Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Sep 15.
Published in final edited form as: Mol Cell Endocrinol. 2018 Jan 31;473:124–135. doi: 10.1016/j.mce.2018.01.011

The Liver X Receptors and Sterol Regulatory Element Binding Proteins alter Progesterone Secretion and are regulated by Human Chorionic Gonadotropin in Human Luteinized Granulosa Cells

Yafei Xu 1, José J Hernández-Ledezma 2,3, Scot M Hutchison 2,4, Randy L Bogan 1
PMCID: PMC6045446  NIHMSID: NIHMS938505  PMID: 29366778

Abstract

There is increased expression of liver x receptor (LXR) target genes and reduced low density lipoprotein receptor (LDLR) during spontaneous luteolysis in primates. The LXRs are nuclear receptors that increase cholesterol efflux by inducing transcription of their target genes. Transcription of LDLR is regulated by sterol regulatory element binding proteins (SREBPs). Human chorionic gonadotropin (hCG) prevents luteolysis and stimulates progesterone synthesis via protein kinase A (PKA). Thus, our primary objectives are: 1) Determine the effects of LXR activation and SREBP inhibition on progesterone secretion and cholesterol metabolism, and 2) Determine whether hCG signaling via PKA regulates transcription of LXR and SREBP target genes in human luteinized granulosa cells. Basal and hCG-stimulated progesterone secretion was significantly decreased by the combined actions of the LXR agonist T0901317 and the SREBP inhibitor fatostatin, which was associated with reduced intracellular cholesterol storage. Expression of LXR target genes in the presence of T0901317 was significantly reduced by hCG, while hCG promoted transcriptional changes that favor LDL uptake. These effects of hCG were reversed by a specific PKA inhibitor. A third objective was to resolve a dilemma concerning LXR regulation of steroidogenic acute regulatory protein (STAR) expression in primate and non-primate steroidogenic cells. T0901317 induced STAR expression and progesterone synthesis in ovine, but not human cells, revealing a key difference between species in LXR regulation of luteal function. Collectively, these data support the hypothesis that LXR-induced cholesterol efflux and reduced LDL uptake via SREBP inhibition mediates luteolysis in primates, which is prevented by hCG.

Keywords: progesterone, liver x receptor, sterol regulatory element binding protein, human chorionic gonadotropin, protein kinase A, steroidogenic acute regulatory protein

1. Introduction

The mechanisms causing luteolysis of the primate corpus luteum (CL) have not been determined (Stouffer, Bishop, Bogan et al., 2013). It has previously been reported that there is increased expression of liver x receptor (LXR) target genes and decreased low density lipoprotein receptor (LDLR) during spontaneous luteolysis in the primate CL (Bogan and Hennebold, 2010). There are two LXR isoforms, α (NR1H3) and β (NR1H2), which are cholesterol sensors belonging to the steroid hormone receptor superfamily (Repa and Mangelsdorf, 2000). When intracellular cholesterol concentrations rise, they induce transcription of their target genes including ATP binding cassette subfamily A1 (ABCA1) and G1 (ABCG1) (Lund, Menke and Sparrow, 2003), as well as NR1H3 itself (Laffitte, Joseph, Walczak et al., 2001), which results in an enhancement of cholesterol efflux. Furthermore, the LXRs inhibit uptake of LDL cholesterol by inducing transcription of myosin regulatory light chain interacting protein (MYLIP), which causes proteolytic degradation of LDLR (Zelcer, Hong, Boyadjian et al., 2009). Therefore, the role of the LXRs is to reduce intracellular cholesterol concentrations.

Sterol regulatory element binding proteins (SREBPs) are important mediators of lipid metabolism (Goldstein, DeBose-Boyd and Brown, 2006). There are two genes that encode three SREBPs: sterol regulatory element binding transcription factor 1 (SREBF1) that encodes SREBP1a and SREBP1c via alternative promoters, and SREBF2 that encodes SREBP2 (Horton, Goldstein and Brown, 2002). The SREBPs are synthesized as inactive precursors that are embedded in the endoplasmic reticulum (ER) membrane when sterol concentrations are high. When sterol concentrations fall, SREBPs are transported to the Golgi apparatus where they are proteolytically cleaved to release the active transcription factor (Goldstein et al., 2006). The SREBP1c isoform preferentially targets genes involved in fatty acid synthesis but does not increase intracellular cholesterol (Horton et al., 2002), and interestingly SREBP1c (SREBF1) is also a known LXR target gene (Repa, Liang, Ou et al., 2000, Yoshikawa, Shimano, Amemiya-Kudo et al., 2001). Conversely, SREBP1a and SREBP2 activate transcription of the rate-limiting enzyme in cholesterol biosynthesis 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR), as well as LDLR, which raises intracellular cholesterol concentrations (Horton et al., 2002). Thus, the LXRs and SREBP1a and SREBP2 have opposing actions that are necessary to maintain intracellular cholesterol homeostasis. This is further illustrated by the fact that many endogenous LXR agonists also inhibit processing of the SREBPs to their active forms (Goldstein et al., 2006, Hong and Tontonoz, 2014).

The CL is a highly steroidogenic gland that has a large demand for cholesterol (Stouffer and Hennebold, 2015). Thus, we hypothesize that limiting the intracellular cholesterol supply via increased LXR and reduced SREBP activity could reduce progesterone (P4) synthesis and cause luteolysis of the primate CL. Furthermore, it has been well established that luteolysis is prevented during early pregnancy by human chorionic gonadotropin (hCG), which binds to the luteinizing hormone/choriogonadotropin receptor (LHCGR) and maintains P4 secretion via protein kinase (PKA) (Ascoli, Fanelli and Segaloff, 2002). Therefore, we also hypothesize that hCG signaling via PKA inhibits LXR and stimulates SREBP target gene transcription. Correspondingly, the two primary objectives of this study are: 1) Determine the effects of LXR activation and SREBP inhibition on P4 secretion and cholesterol metabolism; and 2) Determine whether hCG signaling via PKA regulates transcription of LXR and SREBP target genes. Human luteinized granulosa cells were used for these studies as they are functionally similar to luteal cells (Stewart and Vandevoort, 1997), and express both LXR isoforms (Drouineaud, Sagot, Garrido et al., 2007).

The third objective was to resolve a dilemma concerning LXR regulation of steroidogenic acute regulatory protein (STAR) expression in primate and non-primate steroidogenic cells (Mouzat, Baron, Marceau et al., 2013). The LXRs increase STAR expression and steroidogenesis in rodents (Manna, Cohen-Tannoudji, Counis et al., 2013, Mouzat, Volat, Baron et al., 2009), but have not been reported to induce STAR in steroidogenic primate cells (Drouineaud et al., 2007, Puttabyatappa, Vandevoort and Chaffin, 2010). Given the critical role of STAR in steroidogenesis (Manna, Stetson, Slominski et al., 2016), the role of the LXRs in regulating STAR expression warrants further clarification.

2. Materials and Methods

2.1 Isolation of Human Granulosa Cells

The follicular aspirates used in this study were from 55 female patients undergoing oocyte donation or in vitro fertilization for male factor or idiopathic infertility at the Reproductive Health Center, Tucson, AZ. The patients were 24 to 44 years old at the time of retrieval. The University of Arizona Institutional Review Board approved the study and patients gave informed written consent. Follicular aspirates were centrifuged at 500 × g for 5 min at 4° C. The supernatant was aspirated and cell pellets were suspended in nutrient mixture F10 Ham (Ham’s F10) with 0.1% (w:v) bovine serum albumin, covered onto a 40% (v:v) Percoll gradient (GE Healthcare) in Hanks’ balanced salt solution (Sigma-Aldrich Inc.), and centrifuged at 500 × g for 15 min at 4° C. The supernatant was recovered and diluted with Ham’s F10 and centrifuged as before. The cell pellet was washed once more with Ham’s F10. Finally, the cell pellet was suspended in Dulbecco’s Modified Eagle’s Medium/Nutrient Mixture F-12 Ham (DMEM/F12) with insulin-transferrin-selenium (ITS) supplement (Sigma-Aldrich) and 0.02 IU/ml hCG. Cells were counted by trypan blue (0.2% v:v) dye-exclusion method. Plates were coated with 5 μg/ml fibronectin at 37° C for 1 hour and washed with sterile PBS. The isolated granulosa cells were plated in 24-well plates or 96-well plates at a density of 5 × 104 cells/cm2. Granulosa cells were cultured for 5 days in luteinization medium (DMEM/F12 with ITS supplement, 100 units/ml penicillin, 0.1 mg/ml streptomycin (Pen/Strep), and 0.02 IU/ml hCG), incubated at 37° C and 5% CO2 in a humidified environment, and media was changed daily.

2.2 Cell Treatments

A 2 × 2 × 2 factorial design was used to test the effects of the LXR agonist T0901317 (T09, Cayman Chemical Co.), the SREBP inhibitor fatostatin (Cayman Chemical), and hCG (Fig. 1). Cells were first treated with vehicle (0.1% v:v DMSO), T09 (0.1 μM), and/or fatostatin (5 μM) in treatment medium (DMEM/F12 containing ITS, Pen/Strep, 20 μg/ml LDL and 10 μg/ml HDL cholesterol). Both LDL and HDL were included in treatment medium because they are necessary for cholesterol uptake and efflux, respectively. After 16 hours (pretreatment period), fresh treatments with or without 2 IU/ml hCG were added for the final 4 hours (challenge period).

Figure 1. Primary experimental timeline.

Figure 1

Open in a new tab

The timeline begins with plating of luteinizing granulosa cells and ends with cell harvest. The relative timescale is shown above the line, with additives to the base medium (DMEM/F12 with ITS and Pen/Strep) indicated beneath the line.

To determine whether PKA mediates hCG effects, another 2 × 2 × 2 factorial design consisting of T09, protein kinase inhibitor 14–22 (PKI, Life Technologies, Inc.), and hCG was employed (Fig. 1). Cells were first treated with vehicle or T09 in treatment medium for 16 hours. Fresh treatments were added in the presence and absence of 2 IU/ml hCG and PKI (50 μM) for the final 4 hours. One additional experiment for Western blot analysis was performed. Treatment groups for this experiment included: 1) vehicle, 2) T09, 3) T09 + hCG, and 4) T09 + hCG + PKI. Treatments were applied to cells as illustrated in Figure 1, with the exception that the final treatment in the presence and absence of hCG and PKI was extended from 4 hours to 8 hours to allow more time for protein turnover in response to hCG and PKI.

To determine the chronic effects of hCG, after 4 days of luteinization cells were switched to treatment medium containing 0.02 IU/ml hCG for one day. The next day cells were incubated in the presence or absence of 0.2 IU/ml hCG in treatment medium, with media changed daily. Cells were harvested every 24 hours for 3 consecutive days.

2.3 Ovine Mixed Luteal Cell Isolation and Treatment

Procedures involving sheep were approved by the University of Arizona Institutional Animal Care and Use Committee. The estrous cycle of ewes was synchronized by inserting controlled internal drug release (CIDR) devices for 7 days with a lutalyse (Zoetis Inc.) injection (15 mg/60 kg body weight IM) on day 6. To induce superovulation, at the time of CIDR removal ewes received 1000 IU pregnant mare serum gonadotropin IM. At 38-hours post-CIDR removal ewes received 750 IU hCG IV to induce final follicular maturation and ovulation. Ovulation was confirmed by analysis of serum P4 concentrations. At 11 days post-CIDR removal (mid-luteal phase), CL were collected from ewes, dispersed with collagenase (Type 2 at 0.2% w:v, Worthington Biochemical) and DNAse I (0.02% w:v, Worthington Biochemical), and cultured in DMEM/F12 + ITS. The next day they were treated for 24 hours with T09 (0.1 μM) and/or the adenylate cyclase activator forskolin (10 μM).

2.4 Progesterone Analysis

Culture media from the final 4 hour challenge period were harvested, and P4 was extracted and concentrations determined by enzymatic immunoassay as previously described (Seto and Bogan, 2015). The intra and inter-assay coefficients of variation are less than 9% and 11%, respectively. Cells were lysed in RIPA buffer containing a protease and phosphatase inhibitor cocktail (Thermo Scientific Pierce), and protein concentrations were determined by a bicinchoninic acid (BCA) protein assay (Thermo Scientific Pierce) following manufacturer recommendations. Progesterone concentration was normalized to total protein content in the cells.

2.5 Cholesterol Efflux Assay

Cells were labeled with Bodipy Cholesterol (Avanti Polar Lipids Inc., 2 μg/ml) during the 16-hour initial treatment period. Cells that were not labeled were used to control for background fluorescence. After labeling, media were aspirated and cells were washed once with PBS. Cells were then incubated an additional 4 hours in treatment medium as described earlier, except that aminoglutethimide (0.5 mM, Thermo Scientific) was included with all treatment groups to inhibit steroidogenic conversion of the tracer. Media were collected and cells were lysed using 100 μl/well of M-PER reagent (Thermo Scientific). The fluorescence of cells and media was measured, and cholesterol efflux was calculated by the equation: 100 × (media fluorescence)/(cell lysate fluorescence + media fluorescence).

2.6 LDL Uptake Assay

Cells were incubated with Dil-LDL (Thermo Scientific, 10 μg/ml) instead of unlabeled LDL during the final 4-hour treatment, and cells that did not receive Dil-LDL were used to control for background fluorescence. Next, cells were washed once with PBS and lysed in RIPA buffer containing protease & phosphatase inhibitors. Fluorescence was determined in the cell lysate, and a BCA protein assay was subsequently performed on the lysates. Fluorescence values were normalized to total protein concentration.

2.7 Total Intracellular Cholesterol Analysis

Cells were washed with PBS and scraped into cold PBS containing a protease and phosphatase inhibitor cocktail. The cells were sonicated in an ice water bath using a Branson 250 digital sonicator programmed to cycle at a 10% amplitude with 5 sec on followed by 20 sec off, and a 15 sec total sonication time. Total cholesterol was extracted from cell lysates using the Bligh/Dyer procedure (Bligh and Dyer, 1959), and resuspended in cholesterol assay buffer (0.1 M potassium phosphate, pH 7.0, 50 mM sodium chloride, 5 mM cholic acid and 0.1% Triton X-100). Cholesterol concentrations were determined via a fluorometric enzyme assay using cholesterol esterase (60 units/ml), cholesterol oxidase (200 units/ml), horse radish peroxidase (200 units/ml), and Amplex UltraRed (200 units/ml). A BCA protein assay was performed on the lysates, and cholesterol concentrations were normalized to total protein content.

2.8 Semi-Quantitative Real-Time PCR (QPCR)

Total RNA was extracted with Trizol reagent and purified over RNeasy columns (Life Technologies) according to manufacturer recommendations. The quantity and purity of RNA was determined by spectrophotometry. The High Capacity cDNA Reverse Transcription Kit (Life Technologies) was used to reverse transcribe RNA into cDNA. The corresponding forward and reverse primers and Taqman probe sequences are listed in Table 1. Reactions for QPCR were performed in a StepOne Plus Real-Time PCR system (Life Technologies) using Taqman MGB probe or SYBR green detection. Relative mRNA abundance was determined by extrapolation of Ct values from a standard curve of serial cDNA dilutions, and normalized to glucose-6-phosphate dehydrogenase (G6PD) which has previously been determined to be invariant in luteinized human granulosa cells (Nio-Kobayashi, Trendell, Giakoumelou et al., 2015).

Table 1.

Primer and Taqman MGB probe sequences used in QPCR analyses.

Human Sequences
Gene Forward primer (5′-3′) Reverse primer (5′-3′) MGB Probe (5′-3′) or SYBR
ABCA1 TCCAGGCCAGTACGGAATTC TCCTCGCCAAACCAGTAGGA CTGGTATTTTCCTTGCACCAA
ABCG1 GACCAGCTTTACGTCCTGAGTCA GTTCAGACCCAAATCCCTCAAAT AAAGTCTGCAATCTTGTGCC
MYLIP GCCACCCAGTCAGGAAAGAAT GCCCTGGTGCTGATCATTTT CAGCATCGTGCTCTT
LDLR CTGGTCAGATGAACCCATCAAAG GCCGATCTTAAGGTCATTGCA CCAACGAATGCTTGGAC
NR1H2 ATCGTGGACTTCGCTAAGCAA GATCTCGATAGTGGATGCCTTCA TGCCTGGTTTCCTGC
NR1H3 TCCCCATGACCGACTGATG CAGACGCAGTGCAAACACTTG TCCCACGGATGCTAAT
HMGCR AACACGATGCATAGCCATCCT AAGGCCAGCAATACCCAAAA SYBR Green
SCARB1 TTCCTCGAGTACCGCACCTT GCACCCAAGACCAGGATGTT SYBR Green
STAR GTGGGTGCCTTCCAGAAATATAGT TGACTGGTGCCTATGAAAGCAA SYBR Green
SREBF1 GGAGCCATGGATTGCACTTT AGCATAGGGTGGGTCAAATAGG SYBR Green
SREBF2 ATCGCTCCTCCATCAATGACA TCCTCAGAACGCCAGACTTGT SYBR Green
G6PD GAAGCCGGGCATGTTCTTC TAGGCGTCAGGGAGCTTCAC SYBR Green
Ovine Sequences
Gene Forward primer (5′-3′) Reverse primer (5′-3′) MGB Probe (5′-3′) or SYBR
STAR GAAGTCCCTCAAGGACCAAACTC GCGAGAGGACCTGATTGATGA SYBR Green
MRPS10 TTGAGCTCTCGAGAAATCACTGAA CTGGGTGCAAACCTAACAAAAGA ATTGGTTCCTTCATCCTGT
Open in a new tab

2.9 Western Blot

Cells were lysed in RIPA buffer and protein concentrations determined by BCA assay. Equal amounts of protein (7.5 μg) were resolved on 10% Bis-Tris gels (Life Technologies) and subsequently transferred to nitrocellulose. Membranes were blocked in TBS with 0.1% (v:v) Tween 20 (TBST) containing 5% (w:v) non-fat dry milk (NFDM). Primary antibodies including mouse monoclonal ABCA1 (catalog ab18180) and rabbit polyclonal MYLIP (catalog ab134994) were obtained from Abcam Inc., and mouse monoclonal tubulin beta class I (TUBB, catalog T8328) was from Sigma. Antibodies were diluted in TBST plus 1% NFDM, with both ABCA1 and MYLIP antibodies used at 1 μg/ml and TUBB at 0.5 μg/ml final concentrations. Following an overnight incubation at 4°C, membranes were washed 4 times with TBST. Secondary antibodies conjugated to IRDye® 680RD or IRDye® 800CW (LI-COR, Inc.) were diluted 1:4000 and incubated with membranes for 1 hour at room temperature. Membranes were washed 4 times with TBST and scanned with a Li-COR Odyssey CLx. Image Studio software version 3.1 was used for quantification, and data were normalized to TUBB.

2.10 Statistical Analysis

Each individual experiment was performed in duplicate or triplicate, and repeated with 3–6 biological replicates from different preparations of cells (from individual or pooled patients). Statistical analysis was performed with mixed effects regression analysis (Stata Version 14) using treatment as the fixed effect and cell replicate as the random effect followed by a Bonferroni multiple testing procedure for pairwise comparisons. The random effect in the mixed effects regression analysis accounts for repeated measures. Data were log-transformed if necessary to normalize variance, and comparisons were considered significant at p < 0.05.

3. Results

3.1 Effect of LXR agonist and/or SREBP inhibitor on P4 secretion and cholesterol metabolism

Combined treatment with T09 and fatostatin in the absence of hCG significantly (p < 0.05) decreased P4 secretion in an additive manner compared with the DMSO vehicle control (Fig. 2A). In the presence of hCG, P4 secretion was significantly reduced by fatostatin alone and combined T09 and fatostatin treatment. In the presence or absence of hCG, cholesterol efflux was significantly enhanced by T09 (Fig. 2B). The uptake of LDL was significantly lower for T09 compared to fatostatin individual treatments in the presence or absence of hCG, with combined treatment not being different from DMSO (Fig. 2C). Total intracellular cholesterol concentrations were significantly decreased with T09 and fatostatin combined treatment relative to DMSO in the presence of hCG. In general, hCG decreased total cholesterol concentrations with a significant decrease occurring in the T09 and T09 with fatostatin treatment groups (Fig. 2D).

Figure 2. Effects of T09 and/or fatostatin in the presence and absence of hCG on P4 secretion and cholesterol metabolism in human luteinized granulosa cells.

Figure 2

Open in a new tab

Panel A is P4 concentrations in spent media, panel B is cholesterol efflux, panel C is LDL uptake, and panel D is total intracellular cholesterol concentrations. Each chart is expressed as the fold change relative to the Basal DMSO control group. Error bars indicate one standard error of the mean (SEM). Columns without a common letter are significantly different (p < 0.05).

3.2 Effect of hCG, LXR agonist and/or SREBP inhibitor on expression of LXR and SREBP target genes

The LXR target genes ABCA1, ABCG1, SREBF1, and MYLIP were all significantly (p < 0.05) increased by T09 (Fig. 3A). Combined T09 and fatostatin treatment resulted in significantly higher ABCA1, ABCG1, and SREBF1 compared to T09 alone. The expression of NR1H2 did not change significantly between groups with the exception that fatostatin treatment had significantly higher NR1H2 than T09 in the absence of hCG (Fig. 3B). There was a significant increase in NR1H3 induced by T09 and fatostatin combined treatment compared to the vehicle control in the absence of hCG. Human chorionic gonadotropin significantly inhibited T09-induced ABCA1, ABCG1, SREBF1, and MYLIP expression in the presence and absence of fatostatin co-treatment. Treatment with hCG significantly (p < 0.05) increased expression of LDLR at least 6-fold in all groups, while fatostatin itself did not significantly alter LDLR (Fig. 4A). The expression of HMGCR was significantly increased by hCG in the presence of fatostatin and T09 with fatostatin combined treatment (Fig. 4A). There were no significant changes in SREBF2 (Fig. 4B). The scavenger receptor class B member 1 (SCARB1), which is responsible for cholesterol uptake from HDL (Stouffer and Hennebold, 2015), did not significantly change in expression (Fig. 4C).

Figure 3. Effects of T09 and/or fatostatin in the presence and absence of hCG on the expression of the LXRs and their target genes in human luteinized granulosa cells.

Figure 3

Open in a new tab

Panel A shows QPCR data for the four LXR target genes: ABCA1, ABCG1, SREBF1, and MYLIP. Panel B is QPCR data for the two LXR isoforms NR1H2 and NR1H3. The ABCA1 and ABCG1 charts plot raw ratios relative to the G6PD housekeeping control, and all remaining charts express as the fold change relative to the Basal DMSO control group. Error bars indicate one SEM, and columns without a common letter are significantly different (p < 0.05).

Figure 4. Effects of T09 and/or fatostatin in the presence and absence of hCG on the expression of SREBP target genes, SREBF2, and SCARB1 in human luteinized granulosa cells.

Figure 4

Open in a new tab

Panel A shows QPCR data for the SREBP target genes LDLR and HMGCR, Panel B is SREBF2, and Panel C is SCARB1 that is responsible for cholesterol uptake from HDL. Each chart is expressed as the fold change relative to the Basal DMSO control group. Error bars indicate one SEM, and columns without a common letter are significantly different (p < 0.05).

3.3 Effects of PKA inhibitor on hCG-mediated changes in LXR target genes and LDLR

The LXR target genes ABCA1, SREBF1, and MYLIP were all significantly (p < 0.05) reduced by hCG in the presence of the LXR agonist T09. During PKI co-treatment, hCG no longer altered T09-stimulated LXR target gene expression (Fig. 5A–C) The expression of LDLR was significantly increased by hCG, which was prevented by PKI co-treatment (Fig. 5D). Relative protein concentrations of ABCA1 and MYLIP were also determined (Fig. 5E–F). Both ABCA1 and MYLIP were significantly increased by T09, while hCG significantly reduced T09-induced expression. Co-treatment with PKI reversed the effect of hCG on ABCA1 protein (Fig. 5E), and significantly increased MYLIP protein concentrations above all other treatments (Fig. 5F).

Figure 5. Effects of hCG signaling via PKA on expression of LXR and SREBP target genes in human luteinized granulosa cells.

Figure 5

Open in a new tab

Panels A–C are the LXR target genes ABCA1, SREBF1, and MYLIP, respectively; while Panel D is the SREBP target gene LDLR. Each chart in Panels A–D are expressed as the fold change relative to the Basal DMSO control group. Panels E and F contain Western blot data for ABCA1 and MYLIP, respectively. Representative images are shown with band identities indicated to the right of the images, and the approximate molecular weight (MW) shown on the left. Beneath the images is the treatments corresponding with each lane. The charts display results from densitometry analysis of individual replicates (n = 4), with data normalized to TUBB and treatments indicated beneath each column. For all panels, error bars indicate one SEM, and columns without a common letter are significantly different (p < 0.05).

3.4 Effects of chronic hCG exposure on expression of LXR target genes and LDLR

In the presence of hCG, both LXR isoforms progressively declined in expression over the 3 days of hCG supplementation with NR1H2 being significantly (p < 0.05) lower on days 2 and 3 compared to day 1, while NR1H3 was significantly lower on day 3 compared to day 1 (Fig. 6A). In the absence of hCG, there was relatively stable expression of both LXR isoforms. The expression of ABCA1 displayed a similar pattern as the LXRs with day 3 of hCG supplementation being significantly lower than day 1. Furthermore, ABCA1 significantly increased from day 2 to day 3 of hCG withdrawal. There were no significant changes in ABCG1 over time or as a result of hCG supplementation (Fig. 6B). The expression of MYLIP was significantly suppressed at least 65% by hCG during each of the 3 days of treatment. The expression of LDLR was increased to similar levels throughout the 3 days of hCG treatment with days 1 and 2 having significantly higher LDLR concentrations than the same days in cells not receiving hCG (Fig. 6C).

Figure 6. Effects of long term hCG exposure or withdrawal on the LXRs and their target genes, as well as LDLR in human luteinized granulosa cells.

Figure 6

Open in a new tab

Panel A shows the two LXR isoforms NR1H2 and NR1H3. Panel B shows the LXR target genes ABCA1 and ABCG1. Panel C shows genes regulating LDL uptake including the LXR target gene MYLIP (negative regulator of LDL uptake), and the SREBP target gene LDLR. Each chart is expressed as the fold change relative to the 1 Day of hCG withdrawal group. Error bars indicate one SEM, and columns without a common letter are significantly different (p < 0.05).

3.5 LXR regulation of STAR transcription in sheep and humans

The expression of STAR was significantly (p < 0.05) increased by T09 in the presence and absence of pharmacologic activation of PKA via forskolin in ovine mixed luteal cells (Fig. 7A). These changes in STAR expression were associated with a significant increase in basal P4 secretion, and a tendency for an enhancement of forskolin-induced P4 synthesis in ovine luteal cells. In contrast, T09 did not increase STAR transcription in human luteinized granulosa cells while hCG significantly increased STAR expression (Fig. 7B).

Figure 7. Differences between ovine and human cells in LXR agonist regulation of STAR expression.

Figure 7

Open in a new tab

Panel A shows expression of STAR and P4 secretion in response to the LXR agonist T09 and the adenylyl cyclase activator forskolin (FSK) in ovine mixed luteal cells. Panel B is QPCR data for STAR expression in human luteinized granulosa cells, normalized to the Basal DMSO control group. Error bars indicate one SEM, and columns without a common letter of the same case are significantly different (p < 0.05).

4. Discussion

While it has been previously reported that spontaneous luteolysis in primates is associated with increased LXR and reduced SREBP target gene expression (Bogan and Hennebold, 2010), direct evidence of whether this could actually inhibit P4 production was limited. A previous study reported that chronic treatment of human luteinized granulosa cells with 1 and 10 μM T09 for 7 days significantly inhibited P4 secretion (Drouineaud et al., 2007). In macaque granulosa cells undergoing in vitro luteinization, high doses (5 and 10 μM) of the LXR agonist T09 significantly inhibited hCG-induced P4 secretion after 1 and 2 days of treatment while a 1 μM dose had no effect (Puttabyatappa et al., 2010). In this study, we used the LXR agonist T09 and the SREBP inhibitor fatostatin alone and in combination. We luteinized cells for 5 days prior to initiating treatments in order to mimic mid-luteal cells (Stewart and Vandevoort, 1997), and performed a short term treatment (16 hr pretreatment and 4 hr challenge) with a low dose of T09 (0.1 μM). The experimental timeline shown in Figure 1 is designed to test the effects of the LXR agonist and SREBP inhibitor on functional outcomes such as P4 secretion (Objective 1). An acute hCG treatment (4 hr) was selected to limit the possibility of hCG masking the effects of T09 and fatostatin on P4 secretion, yet still allow determination of its effects on LXR and SREBP target gene transcription (Objective 2). The combined treatment of T09 and fatostatin significantly decreased both basal and hCG-stimulated P4 secretion (Fig. 2A) indicating that increased LXR and decreased SREBP activity could decrease P4 synthesis in the primate CL (Fig. 8B), which is the key event in luteolysis (Stouffer and Hennebold, 2015).

Figure 8. Proposed model for luteolysis in primates.

Figure 8

Open in a new tab

Panel A illustrates a functional luteal cell. Binding of hCG (or LH) to the LHCGR results in activation of PKA, which suppresses LXR target gene expression and stimulates SREBP-mediated (SREBP1a and SREBP2) expression of the LDLR. Expression of MYLIP is also directly suppressed by PKA. This allows a maintenance of cholesterol stored in lipid droplets. Additionally, PKA stimulates P4 synthesis by increasing free cholesterol release from lipid droplets and its transport into mitochondria via induction of STAR. Panel B illustrates a regressing luteal cell. During the late luteal phase of non-conception cycles, LHCGR concentrations are maintained but LH pulses are less frequent resulting in longer intervals without LH stimulation. In the absence of active PKA, oxysterols are formed from cholesterol and are dual LXR agonists and SREBP inhibitors. This results in a repression of LDL uptake via loss of SREBP-mediated LDLR transcription, as well as increased MYLIP expression due to LXR activation and absence of PKA signaling, which results in decreased LDLR. The LXRs also induce cholesterol efflux via increased ABCA1. This results in a depletion of cholesterol stores, and consequently P4 synthesis is suppressed in response to subsequent LH pulses and luteolysis ensues.

As expected, T09 significantly increased cholesterol efflux (Fig. 2B). Interestingly, T09 itself did not significantly decrease total cellular cholesterol concentrations (Fig. 2D). In luteinized granulosa cells, total cholesterol concentrations may be affected by: cholesterol uptake, cholesterol efflux, de novo cholesterol synthesis, and steroidogenesis. As opposed to some natural LXR agonists, the synthetic LXR agonist T09 does not inhibit SREBP processing (Hong and Tontonoz, 2014). Thus, reductions in intracellular cholesterol concentrations caused by T09 may be partially offset by enhanced cholesterol synthesis and uptake due to an increase in SREBP transcriptional activity. In support of this, it has previously been reported that T09 increased de novo cholesterol synthesis approximately 10-fold in human HepG2 cells (Aravindhan, Webb, Jaye et al., 2006). Furthermore, hCG itself tended to decrease total cholesterol concentrations, which was most dramatic in the presence of T09 (Fig. 2D). This is consistent with a previous report in rat theca-interstitial cells that acute (4 hr) hCG treatment significantly reduced total cholesterol concentrations, which was prevented by co-treatment with the steroidogenesis inhibitor aminoglutethimide (Palaniappan and Menon, 2009). Thus, hCG-induced steroidogenesis catabolizes a large proportion of total cellular cholesterol. Surprisingly, fatostatin did not inhibit LDL uptake (Fig. 2C). However, it contributed to reductions in total cholesterol concentrations (Fig. 2D). Collectively, these data are consistent with the anti-steroidogenic effect of T09 and fatostatin being mediated by a reduction in cholesterol availability for steroidogenesis (Fig. 8B), which was most evident by the reduction in total cholesterol concentrations when steroidogenesis was maximally stimulated by hCG (Fig. 2D).

The second objective of this study was to determine if hCG signaling via PKA inhibits LXR and stimulates SREBP target gene transcription. Reports of post-translational regulation of LXR-mediated transcription are limited. In the liver PKA directly phosphorylates NR1H3, which significantly suppressed LXR induction of SREBF1 but not ABCA1 expression (Yamamoto, Shimano, Inoue et al., 2007). In the current study, co-treatment with hCG significantly inhibited the T09-induced expression of ABCA1, ABCG1, SREBF1, and MYLIP without altering either NR1H2 or NR1H3 concentrations (Fig. 3). Furthermore, hCG did not inhibit T09-induced LXR target gene expression in the presence of the specific PKA inhibitor, PKI (Fig. 5A, B & C). At the protein level, hCG significantly suppressed T09-induced ABCA1 and MYLIP, while PKI reversed the effect of hCG on ABCA1 and significantly stimulated MYLIP above all other treatments (Fig. 5E & F). This indicates that hCG (and likely LH as well) signaling via PKA directly interferes with LXR-mediated transcriptional activation of their target genes in an LXR agonist replete environment (Fig. 8A).

Long-term treatment with hCG in the absence of an exogenous LXR agonist also significantly reduced ABCA1 expression. This decrease paralleled significant reductions in both LXR isoforms (Fig. 6). In the macaque preovulatory follicle, an ovulatory dose of hCG suppresses expression of both LXR isoforms, which parallels reductions in LXR target genes (Puttabyatappa et al., 2010). Collectively, this indicates that in addition to direct interference with LXR-mediated transcriptional activation, hCG also reduces LXR abundance, which may be important to allow luteinization as well as preventing luteolysis. However, hCG does not exclusively result in an inhibition of LXR function. It has been demonstrated in immortalized mouse leydig cells that activation of the PKA pathway enhances hormone sensitive lipase activity and consequently hydrolysis of cholesterol esters, which results in an increase in oxysterol production and an enhancement of LXR target gene expression (Manna et al., 2013). Therefore, hCG may indirectly stimulate LXR activity via increased intracellular cholesterol availability leading to elevated oxysterol production. However, it simultaneously limits LXR activity, which may be a mechanism to escape the normal control of cholesterol homeostasis and ensure an adequate supply of cholesterol to support steroidogenesis (Fig. 8A).

The primate CL depends primarily on LDL-derived cholesterol to support steroidogenesis (Stouffer and Hennebold, 2015). In the current study LDLR was strongly induced by hCG, which was prevented by PKI co-treatment. The effect of hCG and cAMP to enhance LDLR expression has been known for some time (Golos, August and Strauss, 1986, Golos and Strauss, 1987, Golos, Strauss and Miller, 1987). Furthermore, hCG-mediated induction of LDLR supersedes negative feedback due to oxysterols that are SREBP inhibitors (Golos et al., 1986, Golos and Strauss, 1987, Golos et al., 1987). Both SREBP1a and SREBP2 induce LDLR and promote intracellular cholesterol accumulation (Horton et al., 2002). It has been shown that in rat ovaries hCG reduces expression of insulin-induced gene 1 (INSIG1) that anchors SREBPs in the ER to prevent their activation, and increases proteolytic cleavage of SREBP1a and SREBP2 to their active forms (Palaniappan and Menon, 2009, Menon, Sinden, Franzo-Romain et al., 2013). Therefore, hCG induces LDLR expression, at least in part, by increasing transcriptionally active SREBP1a and SREBP2 (Fig. 8A). In addition to driving LDLR expression, hCG may also promote LDL uptake by preventing expression of MYLIP, which is responsible for proteolytic degradation of the LDLR (Zelcer et al., 2009). As mentioned already, MYLIP is an LXR target gene and T09-stimulated MYLIP expression was inhibited by hCG similar to other known LXR target genes. However, the negative regulation of MYLIP expression by hCG exceeded the amount attributable to the LXRs. In the current study hCG inhibited basal MYLIP mRNA expression by 65–75% over 3 days of treatment (Fig. 6C), which was a far greater effect than observed for other LXR target genes and more than the change in total NR1H2 and NR1H3 expression. Also, PKI significantly increased MYLIP protein expression to concentrations that exceeded the effect of T09 itself (Fig. 5F). Collectively, this indicates that hCG suppresses MYLIP by a non LXR-mediated mechanism involving PKA (Fig. 8A). Therefore, it appears that hCG signaling via PKA promotes a transcriptional profile supportive of LDL uptake by strongly inducing LDLR and inhibiting MYLIP expression. This may be necessary for long-term maintenance of cholesterol supply to compensate for the significant utilization of cholesterol for steroidogenesis (Fig. 8A).

Surprisingly, the expression of SREBP target genes HMGCR and LDLR was not significantly decreased by the SREBP inhibitor fatosatin even though analysis of total cholesterol concentrations indicate that fatostatin inhibited P4 by decreasing cholesterol availability. Fatostatin was originally determined to inhibit SREBPs by binding to their escort protein SCAP (SREBP cleavage-activating protein) and blocking their translocation from the ER to the Golgi, which is necessary for their activation (Kamisuki, Mao, Abu-Elheiga et al., 2009). This results in decreased expression of SREBP target genes, and reduces the levels of intracellular fatty acids and cholesterol (Kamisuki et al., 2009). Because fatostatin inhibits activation of all SREBP isoforms, it is possible that other SREBP1a, SREBP1c, or SREBP2 target genes mediated the effects of fatostatin. For example, fatostatin inhibition of SREBP1c reduces fatty acid synthesis (Kamisuki et al., 2009), and because fatty acids are necessary for cholesterol esterification, this may have reduced cholesterol ester storage. It is also possible that compensatory mechanisms may have obscured an effect of fatostatin on gene expression. For example, the reduced intracellular cholesterol concentrations caused by fatostatin may have activated homeostatic mechanisms that restored HMGCR and LDLR expression via a non-SREBP mechanism. Therefore, it appears that the anti-steroidogenic effect of fatostatin is mediated via reduced cholesterol availability, but the extent to which this is due to inhibition of specific SREBP isoforms or possibly other off-target effects is unclear.

The third objective of this study was to resolve a dilemma regarding LXR regulation of STAR transcription in primate and non-primate steroidogenic cells. The PKA-induced transport of cholesterol across the mitochondrial membrane is the rate-limiting step in steroidogenesis and is controlled by STAR (Manna et al., 2016). Interestingly, Star is an LXR target gene in mice (Cummins, Volle, Zhang et al., 2006). The LXR agonist T09 induces Star expression and enhances P4 production from immortalized mouse leydig cells (Manna et al., 2013), as well as ovarian steroidogenesis in vivo in mice (Mouzat et al., 2009). In this study, we found a similar effect in ovine mixed luteal cells (Fig. 7A). There was a significant increase in basal and forskolin-induced STAR expression caused by T09. Basal P4 secretion was also significantly increased by T09 in ovine luteal cells. These data from mice and sheep are contrary to the possibility that increased LXR activation contributes to decreased P4 synthesis during luteolysis in primates. However, we found that STAR was not induced by T09 (Fig. 7B), and T09 contributed to significant reductions in P4 synthesis (Fig. 2A) in human luteinized granulosa cells. This is consistent with another study in human luteinized granulosa cells that found T09 treatment for 3 days did not affect STAR expression (Drouineaud et al., 2007). Furthermore, in luteinizing macaque granulosa cells T09 dose-dependently inhibited STAR expression in the presence of hCG (Puttabyatappa et al., 2010). This indicates that there is a key difference between non-primates and primates in LXR regulation of luteal function as the LXRs do not stimulate STAR expression or P4 secretion in primates.

Collectively, these data support the hypothesis that decreased P4 secretion during luteolysis in primates is caused by enhanced LXR and reduced SREBP activity (Fig. 8B). During early pregnancy hCG signaling via PKA can prevent these effects, as well as LH during the luteal phase. Binding of LH and hCG to the LHCGR results in activation of PKA, which regulates both the LXRs and SREBPs. This may interfere with the normal homeostatic control of intracellular cholesterol levels such that the cholesterol supply is maintained and steroidogenesis is supported (Fig. 8A). While daily mean LH levels are relatively equal, there is a marked change in the frequency of LH pulses as the luteal phase nears luteolysis such that the CL undergoes increasing intervals between LH pulses (Ellinwood, Norman and Spies, 1984). During the intervals between LH pulses cholesterol supplies may become diminished (Fig. 8B), which is consistent with the characteristic reduction in LH sensitivity that occurs during luteolysis (Brannian and Stouffer, 1991, Cameron and Stouffer, 1982, Eyster, Ottobre and Stouffer, 1985). The molecular mechanisms mediating the effect of hCG still need to be elucidated. Some possible mechanisms include direct phosphorylation of the LXRs, SREBPs, or proteins that modulate their functions; alterations in the availability or binding of endogenous LXR agonists and SREBP inhibitors; or changes in mRNA stability. The effect of LXR activation and SREBP inhibition on luteal function, and the mechanisms that normally lead to the apparent increase in LXR and decrease in SREBP activity during luteolysis, also need to be determined in vivo.

Highlights.

  • Combined LXR agonism and SREBP inhibition reduces progesterone secretion.

  • HCG inhibits LXR agonist-induced target gene expression via PKA.

  • HCG causes transcriptional changes that favor LDL uptake via PKA.

  • The LXRs induce STAR and progesterone synthesis in ovine, but not human cells.

Acknowledgments

Grant Support: This study was supported by the Eunice Kennedy Shriver National Institute of Child Health & Human Development (NICHD), National Institutes of Health (NIH), award number R00 HD067678 to R.L.B.

The authors would like to thank the patients and staff at the Reproductive Health Center in Tucson.

Footnotes

Disclosure Summary: The authors have nothing to disclose.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Aravindhan K, Webb CL, Jaye M, Ghosh A, Willette RN, DiNardo NJ, Jucker BM. Assessing the effects of LXR agonists on cellular cholesterol handling: a stable isotope tracer study. J Lipid Res. 2006;47:1250–60. doi: 10.1194/jlr.M500512-JLR200. [DOI] [PubMed] [Google Scholar]
  2. Ascoli M, Fanelli F, Segaloff DL. The lutropin/choriogonadotropin receptor, a 2002 perspective. Endocr Rev. 2002;23:141–74. doi: 10.1210/edrv.23.2.0462. [DOI] [PubMed] [Google Scholar]
  3. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem Physiol. 1959;37:911–7. doi: 10.1139/o59-099. [DOI] [PubMed] [Google Scholar]
  4. Bogan RL, Hennebold JD. The reverse cholesterol transport system as a potential mediator of luteolysis in the primate corpus luteum. Reproduction. 2010;139:163–176. doi: 10.1530/REP-09-0005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Brannian JD, Stouffer RL. Progesterone production by monkey luteal cell subpopulations at different stages of the menstrual cycle: changes in agonist responsiveness. Biol Reprod. 1991;44:141–9. doi: 10.1095/biolreprod44.1.141. [DOI] [PubMed] [Google Scholar]
  6. Cameron JL, Stouffer RL. Gonadotropin receptors of the primate corpus luteum. II. Changes in available luteinizing hormone- and chorionic gonadotropin-binding sites in macaque luteal membranes during the nonfertile menstrual cycle. Endocrinology. 1982;110:2068–73. doi: 10.1210/endo-110-6-2068. [DOI] [PubMed] [Google Scholar]
  7. Cummins CL, Volle DH, Zhang Y, McDonald JG, Sion B, Lefrancois-Martinez AM, Caira F, Veyssiere G, Mangelsdorf DJ, Lobaccaro JM. Liver X receptors regulate adrenal cholesterol balance. J Clin Invest. 2006;116:1902–12. doi: 10.1172/JCI28400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Drouineaud V, Sagot P, Garrido C, Logette E, Deckert V, Gambert P, Jimenez C, Staels B, Lagrost L, Masson D. Inhibition of progesterone production in human luteinized granulosa cells treated with LXR agonists. Mol Hum Reprod. 2007;13:373–9. doi: 10.1093/molehr/gam019. [DOI] [PubMed] [Google Scholar]
  9. Ellinwood WE, Norman RL, Spies HG. Changing frequency of pulsatile luteinizing hormone and progesterone secretion during the luteal phase of the menstrual cycle of rhesus monkeys. Biol Reprod. 1984;31:714–22. doi: 10.1095/biolreprod31.4.714. [DOI] [PubMed] [Google Scholar]
  10. Eyster KM, Ottobre JS, Stouffer RL. Adenylate cyclase in the corpus luteum of the rhesus monkey. III. Changes in basal and gonadotropin-sensitive activities during the luteal phase of the menstrual cycle. Endocrinology. 1985;117:1571–7. doi: 10.1210/endo-117-4-1571. [DOI] [PubMed] [Google Scholar]
  11. Goldstein JL, DeBose-Boyd RA, Brown MS. Protein sensors for membrane sterols. Cell. 2006;124:35–46. doi: 10.1016/j.cell.2005.12.022. [DOI] [PubMed] [Google Scholar]
  12. Golos TG, August AM, Strauss JF., 3rd Expression of low density lipoprotein receptor in cultured human granulosa cells: regulation by human chorionic gonadotropin, cyclic AMP, and sterol. J Lipid Res. 1986;27:1089–96. [PubMed] [Google Scholar]
  13. Golos TG, Strauss JF., 3rd Regulation of low density lipoprotein receptor gene expression in cultured human granulosa cells: roles of human chorionic gonadotropin, 8-bromo-3′,5′-cyclic adenosine monophosphate, and protein synthesis. Mol Endocrinol. 1987;1:321–6. doi: 10.1210/mend-1-4-321. [DOI] [PubMed] [Google Scholar]
  14. Golos TG, Strauss JF, 3rd, Miller WL. Regulation of low density lipoprotein receptor and cytochrome P-450scc mRNA levels in human granulosa cells. J Steroid Biochem. 1987;27:767–73. doi: 10.1016/0022-4731(87)90148-8. [DOI] [PubMed] [Google Scholar]
  15. Hong C, Tontonoz P. Liver X receptors in lipid metabolism: opportunities for drug discovery. Nat Rev Drug Discov. 2014;13:433–44. doi: 10.1038/nrd4280. [DOI] [PubMed] [Google Scholar]
  16. Horton JD, Goldstein JL, Brown MS. SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J Clin Invest. 2002;109:1125–31. doi: 10.1172/JCI15593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kamisuki S, Mao Q, Abu-Elheiga L, Gu Z, Kugimiya A, Kwon Y, Shinohara T, Kawazoe Y, Sato S, Asakura K, Choo HY, Sakai J, Wakil SJ, Uesugi M. A small molecule that blocks fat synthesis by inhibiting the activation of SREBP. Chem Biol. 2009;16:882–92. doi: 10.1016/j.chembiol.2009.07.007. [DOI] [PubMed] [Google Scholar]
  18. Laffitte BA, Joseph SB, Walczak R, Pei L, Wilpitz DC, Collins JL, Tontonoz P. Autoregulation of the human liver X receptor alpha promoter. Mol Cell Biol. 2001;21:7558–68. doi: 10.1128/MCB.21.22.7558-7568.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lund EG, Menke JG, Sparrow CP. Liver X receptor agonists as potential therapeutic agents for dyslipidemia and atherosclerosis. Arterioscler Thromb Vasc Biol. 2003;23:1169–77. doi: 10.1161/01.ATV.0000056743.42348.59. [DOI] [PubMed] [Google Scholar]
  20. Manna PR, Cohen-Tannoudji J, Counis R, Garner CW, Huhtaniemi I, Kraemer FB, Stocco DM. Mechanisms of action of hormone-sensitive lipase in mouse Leydig cells: its role in the regulation of the steroidogenic acute regulatory protein. J Biol Chem. 2013;288:8505–18. doi: 10.1074/jbc.M112.417873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Manna PR, Stetson CL, Slominski AT, Pruitt K. Role of the steroidogenic acute regulatory protein in health and disease. Endocrine. 2016;51:7–21. doi: 10.1007/s12020-015-0715-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Menon B, Sinden J, Franzo-Romain M, Botta RB, Menon KM. Regulation of LH receptor mRNA binding protein by miR-122 in rat ovaries. Endocrinology. 2013;154:4826–34. doi: 10.1210/en.2013-1619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Mouzat K, Baron S, Marceau G, Caira F, Sapin V, Volle DH, Lumbroso S, Lobaccaro JM. Emerging roles for LXRs and LRH-1 in female reproduction. Mol Cell Endocrinol. 2013;368:47–58. doi: 10.1016/j.mce.2012.06.009. [DOI] [PubMed] [Google Scholar]
  24. Mouzat K, Volat F, Baron S, Alves G, Pommier AJ, Volle DH, Marceau G, DeHaze A, Dechelotte P, Duggavathi R, Caira F, Lobaccaro JM. Absence of nuclear receptors for oxysterols liver X receptor induces ovarian hyperstimulation syndrome in mice. Endocrinology. 2009;150:3369–75. doi: 10.1210/en.2008-1519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Nio-Kobayashi J, Trendell J, Giakoumelou S, Boswell L, Nicol L, Kudo M, Sakuragi N, Iwanaga T, Duncan WC. Bone morphogenetic proteins are mediators of luteolysis in the human corpus luteum. Endocrinology. 2015;156:1494–503. doi: 10.1210/en.2014-1704. [DOI] [PubMed] [Google Scholar]
  26. Palaniappan M, Menon KM. Regulation of sterol regulatory element-binding transcription factor 1a by human chorionic gonadotropin and insulin in cultured rat theca-interstitial cells. Biol Reprod. 2009;81:284–92. doi: 10.1095/biolreprod.108.074351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Puttabyatappa M, Vandevoort CA, Chaffin CL. hCG-induced down-regulation of PPARgamma and liver X receptors promotes periovulatory progesterone synthesis by macaque granulosa cells. Endocrinology. 2010;151:5865–72. doi: 10.1210/en.2010-0698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Repa JJ, Liang G, Ou J, Bashmakov Y, Lobaccaro JM, Shimomura I, Shan B, Brown MS, Goldstein JL, Mangelsdorf DJ. Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and LXRbeta. Genes Dev. 2000;14:2819–30. doi: 10.1101/gad.844900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Repa JJ, Mangelsdorf DJ. The role of orphan nuclear receptors in the regulation of cholesterol homeostasis. Annu Rev Cell Dev Biol. 2000;16:459–81. doi: 10.1146/annurev.cellbio.16.1.459. [DOI] [PubMed] [Google Scholar]
  30. Seto NL, Bogan RL. Decreased Cholesterol Uptake and Increased Liver X Receptor-Mediated Cholesterol Efflux Pathways During Prostaglandin F2 Alpha-Induced and Spontaneous Luteolysis in Sheep. Biol Reprod. 2015;92:128. doi: 10.1095/biolreprod.114.124941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Stewart DR, Vandevoort CA. Simulation of human luteal endocrine function with granulosa lutein cell culture. J Clin Endocrinol Metab. 1997;82:3078–83. doi: 10.1210/jcem.82.9.4240. [DOI] [PubMed] [Google Scholar]
  32. Stouffer RL, Bishop CV, Bogan RL, Xu F, Hennebold JD. Endocrine and local control of the primate corpus luteum. Reprod Biol. 2013;13:259–71. doi: 10.1016/j.repbio.2013.08.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Stouffer RL, Hennebold JD. Structure, Function, and Regulation of the Corpus Luteum. In: Plant TM, Zeleznik AJ, editors. Knobil and Neill’s Physiology of Reproduction. Academic Press; 2015. pp. 1023–1076. [Google Scholar]
  34. Yamamoto T, Shimano H, Inoue N, Nakagawa Y, Matsuzaka T, Takahashi A, Yahagi N, Sone H, Suzuki H, Toyoshima H, Yamada N. Protein kinase A suppresses sterol regulatory element-binding protein-1C expression via phosphorylation of liver X receptor in the liver. J Biol Chem. 2007;282:11687–95. doi: 10.1074/jbc.M611911200. [DOI] [PubMed] [Google Scholar]
  35. Yoshikawa T, Shimano H, Amemiya-Kudo M, Yahagi N, Hasty AH, Matsuzaka T, Okazaki H, Tamura Y, Iizuka Y, Ohashi K, Osuga J, Harada K, Gotoda T, Kimura S, Ishibashi S, Yamada N. Identification of liver X receptor-retinoid X receptor as an activator of the sterol regulatory element-binding protein 1c gene promoter. Mol Cell Biol. 2001;21:2991–3000. doi: 10.1128/MCB.21.9.2991-3000.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Zelcer N, Hong C, Boyadjian R, Tontonoz P. LXR regulates cholesterol uptake through Idol-dependent ubiquitination of the LDL receptor. Science. 2009;325:100–4. doi: 10.1126/science.1168974. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES