfbr1 negatively regulates growth and may thus be used as a candidate marker for marker-assisted breeding of this species [23].

Pinctada fucata martensii (synonymous to P. fucata and P. martensii) as an important species for pearl culture is widely studied for its biomineralization and immune system for the pearl production purpose [24,25]. The TGF-β signal and receptor genes of the pearl oyster P. fucata martensii have been also analyzed [26,27]. Most studies showed that TGF-β signal pathway is associated with biomineralization in P. fucata martensii. However, studies on the pearl oyster growth remain relatively limited which is also a crucial factor for the pearl culture. Therefore, in this study, we cloned Pmtgfbr1, the TβR-I gene of P. fucata martensii and estimated the relationship between Pmtgfbr1 and growth traits of pearl oysters.

2. Methods and materials

2.1. Animals and sample collection

Pearl oysters P. fucata martensii were obtained from the Breeding Base, Xuwen, Zhanjiang, Guangdong Province, China (20°250 N, 109°570 E). The marginal zone of the mantle (ME), central zone of the mantle (MC), adductor muscle (A), gill (GI), hepatopancreas (HE), and hemocytes (B) were obtained from adult pearl oysters.

2.2. RNA extraction and cDNA synthesis

Total RNA was extracted from various tissues of 8 adult pearl oysters using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and RNA quality was determined with 1.0% agarose gel electrophoresis and NanoDrop ND1000 spectrophotometer (Thermo scientific, Waltham, MA, USA). Reverse transcription with M-MLV reverse transcriptase (Promega, Madison, WI, USA) was performed with total RNA as template.

2.3. Full-length Pmtgfbr1

The partial sequence of the Pmtgfbr1 gene was obtained from the genomic data of P. fucata martensii [24]. RACE reactions were performed with SMART RACE cDNA Amplification Kit (Clontech, USA) and template cDNA from total RNA obtained from mantle tissue. Specific amplification products were obtained through nested polymerase chain reaction (PCR). Primers involved in this study were designed in accordance with the partial sequence of Pmtgfbr1 and are shown in Table 1.

Table 1.

Primes used in the study.

Primes Sequence (5′-3′) application
5′-outer GTCTAAGCATCACGGTCTGGTAAATCTC Outer PCR
5′-inner TTTACTGCTACGCTTTCTGCTCGCC Inner PCR
3′-outer TGTTGACCTCGCTCCATCAGACAGAGT Outer PCR
3′-inner GAGAGGCGATGTCTACTCGTTTGGTTTG Inner PCR
Pmtgfbr1-A TAGGCGAAAAACGCAACGAT qRT-PCR
Pmtgfbr1-S AACTCCGACCTTGGCACCCC qRT-PCR
GAPDH-A CGTTGATTATCTTGGCGAGTG qRT-PCR
GAPDH-S GCAGATGGTGCCGAGTATGT qRT-PCR

2.4. Sequence and phylogenetic analysis

PCR products containing the 5′-UTR and 3′-UTR were sequenced, and the full length of Pmtgfbr1 was obtained with DNAMAN software. The open reading frame (ORF) of Pmtgfbr1 was identified with ORF finder (http://www.ncbi.nlm.nih.gov/gorf/orfig.cgi). Multiple-sequence alignments were generated with protein sequences from other species by using ClustalX (http://www.ebi.ac.uk/Tools/msa/clustalo/). Protein domain was predicted using SMART (http://smart.embl-heidelberg.de/). The intracellular region of Pmtgfbr1 was submitted to Phyre2 online at http://www.sbg.bio.ic.ac.uk/phyre2/protocol for three-dimensional model construction. Chimera 1.8.1 was used to display the model. A phylogenetic tree was constructed by neighbor-joining (NJ) method with MEGA version 6.1 and tested for reliability over 1000 bootstrap replicates.

2.5. Pmtgfbr1 expression pattern in adult tissues

Real-time quantitative PCR (qRT-PCR) analysis was performed with Thermo Scientific DyNAmo Flash SYBR Green qPCR Kit (Thermo Scientific) in Applied Biosystems 7500/7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) to identify the expression pattern of Pmtfgbr1. Table 1 presents the specific primers used in this analysis. Transcripts were relatively quantified through 2−ΔCT method with GAPDH as the internal control [28,29].

2.6. Pmtgfbr1 expression in two sized groups

The samples were obtained from the base stock in our breeding program. 260 pearl oysters (two years old) were randomly collected from the base stock and sized according to shell length measurement [30]. 20 samples with larger shell length (L) and 20 samples with smaller shell length (S) were used for gene expression analysis. Growth traits of two sized groups were shown in Table S1. The adductor muscle was dissected and stored in liquid nitrogen. The expression levels of Pmtgfbr1 in the two groups (L and S) were detected using the above method and were relatively quantified by 2−ΔCT method with GAPDH as the internal control.

2.7. Statistical analysis

One-way analysis of variance (ANOVA) was used to determine the differences in mean Pmtgfbr1 expression levels among different tissues. Pmtgfbr1 expression levels in the L and S groups were compared using t-test. The significance level for the analyses was set at P < 0.05. Correlations among Pmtgfbr1 gene expression levels and growth traits were estimated using the Pearson method. All analyses were performed with SPSS 19.0 software.

3. Results

3.1. Cloning and sequencing analysis of Pmtgfbr1

The full-length sequence of Pmtgfbr1 (2210 bp) contained a 45-bp 5′-UTR and a 596-bp 3′-UTR with a 39-bp poly-(A) tail. The sequence analysis of Pmtgfbr1 showed that it contained an ORF of 1569 bp and encoded 522 amino acids (aa). The deduced aa sequence of Pmtgfbr1 had a typical activating receptor, a signal peptide, a transmembrane domain, a GS motif, and a serine/threonine protein kinase domain (Fig. 1a). The sequence analysis of Pmtgfbr1 showed that the signal peptide was 1–22 aa in length, and the transmembrane domain was 134–156 aa in length (Fig. 1b). The Pmtgfbr1 gene and deduced protein sequences were deposited in the GenBank database under the accession number AIA98699.1.

Fig. 1.

Fig. 1

Full-length cDNA and amino-acid (aa) sequence analysis of Pmtgfbr1 from P. fucata martensii. (a) Full-length cDNA of Pmtgfbr1. Numbers on the left represent nucleotide and amino acid positions. The 5′ and 3′ UTRs are indicated by small letters. The open reading frame and the deduced aa sequences are indicated by capital letters. The initiation codon (ATG) and stop codon (TAA) are represented by nucleotides surrounded by frames. Sequences in purple and green represent the activin_recp domain and S_TKc domain, respectively. Sequences in red and blue indicate the signal peptide and the transmembrane domain, respectively. The GS motif is in orange. (b) aa sequence analysis of Pmtgfbr1. SP: signal peptide, AC: activin_recp, GS: GS motif, S_TKc: serine/threonine protein kinases.

3.2. Homology analysis of Pmtgfbr1

The deduced aa sequence of Pmtgfbr1 was homologous to that of Tgfbr1. The homology analysis of Pmtgfbr1 was performed with Clustal X2 software. Pmtgfbr1 was compared with Tgfbr1 from Crassostrea gigas (EKC41469.1), Mizuhopecten yessoensis (XP_021365929.1), Azumapecten farreri (AFQ23184.1), and Lingula anatine (XP_013382711.1). The results indicated that Pmtgfbr1 had high homology with other Tgfbr1 (Fig. 2). Pmtgfbr1 showed a completely conserved L45 loop. Furthermore, Pmtgfbr1 shared the highest identity (73%) with Tgfbr1 from C. gigas (EKC41469.1) and followed by with those from A. farreri (66%), M. yessoensis (65%), and L. anatine (63%).

Fig. 2.

Fig. 2

Multiple-sequence alignment of Pmtgfbr1 aa sequences. Conserved aa sequences are indicated by a dark blue background. Highly similar aa sequences are indicated by a pink background. Weakly similar aa sequences are indicated by a light blue background. Numbers on the right show the position of the aa sequence alignment. The accession numbers of the sequences used in this alignment are as follows: P. fucata martensii (AIA98699.1), Crassostrea gigas (EKC41469.1), Mizuhopecten yessoensis (XP_021365929.1), Azumapecten farreri (AFQ23184.1), Lingula anatine (XP_013382711.1). S_TKc represents serine/threonine protein kinases. Sequences surrounded by frames represent the GS motif and L45 loop.

3.3. Three-dimensional model analysis of Pmtgfbr1

The three-dimensional model analysis of the Pmtgfbr1 kinase domain showed that its tertiary structure is similar to the kinase domain of Tgfbr1 from Chlamys farreri (Fig. 3), in which the receptor uses the L45 loop to interact with smad proteins [7]. This result indicated that Pmtgfbr1 functions similarly to Tgfbr1 from other animals.

Fig. 3.

Fig. 3

Molecular model of the three-dimensional structure of the kinase domain of Pmtgfbr1 (a) and Chlamys farreri Tgfbr1 (b). The GS motif and L45 loop are colored red and green, respectively. https://doi.org/doi:10.1371/journal.pone.0051005.

3.4. Construction of the Tgfbr1 phylogenetic tree

To investigate the relationship between Pmtgfbr1 and other TβR-I and TβR-II receptors, a phylogenetic tree was constructed with 21 associated sequences from various phyla by using the NJ method and 1000 bootstrap replications. Pmtgfbr1 showed a high degree of conservation with TβR-I from other phyla (Fig. 4).

Fig. 4.

Fig. 4

Phylogenetic tree of Pmtgfbr1 and other TGF-β superfamily receptors. The phylogenetic tree was constructed using MEGA software 6.05 through the neighbor-joining method with 1000 bootstrap replications. Numbers at the forks indicate bootstrap proportions. The scale bar indicates a branch length of 0.1. The protein sequences used for phylogenetic analysis include the following: P. fucata martensii tgfbr1 (AIA98699.1), Azumapecten farreri TGF-beta type 1 receptor (AFQ23184.1), Homo sapiens transforming growth factor receptor beta 1 (CAF02096.2), Rattus norvegicus transforming growth factor beta type I receptor (AAA83216.1), Danio rerio transforming growth factor-beta receptor type Ib (ABR20510.1), H. sapiens bone morphogenetic protein receptor, type IA (EAW80320.1), Danio rerio Bmpr1a protein (AAI63471.1), Homo sapiens BMPR1B (AAH47773.1), Danio rerio Bone morphogenetic protein receptor, type 1b (AAH81625.1), C. gigas activin-like type 1 receptor (CAC85263.1), H. sapiens ACVR1 protein (AAH33867.1), H. sapiens ALK-1 (CAA80255.1), H. sapiens ACVR2B protein (AAH96245.1), D. rerio Acvr2b (AAI64219.1), C. gigas activin type II receptor (CAR92545.1), H. sapiens Bone morphogenetic protein receptor, type II (serine/threonine kinase) (AAH52985.1), C. gigas bone morphogenic protein type 2 receptor (CAD20574.1), C. gigas TGF-beta receptor type-1 (EKC41469.1), Pinctada fucata activin-like receptor 1-like protein (ADD80738.1), Taeniopygia guttata activin receptor type-1 (XP_002186924.2), Canis lupus familiaris activin receptor type-1 (XP_549615.2).

3.5. Expression analysis of Pmtgfbr1

The expression pattern of Pmtgfbr1 at different tissues was detected through qRT-PCR to further confirm the existence of Pmtgfbr1. Pmtgfbr1 expressed in the ME, MC, A, GI, HE, and B of adult pearl oysters (Fig. 5). Pmtgfbr1 expression in adductor muscle was significantly higher than that in other tissues (P < 0.05) . However, it was not significantly different among ME, MC, GI, HE, and B.

Fig. 5.

Fig. 5

Pmtgfbr1 expression levels in different P. fucata martensii tissues. ME, marginal zone of mantle; MC, central zone of mantle; A, adductor muscle; GI, gill; HE, hepatopancreas; and B, hemocytes. The GAPDH gene was used as the reference gene. Different letters indicate significant differences (P < 0.05) determined through one-way ANOVA, and bars represent standard deviation.

3.6. Pmtgfbr1 expression levels in two groups and its relationship to growth traits

The L and S groups used in the differential expression and growth characterization experiments were utilized to validate the relationship of Pmtgfbr1 with growth of P. fucata martensii. qRT-PCR results indicated that Pmtgfbr1 expression levels were significantly lower in the L group than that in the S group (P < 0.05) (Fig. 6). Pearson’s correlation analysis between Pmtgfbr1 expression levels and growth traits showed that Pmtgfbr1 expression is significantly correlated with shell length (R = −0.767, P < 0.01), shell height (R = −0.794, P < 0.01), shell width (R = −0.790, P < 0.01), total weight (R = −0.767, P < 0.01), tissue weight (R = −0.694, P < 0.01), and shell weight (R = −0.783, P < 0.01) (Table 2).

Fig. 6.

Fig. 6

Pmtgfbr1 expression in the L and S groups. The differences in Pmtgfbr1 gene expression levels between the S and L groups were analyzed through t-test. The GAPDH gene was used as the reference gene. “*” Indicates significant differences between the L and S groups (P < 0.05).

Table 2.

Correlation analysis between Pmtgfbr1 expression and growth traits of P. fucata martensii.

Shell length Shell height Shell width Total Weight Tissue weight Shell weightlll
Pmtgfbr1 expression levels R −0.767** −0.794** −0.790** −0.767** −0.694** −0.783**
P 0.000 0.000 0.000 0.000 0.000 0.000

Note: The number in the table indicates the correlation coefficient (R). R > 0 indicates positive correlation, and R < 0 represents negative correlation. Correlations with “*” are statistically significant at P < 0.05. Correlations with “**” are statistically significant at P < 0.01.

4. Discussion

TGF-β signaling regulates numerous cellular bioprocesses [1], and many studies have focused on the genes involved in this signaling pathway to elucidate its potential mechanisms [[31], [32], [33], [34]]. Many associated growth factors control the cell development and homeostasis of metazoans, and mutations in these pathways cause various human diseases [[35], [36], [37]]. Although the molecular breeding of pearl oysters with improved pearl production has received considerable attention, studies on the relationship between the genes and growth traits of pearl oysters remain limited.

By cloning and subjecting Pmtgfbr1 to sequence analysis, we found that the deduced Pmtgfbr1 exhibits the typical features of TβR-I receptor aa sequences. The intracellular region of Pmtgfbr1 is characterized by a serine/threonine kinase domain [38,39], GS motif [40], and L45 loop, which perfectly matches the consensus motif of other Tgfbr1 proteins. The conserved serine/threonine kinase structures are crucial for determining the specificity of TβR-I for smad proteins [41]. The multiple-sequence alignment of the whole aa sequences of Pmtgfbr1 and other homologous Tgfbr1 proteins revealed that the highly conserved serine/threonine protein kinases, identical SGSGSG sequences, and L45 loop are important features for signal transmission in the TGF-β pathway and that TβR-II phosphorylates TβR-I in the Ser of the SGSGSG motif [[42], [43], [44]]. Therefore, Pmtgfbr1 may have similar functions as TβR-I.

Phylogenetic analysis showed that Pmtgfbr1 has a high degree of conservation with TβR-I. Moreover, comparing the three-dimensional structure of the Pmtgfbr1 kinase domain with the kinase domain of Tgfbr1 from C. farreri also showed that Pmtgfbr1 is highly conserved [23], providing additional evidence for the potential function of this gene in Tgfbr1 activation and the interactions between Tgfbr1 and smad [45].

Pmtgfbr1 expressed in all sampled adult tissues. This expression pattern indicated the extensive existence of the TGF-β signaling pathway, which is necessary for diverse bioprocesses [46]. Adductor muscle presented the highest expression level of Pmtgfbr1 among all tissues, indicating that Pmtgfbr1 has potential roles in muscle growth and regulation [13]. The TGF-β signaling pathway, which transmits signals via Tgfbr1, is also expressed in the skeletal muscle of mammals, such as mice and humans, and is involved in myogenesis and muscle growth [[47], [48], [49], [50]]. Tgfbr1 genes are highly expressed in the muscle tissue of other aquatic species, such as fish, scallops, and other oysters [14,51], providing further evidence for its potential role in muscle growth. Developmental transcriptome analysis of P. fucata martensii showed Pmtgfbr1 was up-regulated in the early trochophore and gastrula which indicated that it was associated in the early development of pearl oyster (Fig. S1) [24]. Therefore, Pmtgfbr1 may be a potential gene participated in the growth of early development and muscle growth.

TGF-β could inhibit gene expression specific to skeletal muscle and modulate cell proliferation [[52], [53], [54], [55]]. In this study, we identified correlations between Pmtgfbr1 expression in adductor muscle and P. fucata martensii growth traits. Pmtgfbr1 expression level is significantly lower in the L group than that in the S group. The transcriptome of the TL (Transcriptome of L group) and TS (Transcriptome of S group) groups [24] also presented that Pmtgfbr1 was up-regulated in the TS group which is consistent with the result of expression pattern in the L and S groups (Fig. S2). On the other hand, there existed significantly negative correlation between gene expression and various traits. This finding indicated that Pmtgfbr1 had a negative effect on oysters in the fast-growing group and its associated pathway are involved in pearl oyster growth. Guo et al. showed a similar correlation between striated muscle mass and Tgfbr1 expression [23]. TGF-β may be involved in inhibiting skeletal muscle differentiation and in muscle growth [49].

5. Conclusion

Pmtgfbr1 possesses the conserved domain of Tgfbr1 and is expressed in all sampled tissues. There existed negative correlation between Pmtgfbr1 expression levels and growth traits of P. fucata martensii. These results indicated that Pmtgfbr1 genes negatively affect growth of P. fucata martensii.

Conflicts of interest

The authors declare no conflict of interest.

Financial support

The research was financially supported by Guangdong Marine and Fishery Bureau (B201601-Z10, Z2014009 and Z2015004), Science and Technology Program of Guangdong Province (2017A030303076 and 2017A030307024), Modern Agricultural Industrial System (CARS-049) and Project of Enhancing School With Innovation of Guangdong Ocean University: GDOU2016050249.

Footnotes

Appendix A

Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.btre.2018.e00262.

Contributor Information

Qingheng Wang, Email: wangqingheng_haida@163.com.

Junhui Li, Email: junhui-li@sohu.com.

Appendix A. Supplementary data

The following is Supplementary data to this article:

mmc1.docx (21.8KB, docx)

References

  • 1.Massague J., Blain S.W., Lo R.S. TGFβ signaling in growth control, cancer, and heritable disorders. Cell. 2000;103(2):295–309. doi: 10.1016/s0092-8674(00)00121-5. [DOI] [PubMed] [Google Scholar]
  • 2.Dijke P.T., Hill C.S. New insights into TGF-β-Smad signalling. Trends Biochem. Sci. 2004;29(5):265–273. doi: 10.1016/j.tibs.2004.03.008. [DOI] [PubMed] [Google Scholar]
  • 3.Knight P.G., Glister C. TGF-β superfamily members and ovarian follicle development. Reproduction. 2006;132(2):191–206. doi: 10.1530/rep.1.01074. [DOI] [PubMed] [Google Scholar]
  • 4.Heldin C.H., Miyazono K., Ten D.P. TGF-β signalling from cell membrane to nucleus through SMAD proteins. Nature. 1997;390(6659):465–471. doi: 10.1038/37284. [DOI] [PubMed] [Google Scholar]
  • 5.Massague J., Wotton D. Transcriptional control by the TGF-β/Smad signaling system. EMBO J. 2000;19(8):1745–1754. doi: 10.1093/emboj/19.8.1745. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ten D.P., Miyazono K., Heldin C.H. Signaling via hetero-oligomeric complexes of type I and type II serine/threonine kinase receptors. Curr. Opin. Cell Biol. 1996;8(2):139–145. doi: 10.1016/s0955-0674(96)80058-5. [DOI] [PubMed] [Google Scholar]
  • 7.Shi Y., Massague J. Mechanisms of TGF-β signaling from cell membrane to the nucleus. Cell. 2003;113(6):685–700. doi: 10.1016/s0092-8674(03)00432-x. [DOI] [PubMed] [Google Scholar]
  • 8.Massagué J., Chen Y.G. Controlling TGF-β signaling. Gene Dev. 2000;14(6):627–644. [PubMed] [Google Scholar]
  • 9.Massague J. TGF beta signaling: receptors, transducers, and mad proteins. Cell. 1996;85(7):947–950. doi: 10.1016/s0092-8674(00)81296-9. [DOI] [PubMed] [Google Scholar]
  • 10.Carcamo J., Weis F.M., Ventura F., Wieser R., Wrana J.L., Attisano L. Type I receptors specify growth-inhibitory and transcriptional responses to transforming growth factor beta and activin. Mol. Cell. Biol. 1994;14(6):3810–3821. doi: 10.1128/mcb.14.6.3810-3821.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Kaklamani V.G., Pasche B. Role of TGF-beta in cancer and the potential for therapy and prevention. Expert Rev. Anticancer Ther. 2004;4(4):649–661. doi: 10.1586/14737140.4.4.649. [DOI] [PubMed] [Google Scholar]
  • 12.Derynck R., Akhurst R.J., Balmain A. TGF-beta signaling in tumor suppression and cancer progression. Nat. Genet. 2001;29(2):117–129. doi: 10.1038/ng1001-117. [DOI] [PubMed] [Google Scholar]
  • 13.Kollias H.D., McDermott J.C. Transforming growth factor-β and myostatin signaling in skeletal muscle. J. Appl. Physiol. 2008;104(3):579–587. doi: 10.1152/japplphysiol.01091.2007. [DOI] [PubMed] [Google Scholar]
  • 14.Maehr T., Wang T., Gonzalez V.J., Wadsworth S., Secombes C.J. Cloning and expression analysis of the transforming growth factor-beta receptors type 1 and 2 in the rainbow trout Oncorhynchus mykiss. Dev. Comp. Immunol. 2012;37(1):115–126. doi: 10.1016/j.dci.2011.10.006. [DOI] [PubMed] [Google Scholar]
  • 15.Chen K., Rund L.A., Beever J.E., Schook L.B. Isolation and molecular characterization of the porcine transforming growth factor beta type I receptor (TGFBR1) gene. Gene. 2006;384:62–72. doi: 10.1016/j.gene.2006.07.009. [DOI] [PubMed] [Google Scholar]
  • 16.Roelen B.A., Van Eijk M.J., Van Rooijen M.A., Bevers M.M., Larson J.H., Lewin H.A. Molecular cloning, genetic mapping, and developmental expression of a bovine transforming growth factor beta (TGF-beta) type I receptor. Mol. Reprod. Dev. 1998;49(1):1–9. doi: 10.1002/(SICI)1098-2795(199801)49:1<1::AID-MRD1>3.0.CO;2-U. [DOI] [PubMed] [Google Scholar]
  • 17.Herpin A., Favrel P., Cunningham C. Gene structure and expression of cg-ALR1, a type I activin-like receptor from the bivalve mollusc Crassostrea gigas. Gene. 2002;301(1-2):21–30. doi: 10.1016/s0378-1119(02)01082-x. [DOI] [PubMed] [Google Scholar]
  • 18.Herpin A., Lelong C., Becker T., Rosa F.M., Favrel P., Cunningham C. Structural and functional evidences for a type 1 TGF-beta sensu stricto receptor in the lophotrochozoan Crassostrea gigas suggest conserved molecular mechanisms controlling mesodermal patterning across bilateria. Mech. Dev. 2005;122(5):695–705. doi: 10.1016/j.mod.2004.12.004. [DOI] [PubMed] [Google Scholar]
  • 19.Herpin A., Lelong C., Becker T., Rosa F., Favrel P., Cunningham C. Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway. FEBS J. 2005;272(13):3424–3440. doi: 10.1111/j.1742-4658.2005.04761.x. [DOI] [PubMed] [Google Scholar]
  • 20.Le Quere H., Herpin A., Huvet A., Lelong C., Favrel P. Structural and functional characterizations of an activin type Ⅱ receptor orthologue from the pacific oyster Crassostrea gigas. Gene. 2009;436(1–2):101–107. doi: 10.1016/j.gene.2009.01.010. [DOI] [PubMed] [Google Scholar]
  • 21.Zhang G., Fang X., Guo X., Li L., Luo R., Xu F. The oyster genome reveals stress adaptation and complexity of shell formation. Nature. 2012;490(7418):49–54. doi: 10.1038/nature11413. [DOI] [PubMed] [Google Scholar]
  • 22.Chen Y., Li Q., Yu H., Kong L. Polymorphism of transforming growth factor β receptor I gene and its association with growth traits and glycogen content in pacific oyster Crassostrea gigas. Period. Ocean Univ. China. 2017;47(03):27–33. [Google Scholar]
  • 23.Guo H., Bao Z., Li J., Lian S., Wang S., He Y. Molecular characterization of TGF-beta type I receptor gene (Tgfbr1) in Chlamys farreri, and the association of allelic variants with growth traits. PLoS One. 2012;7(11):e51005. doi: 10.1371/journal.pone.0051005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Du X., Fan G., Jiao Y., Zhang H., Guo X., Huang R. The pearl oyster Pinctada fucata martensii genome and multi-omic analyses provide insights into biomineralization. GigaScience. 2017;6(8):1–12. doi: 10.1093/gigascience/gix059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Zheng Z., Liang J., Huang R., Du X., Wang Q., Deng Y. Identification of a novel miR-146a from Pinctada martensii involved in the regulation of the inflammatory response. Fish Shellfish Immunol. 2016;54:40–45. doi: 10.1016/j.fsi.2016.03.025. [DOI] [PubMed] [Google Scholar]
  • 26.Yan F., Luo S., Jiao Y., Deng Y., Du X., Huang R. Molecular characterization of the BMP7 gene and its potential role in shell formation in Pinctada martensii. Int. J. Mol. Sci. 2014;15(11):21215–21228. doi: 10.3390/ijms151121215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Ottaviani E., Caselgrandi E., Kletsas D. Effect of PDGF and TGF-β on the release of biogenic amines from invertebrate immunocytes and their possible role in the stress response. FEBS Lett. 1997;403(3):236–238. doi: 10.1016/s0014-5793(97)00053-7. [DOI] [PubMed] [Google Scholar]
  • 28.Kuchel R.P., Nair S., Raftos D.A. Changes in the transcriptional expression of oxidative stress response genes in Akoya pearl oysters (Pinctada fucata) exposed to air and mechanical agitation. Aquaculture. 2012;362:33–38. [Google Scholar]
  • 29.Anju A., Jeswin J., Thomas P.C., Vijayan K.K. Molecular cloning, characterization and expression analysis of F-type lectin from pearl oyster Pinctada fucata. Fish Shellfish Immunol. 2013;35(1):170–174. doi: 10.1016/j.fsi.2013.03.359. [DOI] [PubMed] [Google Scholar]
  • 30.Yang C., Hao R., Deng Y., Liao Y., Wang Q., Sun R. Effects of protein sources on growth, immunity and antioxidant capacity of juvenile pearl oyster Pinctada fucata martensii. Fish Shellfish Immunol. 2017;67:411–418. doi: 10.1016/j.fsi.2017.06.037. [DOI] [PubMed] [Google Scholar]
  • 31.Kopecny M., Stratil A., Van Poucke M., Bartenschlager H., Geldermann H., Peelman L.J. PCR-RFLPs, linkage and RH mapping of the porcine TGFB1 and TGFBR1 genes. Anim. Genet. 2004;35(3):253–255. doi: 10.1111/j.1365-2052.2004.01130.x. [DOI] [PubMed] [Google Scholar]
  • 32.Shimanuki S., Mikawa A., Miyake Y., Hamasima N., Mikawa S., Awata T. Structure and polymorphism analysis of transforming growth factor beta receptor 1 (TGFBR1) in pigs. Biochem. Genet. 2005;43(9–10):491–500. doi: 10.1007/s10528-005-8165-0. [DOI] [PubMed] [Google Scholar]
  • 33.Juengel J.L., McNatty K.P. The role of proteins of the transforming growth factor-beta superfamily in the intraovarian regulation of follicular development. Hum. Reprod. Update. 2005;11(2):143–160. doi: 10.1093/humupd/dmh061. [DOI] [PubMed] [Google Scholar]
  • 34.Polley S., De S., Brahma B., Mukherjee A., Vinesh P.V., Batabyal S. Polymorphism of BMPR1B, BMP15 and GDF9 fecundity genes in prolific Garole sheep. Trop. Anim. Health Prod. 2010;42(5):985–993. doi: 10.1007/s11250-009-9518-1. [DOI] [PubMed] [Google Scholar]
  • 35.Saika S. TGF-beta signal transduction in corneal wound healing as a therapeutic target. Cornea. 2004;23(8 Suppl):S25–S30. doi: 10.1097/01.ico.0000136668.41000.73. [DOI] [PubMed] [Google Scholar]
  • 36.Schnaper H.W., Hayashida T., Hubchak S.C., Poncelet A.C. TGF-beta signal transduction and mesangial cell fibrogenesis. Am. J. Physiol. Ren. Physiol. 2003;284(2):F243–F252. doi: 10.1152/ajprenal.00300.2002. [DOI] [PubMed] [Google Scholar]
  • 37.Schnaper H.W., Jandeska S., Runyan C.E., Hubchak S.C., Basu R.K., Curley J.F. TGF-beta signal transduction in chronic kidney disease. Front. Biosci. (Landmark Ed) 2009;14:2448–2465. doi: 10.2741/3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Attisano L., Carcamo J., Ventura F., Weis F.M., Massague J., Wrana J.L. Identification of human activin and TGF beta type I receptors that form heteromeric kinase complexes with type Ⅱ receptors. Cell. 1993;75(4):671–680. doi: 10.1016/0092-8674(93)90488-c. [DOI] [PubMed] [Google Scholar]
  • 39.Ebner R., Chen R.H., Shum L., Lawler S., Zioncheck T.F., Lee A. Cloning of a type I TGF-beta receptor and its effect on TGF-beta binding to the type Ⅱ receptor. Science. 1993;260(5112):1344–1348. doi: 10.1126/science.8388127. [DOI] [PubMed] [Google Scholar]
  • 40.Wrana J.L., Tran H., Attisano L., Arora K., Childs S.R., Massague J. Two distinct transmembrane serine/threonine kinases from Drosophila melanogaster form an activin receptor complex. Mol. Cell. Biol. 1994;14(2):944–950. doi: 10.1128/mcb.14.2.944-950.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Chen Y.G., Hata A., Lo R.S., Wotton D., Shi Y., Pavletich N. Determinants of specificity in TGF-beta signal transduction. Genes Dev. 1998;12(14):2144–2152. doi: 10.1101/gad.12.14.2144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Feng X.H., Derynck R. Ligand-independent activation of transforming growth factor (TGF) beta signaling pathways by heteromeric cytoplasmic domains of TGF-beta receptors. J. Biol. Chem. 1996;271(22):13123–13129. doi: 10.1074/jbc.271.22.13123. [DOI] [PubMed] [Google Scholar]
  • 43.Souchelnytskyi S., Ten D.P., Miyazono K., Heldin C.H. Phosphorylation of Ser165 in TGF-beta type I receptor modulates TGF-beta1-induced cellular responses. EMBO J. 1996;15(22):6231–6240. [PMC free article] [PubMed] [Google Scholar]
  • 44.Luo K., Lodish H.F. Positive and negative regulation of type Ⅱ TGF-beta receptor signal transduction by autophosphorylation on multiple serine residues. EMBO J. 1997;16(8):1970–1981. doi: 10.1093/emboj/16.8.1970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Huse M., Chen Y.G., Massague J., Kuriyan J. Crystal structure of the cytoplasmic domain of the type I TGF beta receptor in complex with FKBP12. Cell. 1999;96(3):425–436. doi: 10.1016/s0092-8674(00)80555-3. [DOI] [PubMed] [Google Scholar]
  • 46.Padua D., Massagué J. Roles of TGFβ in metastasis. Cell Res. 2009;19(1):89–102. doi: 10.1038/cr.2008.316. [DOI] [PubMed] [Google Scholar]
  • 47.Lafyatis R., Lechleider R., Roberts A.B., Sporn M.B. Secretion and transcriptional regulation of transforming growth factor-beta 3 during myogenesis. Mol. Cell. Biol. 1991;11(7):3795–3803. doi: 10.1128/mcb.11.7.3795-3803.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Koishi K., Dalzell K.G., McLennan I.S. The expression and structure of TGF-beta2 transcripts in rat muscles. Biochim. Biophys. Acta. 2000;1492(2–3):311–319. doi: 10.1016/s0304-419x(00)00012-3. [DOI] [PubMed] [Google Scholar]
  • 49.Liu D., Black B.L., Derynck R. TGF-beta inhibits muscle differentiation through functional repression of myogenic transcription factors by Smad3. Genes Dev. 2001;15(22):2950–2966. doi: 10.1101/gad.925901. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Schabort E.J., van der Merwe M., Loos B., Moore F.P., Niesler C.U. TGF-beta’s delay skeletal muscle progenitor cell differentiation in an isoform-independent manner. Exp. Cell Res. 2009;315(3):373–384. doi: 10.1016/j.yexcr.2008.10.037. [DOI] [PubMed] [Google Scholar]
  • 51.Hu X., Guo H., He Y., Wang S., Zhang L., Wang S. Molecular characterization of Myostatin gene from Zhikong scallop Chlamys farreri (Jones et Preston 1904) Genes Genet. Syst. 2010;85(3):207–218. doi: 10.1266/ggs.85.207. [DOI] [PubMed] [Google Scholar]
  • 52.Allen R.E., Boxhorn L.K. Regulation of skeletal muscle satellite cell proliferation and differentiation by transforming growth factor-beta, insulin-like growth factor I, and fibroblast growth factor. J. Cell. Physiol. 1989;138(2):311–315. doi: 10.1002/jcp.1041380213. [DOI] [PubMed] [Google Scholar]
  • 53.Cook D.R., Doumit M.E., Merkel R.A. Transforming growth factor-beta, basic fibroblast growth factor, and platelet-derived growth factor-BB interact to affect proliferation of clonally derived porcine satellite cells. J. Cell. Physiol. 1993;157(2):307–312. doi: 10.1002/jcp.1041570213. [DOI] [PubMed] [Google Scholar]
  • 54.Florini J.R., Roberts A.B., Ewton D.Z., Falen S.L., Flanders K.C., Sporn M.B. Transforming growth factor-beta. A very potent inhibitor of myoblast differentiation, identical to the differentiation inhibitor secreted by buffalo rat liver cells. J. Biol. Chem. 1986;261(35):16509–16513. [PubMed] [Google Scholar]
  • 55.Massague J., Cheifetz S., Endo T., Nadal-Ginard B. Type beta transforming growth factor is an inhibitor of myogenic differentiation. Proc. Natl. Acad. Sci. U. S. A. 1986;83(21):8206–8210. doi: 10.1073/pnas.83.21.8206. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

mmc1.docx (21.8KB, docx)

Articles from Biotechnology Reports are provided here courtesy of Elsevier

RESOURCES