Summary
The aim of this study was to investigate the association between the single‐nucleotide polymorphisms (SNPs) of the interleukin 22 (IL‐22) gene and systemic lupus erythematosus (SLE) in a Chinese population. Three IL‐22 SNPs (rs2227485, rs2227513 and rs2227491) were genotyped using SNaPshot SNP genotyping assays and identified by sequencing in 314 SLE patients and 411 healthy controls. The IL‐22 level of serum was assessed by enzyme‐linked immunosorbent assay (ELISA) kits. Data were analysed by spss version 17.0 software. We found that rs2227513 was associated with an increased risk of SLE [AG versus AA: adjusted odds ratio (aOR) = 2·24, 95% confidence interval (CI) = 1·22–4·12, P = 0·010; G versus· A: adjusted OR = 2·18, 95% CI = 1·20‐3·97, P = 0·011]. Further analysis in patients with SLE showed that the AG genotype and G allele were associated with an increased risk of renal disorder in SLE (G versus A: aOR = 3·09, 95% CI = 1·30–7·33, P = 0·011; AG versus· AA: aOR = 3·25, 95% CI = 1·35–7·85, P = 0·009). In addition, the concentration of IL‐22 was significantly lower in the rs2227513 AG genotype compared with AA genotype (P = 0·028). These results suggest that rs2227513 polymorphism might contribute to SLE susceptibility, probably by decreasing the expression of IL‐22.
Keywords: Chinese, expression, IL‐22, single nucleotide polymorphism, systemic lupus erythematosus
Introduction
Systemic lupus erythematosus (SLE) is a severe, chronic, systemic and inflammatory disease that potentially affects multiple organs and tissues. SLE is characterized by complement activation, autoantibody production, immune complex deposition and systemic inflammation 1, 2. Approximately 17–48/100 000 people worldwide suffer from SLE, and lupus could damage their immune system by the direct action of antibodies that influence physical and mental health, as well as quality of life and life expectancy in patients 3, 4. Previous studies have shown that immunological abnormalities may contribute to the development of SLE, including cytokine disorders and T and B cell activation 5, 6. However, until now, the particular aetiology and pathogenesis of SLE have not been elucidated clearly. Thus, it is important to explore the possible aetiology of the disease and search new diagnostic and therapeutic targets. A few non‐genetic factors have been confirmed to contribute to the development of SLE, such as environment, infection, hormonal action and viruses. Environmental factors could trigger abnormal autoimmune responses in individuals who carry a predisposing genetic background. Therefore, genes have been demonstrated to influence individuals' susceptibility to SLE, such as interleukin (IL‐6), IL‐10, IL‐18, programmed cell death 1 (PDCD1), Toll‐like receptor (TLR)‐9 and TLR‐5 7, 8, 9, 10, 11, 12.
IL‐22 is a member of the IL‐10 cytokine family, which was found to be produced primarily by T helper type 22 (Th22) cells. Recently, Zhong et al. 13 demonstrated that levels of CCR6+ Th22 cells correlate with skin and renal impairment in SLE. The results indicate a new diagnosis and treatment target for SLE. There is evidence that IL‐22 modulates the inflammatory process and several autoimmune diseases, including SLE, rheumatoid arthritis (RA) and multiple sclerosis (MS) 14, 15, 16. In primary Sjögren's syndrome (pSS), both protein and mRNA levels of IL‐22 were increased significantly in the inflamed salivary glands. The results provide information that IL‐22 may be a proinflammatory factor in pSS 17. Moreover, in muscle tissue from patients with polymyositis (PM) and dermatomyositis (DM), high levels of IL‐22 at the protein, but not the mRNA, level has been observed in PM/DM tissues and were correlated with myositis activity 18. IL‐22 binding to the IL‐22 receptor (IL‐22R) complex that induces a series of downstream signalling pathways 19. A later study indicated further that IL‐22 signalling passes through Janus kinase 1 (JAK1) and tyrosine kinase 2 (TYK2) to enlarge downstream phosphorylation signals, including mitogen‐activated protein kinase (MAPK) signalling pathways, signal transducer and activator of transcription (STAT)‐1, STAT‐3 and STAT‐5 20. These signalling pathways are related to the development of SLE 21, 22. In addition, in SLE patients, the expression of serum IL‐22 levels was decreased and the reason for this phenomenon is not clear 23, 24.
IL‐22, located on chromosome 12q15 in the human genome, encodes the IL‐22 cytokine. Association studies have been performed to examine the relationship of single nucleotide polymorphisms (SNPs) in IL‐22 with the risk of a number of many diseases, including chronic plaque psoriasis 25. However, no report has been carried out to investigate the association of SNPs (i.e. rs2227485, rs2227513 and rs2227491) in IL‐22 and SLE risk, and the relationship between IL‐22 gene SNPs and the serum level of IL‐22 in SLE patients. Therefore, we evaluated the association of the three SNPs (rs2227485, rs2227513 and rs2227491) in IL‐22 with susceptibility to SLE and investigated further the influence of IL‐22 polymorphisms on serum levels and clinical features.
Methods
Subjects of study
Our case–control study collected 314 independent Chinese SLE patients (251 women and 63 men), recruited consecutively from the Affiliated Hospital of the Youjiang Medical University for Nationalities, Guangxi, China. All patients with SLE met the 1997 American College of Rheumatology (ACR) classification criteria for SLE 26, 27. Data on basic information and clinical profiles were collected by reviewing hospital laboratory records or by questionnaire.
At the same time, a total of 411 unrelated age‐ and gender‐matched healthy controls (103 males and 308 females) with no history of autoimmune disease, allergy and chronic infectious disease were also selected from the Affiliated Hospital of Youjiang Medical University for Nationalities. The study protocol was approved by the Ethics Committees of the Affiliated Hospital of Youjiang Medical University for Nationalities. The study was performed in accordance with the relevant guidelines. All subjects provided informed consent.
DNA extraction and genotyping
The genomic DNA was extracted from peripheral blood samples by standard procedures using a whole‐blood genome DNA isolation kit (Tiangen, Beijing, China). The polymerase chain reaction (PCR) primer designs were carried out by online primer version 3.0 software (http://primer3.ut.ee/), and are shown in Table 1. Genotypes of IL‐22 SNPs (rs2227485, rs2227513 and rs2227491) were analysed using the multiple single nucleotide primer extension technique. Each assay (20 µl) for PCR amplification comprised 2 μl PCR buffer (1× GC buffer I; Takara, Dalien, China), 2·0 µl Mg2+ (2·5 mmol/l), 2·0 µl deoxyribonucleotide triphosphate (dNTP) (2 mmol/l), 1 µl upstream primer (0·2 mol/l), 1 µl downstream primer (0·2 mol/l), 1·0 U polymerase and 1·0 µl template DNA. Sterile double‐distilled water was used to complement the inadequate volume in each reaction. PCR product was achieved using Multiplex PCR Master Mix (HotStarTaq DNA polymerase; Qiagen, Valencia, CA, USA). Twenty μl PCR was then purified with 5 U shrimp alkaline phosphatase (SAP) enzyme (Promega, Madison, WI, USA) and 2 U exonuclease I (Epicentre Technologies Corp., Madison, WI, USA) and incubated at 37°C for 60 min using the SNaPshot Multiplex Kit (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA), continuing the extension reaction after incubation at 75°C for 15 min. Finally, the 0·5 µl extension product was sequenced by using ABI3730XL sequencer after purification with SAP. GeneMapper version 4.1 (ABS) was performed to analyse the SNP genotype. Reaction condition of PCR: 96°C 2 min; 11 cycles (94°C 20 s, 65°C 40 s, 72°C 1·5 min); 24 cycles (94°C 20 s, 59°C 30 s, 72°C 1·5 min); 72°C 2 min; 4°C. To confirm the genotyping success, the samples were determined by DNA sequencing and the results were concordant.
Table 1.
Single nucleotide polymorphisms (SNPs) information and primers used for interleukin (IL)‐22 gene genotyping
| SNPs | Chromosome position | Primers |
|---|---|---|
| rs2227485 | 68253933 | rs2227485F: 5′‐GCCCGGAGGGTATTTTACAGACA‐3′ |
| rs2227485R: 5′‐TGGTAGGAAAATGAGTCCGTGACC‐3′ | ||
|
rs2227485E: 5′‐TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTCCGTGACCAAAATGCTTACTCAG‐3′ |
||
| rs2227513 | 68253559 | rs2227513F: 5′‐CAACTGGTGACTGGGGAAGGAG‐3′ |
| rs2227513R: 5′‐TGTGGGCTCCTGTGGTGGTTAG‐3′ | ||
|
rs2227513E: 5′‐TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTGCGTTTCGGCAAACTTGGT‐3′ |
||
| rs2227491 | 68252741 | rs2227491F: 5′‐TCTGCAGGTGGAAGGGAAACAG‐3′ |
| rs2227491R: 5′‐GACGTTCGTCTCATTGGGGAGA‐3′ | ||
|
rs2227491E: 5′‐TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTCAGTGTAAGCTACAGTTGTGACGAAC‐3′ |
E = extension; F = forward; R = reverse.
Serum IL‐22 level determination
Blood samples were collected from SLE patients and healthy controls. The serum was separated after clotting at ambient temperature and stored at −80°C until use. Serum IL‐22 concentration was measured by commercial enzyme‐linked immunosorbent assay (ELISA) (eBioscience, San Diego, CA, USA) following the manufacturer's instructions. The read absorbance of each result was determined using the 450 nm wavelength on an ELISA tester (RT‐6000, Shenzhen, China).
Statistical analysis
All statistical data analyses were performed by spss version 17.0 (SPSS Inc., Chicago, IL, USA). Differences of age between cases and healthy control groups were compared using Student's t‐test, and gender differences were evaluated using the χ2 test. Genotype and allele frequencies of IL‐22 were compared by χ2 test. Hardy–Weinberg equilibrium (HWE) was tested using a goodness‐of‐fit χ2 test. The association of the three SNPs polymorphisms and risk of SLE was evaluated by odds ratios (ORs) with 95% confidence intervals (95% CIs). Haplotype analysis was performed using the SHEsis software (http://analysis.bio-x.cn/myAnalysis.php). ORs and 95% CIs were adjusted based on age and gender using logistic regression. Differences in IL‐22 serum levels were compared using the Mann–Whitney U‐test. A value of P < 0·05 was considered statistically significant.
Results
Clinical characteristics of the study subjects
The characteristics of patients with SLE and controls are shown in Table 2. There was no significant difference between cases and controls in age (P = 0·200) and gender (P = 0·113).
Table 2.
Clinical characteristics of the systemic lupus erythematosus (SLE) patients and controls
| Characteristics | SLE n = 314 (%) | Controls n = 411 (%) | P |
|---|---|---|---|
| Age (median, years) | 37·98 ± 13·07 | 39·19 ± 12·12 | 0·200 |
| Male/female | 63 (20·1)/251 (79·9) | 103 (25·1)/308 (74.9) | 0·113 |
| Malar rash | 94 (29·94) | – | – |
| Photosensitivity | 177 (56·4) | – | – |
| Leucopenia | 195 (62·10) | – | – |
| Anaemia | 168 (53·50) | – | – |
| Complement depressed | 220 (70·06) | – | – |
| Renal disorder | 162 (51·59) | – | – |
| Neurological disorder | 72 (22·93) | – | – |
| Arthritis | 188 (59·87) | – | – |
| Anti‐dsDNA | 154 (49·04) | – | – |
| Anti‐RNP | 127 (40·45) | – | – |
| Anti‐Sm | 124 (38·54) | – | – |
| Anti‐SSA | 211 (67·20) | – | – |
| Anti‐SSB | 74 (23·57) | – | – |
RNP = ribonucleoprotein; SSA = Sjögren's syndrome A; SSB = Sjögren's syndrome B.
Polymorphisms in IL‐22 with SLE risk
Three genotypes were detected, respectively, in rs2227485 and rs2227491 polymorphisms and two genotypes exist in rs2227513 (Fig. 1). The genotype distributions of the IL‐22 rs2227485, rs2227513 and rs2227491 in SLE and controls are shown in Table 3. All genotype distributions of rs2227485, rs2227513 and rs2227491 met the HWE requirements in controls (P = 0·612, 0·650 and 0·059, respectively). In rs2227513, the AG genotype was associated with increased risk of SLE [AG versus AA: adjusted odds ratio (aOR) = 2·24, 95% CI = 1·22–4·12, AP = 0·010]. In addition, the G allele also was associated with increased risk of SLE (G versus A: aOR = 2·18, 95% CI = 1·20–3·97, AP = 0·011). Nevertheless, no significant association of rs2227485 or rs2227491 was observed with SLE risk (P > 0·05).
Figure 1.
Sequencing map of rs2227485, rs2227491 and rs2227513. Note: ①, ② and ③ represent genotypes of CC, CT and TT for rs2227485; ④, ⑤ and ⑥ represent genotypes of AA, AG and GG for rs2227491; ⑦ and ⑧ represent genotypes of AA and AG for rs2227513.
Table 3.
Distribution of polymorphisms of interleukin (IL)‐22 gene polymorphisms in systemic lupus erythematosus (SLE) patients and controls
| Polymorphisms | SLE | Controls | OR (95% CI) | AOR (95% CI)* | P | AP * |
|---|---|---|---|---|---|---|
| rs2227485 | ||||||
| CC | 49 (15·6) | 72 (17·5) | 1·00 (Ref) | 1·00 (Ref) | ||
| CT | 147 (46·8) | 206 (50·1) | 1·05 (0·69–1·60) | 1·02 (0.67–1·56) | 0·825 | 0·919 |
| TT | 118 (37·6) | 133 (32·4) | 1·30 (0·84–2·02) | 1·28 (0·82–1·99) | 0·237 | 0·270 |
| C | 245 (39·0) | 350 (42·6) | 1·00 (Ref) | |||
| T | 383 (61·0) | 472 (57·4) | 1·16 (0·94–1·43) | 1·15 (0·93–1·43) | 0·171 | 0·190 |
| Dominant model | ||||||
| CC | 49 (15·6) | 72 (17·5) | 1·00 (Ref) | 1·00 (Ref) | ||
| CT+TT | 265 (84·4) | 339 (82·5) | 1·15 (0·77–1·71) | 1·12 (0·75–1·68) | 0·494 | 0·566 |
| Recessive model | ||||||
| TT | 118 (37·6) | 133 (32·4) | 1·00 (Ref) | 1·00 (Ref) | ||
| CT+CC | 196 (62·4) | 278 (67·6) | 0·80 (0·59–1·08) | 0·79 (0·58–1·08) | 0·143 | 0·142 |
| rs2227513 | ||||||
| AA | 285 (90·8) | 393 (95·6) | 1·00 (Ref) | 1·00 (Ref) | ||
| AG | 29 (9·2) | 18 (4·4) | 2·22 (1·21–4·08) | 2·24 (1·22–4·12) | 0·009 | 0·010 |
| A | 599 (95·4) | 804 (97·8) | 1·00 (Ref) | 1·00 ( Ref) | ||
| G | 29 (4·6) | 18 (2·2) | 2·16 (1·19–3·93) | 2·18 (1·20–3·97) | 0·010 | 0·011 |
| rs2227491 | ||||||
| AA | 39 (12·4) | 66 (16·1) | 1·00 (Ref) | 1·00 (Ref) | ||
| AG | 164 (52·2) | 220 (53.5) | 1·26 (0·81–1·97) | 1·24 (0.79–1·94) | 0·305 | 0·347 |
| GG | 111 (35·4) | 125 (30·4) | 1·50 (0·94–2·41) | 1·50 (0·94–2·41) | 0·089 | 0·091 |
| A | 242 (38·5) | 352 (42·8) | 1·00 (Ref) | 1·00 (Ref) | ||
| G | 386 (61·5) | 470 (57·2) | 1·20 (0·97–1·48) | 1·20 (0·97–1·48) | 0·100 | 0·094 |
| Dominant model | ||||||
| AA | 39 (12·4) | 66 (16·1) | 1·00 (Ref) | 1·00 (Ref) | ||
| AG+GG | 275 (87·6) | 345 (83·9) | 1·35 (0·88–2·07) | 1·33 (0·87–2·05) | 0·168 | 0·186 |
| Recessive model | ||||||
| GG | 111 (35·4) | 125 (30·4) | 1·00 (Ref) | 1.00 (Ref) | ||
| AG+AA | 203 (64·6) | 286 (69·6) | 0·80 (0·59–1·09) | 0·79 (0·58–1·08) | 0·160 | 0·136 |
95% CI = 95% confidence interval; AOR = adjusted odds ratio; AP = adjusted P‐value; Ref = reference. *Adjusted by age and gender.
Haplotype analysis of the IL‐22 gene
Haplotype analysis was performed by the online SHEsis software and the possible haplotype frequencies are shown in Table 4. The maximum haplotype (T‐G‐A) accounted for 53·5% and 48·6% in SLE and controls, respectively. The two haplotypes (T‐A‐A, C‐G‐A) were associated with a decreased risk of SLE (OR = 0·53, 95% CI = 0·35–0·81, P = 0·003; OR = 0·56, 95% CI = 0·37–0·86, P = 0·007, respectively).
Table 4.
Haplotype analysis of the IL‐22 polymorphisms with risk of systemic lupus erythematosus (SLE)
| Haplotypes | SLE 2n = 628 | Controls 2n = 822 | OR (95% CI) | P |
|---|---|---|---|---|
| T‐G‐A* | 336 (53·5) | 399 (48·6) | 1·00 (Ref) | |
| T‐A‐A* | 36 (5·8) | 80 (9·7) | 0·53 (0·35–0·81) | 0·003 |
| C‐A‐A* | 190 (30·3) | 232 (28·3) | 0·97 (0·77–1·24) | 0·820 |
| C‐G‐A* | 36 (5·8) | 76 (9·3) | 0·56 (0·37–0·86) | 0·007 |
| C‐G‐G | 4 (0·6) | 5 (0·6) | – | – |
| C‐A‐G | 15 (2·4) | 17 (2·1) | – | – |
| T‐G‐G | 10 (1·6) | 12 (1·4) | – | – |
| T‐A‐G | 1 (0·0) | 1 (0·0) | – | – |
*Major haplotype = haplotype with frequency less than 3% will not be considered in the statistical analysis. OR = odds ratio; CI = confidence interval.
Association of polymorphisms and serum IL‐22 level
The median serum IL‐22 level was 74·65 pg/ml (range = 37·82–111·51 pg/ml) in SLE patients (n = 80) and 193·86 pg/ml (range = 101·94–317·23 pg/ml) in controls (n = 80). The concentration of IL‐22 was significantly lower than the controls (P < 0·001, Fig. 2a). We further found that patients carrying the rs2227513 AG genotype had lower levels of IL‐22 than the AA genotype (P = 0·028, Fig. 2b), but we failed to find any association of the rs2227485 and rs2227491 with serum levels of IL‐22 (P > 0·05).
Figure 2.
Enzyme‐linked immunosorbent assay (ELISA) detection of interleukin (IL)‐22 expression. (a) Serum level of IL‐22 in systemic lupus erythematosus (SLE) patients and controls. (b) Serum level of IL‐22 in patients carrying the rs2227513 AA genotype and patients carrying the AG genotype.
Association of rs2227513 polymorphism with clinical features
As shown in Table 5, we performed stratification analysis by comparing allele and genotype frequencies of rs2227513 between positive and negative patients in 13 clinical manifestations. The results showed a significant association between rs2227513 and renal disorder in the distribution of allele and genotype frequencies (G versus A: aOR = 3·09, 95% CI = 1·30–7·33, AP = 0·011; AG versus· AA: aOR = 3·25, 95% CI = 1·35–7·85, AP = 0·009).
Table 5.
Association of allele and genotype frequencies in rs2227513 with clinical features in SLE patients
| Clinical features | Allele | AOR* | AP * | Genotype | AOR* | AP * | ||
|---|---|---|---|---|---|---|---|---|
| A | G | G versus A | AA | AG | AG versus AA | |||
| Malar rash | ||||||||
| Positive | 180 | 8 | 0·88 (0·38–2·03) | 0·769 | 86 | 8 | 0·88 (0·37–2·06) | 0·763 |
| Negative | 419 | 21 | 199 | 21 | ||||
| Photosensitivity | ||||||||
| Positive | 340 | 14 | 0·71 (0·34–1·50) | 0·370 | 163 | 14 | 0·10 (0·98–1·01) | 0·698 |
| Negative | 259 | 15 | 122 | 15 | ||||
| Leucopenia | ||||||||
| Positive | 370 | 20 | 1·38 (0·62–3·07) | 0·438 | 175 | 20 | 1·40 (0·61–3·18) | 0·426 |
| Negative | 229 | 9 | 110 | 9 | ||||
| Anemia | ||||||||
| Positive | 321 | 15 | 0·94 (0·44–1·98) | 0·863 | 153 | 15 | 0·93 (0·43–2·01) | 0·859 |
| Negative | 278 | 14 | 132 | 14 | ||||
| Complement depressed | ||||||||
| Positive | 440 | 20 | 0·95 (0·42–2·12) | 0·90 | 200 | 20 | 0·95 (0·41–2·16) | 0·894 |
| Negative | 179 | 9 | 85 | 9 | ||||
| Renal disorder | ||||||||
| Positive | 302 | 22 | 3·09 (1·30–7·33) | 0·011 | 140 | 22 | 3·25 (1·35–7·85) | 0·009 |
| Negative | 297 | 7 | 145 | 7 | ||||
| Neurologic disorder | ||||||||
| Positive | 136 | 8 | 0·49 (0·58–2·17) | 0·346 | 64 | 8 | 1·31 (0·55–3·11) | 0·538 |
| Negative | 463 | 21 | 221 | 21 | ||||
| Arthritis | ||||||||
| Positive | 359 | 17 | 0·93 (0·44–2·00) | 0·859 | 171 | 17 | 0·93 (0·43–2·03) | 0·856 |
| Negative | 240 | 12 | 114 | 12 | ||||
| Anti‐dsDNA | ||||||||
| Positive | 294 | 14 | 0·97 (0·46–2·05) | 0·941 | 140 | 14 | 0·97 (0·45–2·09) | 0·940 |
| Negative | 305 | 15 | 145 | 15 | ||||
| Anti‐RNP | ||||||||
| Positive | 242 | 12 | 1·04 (0·49–2·23) | 0·912 | 115 | 12 | 1·05 (0·48–2·27) | 0·910 |
| Negative | 357 | 17 | 170 | 17 | ||||
| Anti‐Sm | ||||||||
| Positive | 250 | 9 | 0·67 (0·30–1·51) | 0·335 | 115 | 9 | 0·66 (0·29–1·50) | 0·323 |
| Negative | 349 | 20 | 170 | 20 | ||||
| Anti‐SSA | ||||||||
| Positive | 403 | 19 | 0·93 (0·42–2·04) | 0·853 | 192 | 19 | 0·93 (0·41–2·07) | 0·849 |
| Negative | 196 | 10 | 93 | 10 | ||||
| Anti‐SSB | ||||||||
| Positive | 142 | 6 | 0·84 (0·34–2·10) | 0·710 | 68 | 6 | 0·83 (0·33–2·13) | 0·703 |
| Negative | 457 | 23 | 217 | 23 | ||||
95% CI = 95% confidence interval; AOR = adjusted odds ratio; AP = adjusted P‐value; Ref = reference. *Adjusted by age and gender.
Discussion
Many studies have revealed that inflammatory cytokines are involved in the dominant pathogenesis of autoimmune diseases. Cytokines produced by activated Th cells have been shown to be normally involved in the pathogenesis of SLE 28. Furthermore, Th1‐dominant immune responses have been considered to be pathological of autoimmune diseases by the induction of an inflammatory reaction. A large number of Th1 cytokines [interferon (IFN)‐γ, tumour necrosis factor (TNF)‐α and IL‐12] have been discovered in SLE 29, 30. However, there is compelling evidence that Th17 cells have been related to the aetiology of SLE 31. Importantly, IL‐22 is secreted mainly by Th22 cells. Moreover, over‐expression of IL‐22 has an abnormal acanthosis and hypogranularity of skin phenotype that resembles psoriasis‐like alterations in transgenic mice 32. Kreymborg et al. 33 reported that IL‐22 is expressed in an IL‐23‐dependent fashion, but is not essential for the development of experimental autoimmune encephalomyelitis (EAE). Kim et al. 34 found that IL‐22 could promote osteoclastogenesis in RA by up‐regulating receptor activator of nuclear factor kappa‐B ligand (RANKL) in human synovial fibroblasts. Thus, these studies reveal that IL‐22 takes part in the pathological process in autoimmune diseases, including SLE. It is worth noting that the receptor for IL‐22 is not expressed on immune cells. IL‐22R1 is expressed mainly on cells of non‐haematopoietic origin, such as epithelial, renal tubular and pancreatic ductal cells. IL‐22 is not thought to regulate immune cells directly, and can mediate inflammation by affecting the expression of other cytokines (IL‐6, IL‐1, G‐CSF, etc.). This also requires more research to explore its complex pathological mechanisms in autoimmune diseases.
Copy number variations (CNVs) of IL‐22 were found to be increased significantly in SLE patients than controls. The results showed that the CNVs are associated with the risk of SLE 35. In the current study, we investigated the association of IL‐22 SNPs with susceptibility to SLE. To the best of our knowledge, our study is the first report to detect allele and genotype frequencies of SNPs (rs2227485, rs2227513 and rs2227491) in IL‐22 and risk of SLE between 314 SLE patients and 411 healthy controls in a Chinese population. The rs2227513 was associated with risk of SLE. Of note, the genotype and allele contrast of the SNP rs2227513 revealed that the AG genotype and G allele were associated with a significantly increased risk of SLE with ORs of 2·24 (1·22–4·12) and 2·18 (1·20–3·97), respectively. Moreover, levels of IL‐22 were significantly lower in individuals with the AG genotype than of the AA genotype. SLE is a multi‐system autoimmune disorder, leading to tissue and organ damage. Renal impairment is one of the most common clinical features of SLE, and could influence approximately 60% of lupus patients. In this study, there were 51·59% patients diagnosed with renal disorder. We also analysed the correlations between IL‐22 polymorphisms and clinical features of patients with SLE. Statistical significance was observed in the genotype and allele distribution for rs2227513 between renal disorder and non‐renal disorder patients. These results indicate that rs2227513 may contribute to the susceptibility of SLE.
The rs2227513 locates on the first intron of IL‐22. Recent evidence has confirmed that introns can serve as important gene regulatory structures that have various and complex functional effects, such as RNA editing, non‐coding RNAs and transacting elements 36, 37. Moreover, Xu et al. 38 found that some proteins play the roles of binding partners for the G‐containing SNP site. The G‐to‐A transition weakens protein binding and facilitates exon skipping, leading to altered gene expression. Jun Hu et al. 39 found a higher association of the AG genotype and G allele in rs2227513 with HIV infection in women. We found that the AG genotype and the G allele increased the risk of SLE. Interestingly, Jun Hu et al.'s study showed that the rs2227513 AG genotype was also associated with higher levels of IL‐22. However, the AG genotype corresponded to a lower level of IL‐22 in our results. Because of higher levels of serum IL‐22 in HIV and lower levels in SLE, this result was similar to our findings. Conversely, it also indicated that rs2227513 might increase the susceptibilities of SLE and HIV infection, probably by regulating the expression of IL‐22. However, how the rs2227513 of IL‐22 affects gene expression in SLE remains uncertain.
Previous studies have also evaluated the role of rs2227485 in multiple diseases. Qin et al. 40 demonstrated that genotype and allele frequencies of the IL‐22 rs2227485 polymorphism had no association with the risk of gastric cancer in 108 patients and 110 healthy controls. Other studies have also found no association between the SNP polymorphism and HIV infection, ulcerative colitis (UC), pulmonary tuberculosis and chronic plaque psoriasis 25, 39, 41, 42. However, Liao et al. 43 revealed that rs2227485 was associated with an approximately threefold higher risk in gastric mucosa‐associated lymphoid tissue (MALT) lymphoma compared with its homozygous counterpart. Also, the co‐dominant 2 model and dominant model of rs2227485 were associated significantly with papillary thyroid cancer (PTC) 44; the allele T frequency was also associated with PTC. Correlative analyses of clinical parameters and rs2227485 indicated that the SNP was associated with the number of cancers. Obviously, these results are inconsistent with our result, that the IL‐22 rs2227485 polymorphism is not associated with SLE risk. Some possible reasons should be taken into consideration to interpret the discrepancy. SNPs play different roles in different disease types, especially in diverse ethnicities. Another possibility concerns the limited sample size. Hence, population‐based association studies with more samples are necessary to gain precise results. Regarding the rs2227491 and disease risk, some results have not found a relationship between chronic plaque psoriasis patients and HIV patients 25, 39. Our study was similar to the previous findings.
The findings from our study will provide novel insights into SLE aetiology and create an opportunity to access the diagnosis and treatment of autoimmune diseases. However, several potential limitations of our present study should be acknowledged. First, this design was a hospital‐based case–control study, and the possibility of selection bias cannot be ruled out. However, no deviation from HWE was tested in each SNP, suggesting that the possibility is minimal. Secondly, our study sample size was relatively small. Therefore, the findings should be interpreted carefully, and studies with larger numbers of subjects are necessary to replicate these genetic associations. Thirdly, we tested only three polymorphisms (rs2227485, rs2227513 and rs2227491) in the IL‐22 gene. Illustrating the whole gene with SLE susceptibility is a remote possibility, and further fine‐mapping studies are necessary. Finally, as is well known, SLE is composed of complex interactions between genetic and environmental factors. In this study, the effect of gene–environment interactions cannot be estimated. Thus, further gene–environment interaction studies may provide more powerful proof of IL‐22 polymorphisms in the aetiology of SLE. Furthermore, we did not study the relationship between the IL‐22RA2 gene polymorphism and SLE. This could be a new research suggestion for the future.
In summary, our findings suggested that the IL‐22 gene polymorphism (rs2227513) may act as a contributor to increased SLE susceptibility. Similarly, the rs2227513 was also associated with renal disorder in SLE patients. Nevertheless, to elucidate the accurate mechanism of IL‐22 in SLE, further well‐designed investigations in various populations are warranted to verify these results. More functional studies are needed to clarify the exact role of rs2227513 in the precise pathogenesis of SLE.
Disclosure
The authors declare no competing financial interests.
Acknowledgements
We thank all the participants involved in our study. This work was supported by the National Natural Science Foundation of China (no. 81560552 and 81260234).
Contributor Information
Y. Lan, Email: yylanyan@163.com
Y.‐S. Wei, Email: yeshengwei22@163.com.
References
- 1. Hu SC, Yen FL, Wang TN, Lin YC, Lin CL, Chen GS. Immunosuppressive medication use and risk of herpes zoster (HZ) in patients with systemic lupus erythematosus (SLE): a nationwide case‐control study. J Am Acad Dermatol 2016; 75:49–58. [DOI] [PubMed] [Google Scholar]
- 2. Jucaud V, Ravindranath MH, Terasaki PI et al Serum antibodies to human leucocyte antigen (HLA)‐E, HLA‐F and HLA‐G in patients with systemic lupus erythematosus (SLE) during disease flares: clinical relevance of HLA‐F autoantibodies. Clin Exp Immunol 2016; 183:326–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Hughes T, Sawalha AH. The role of epigenetic variation in the pathogenesis of systemic lupus erythematosus. Arthritis Res Ther 2011; 13:245. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Tebbe B, Orfanos CE. Epidemiology and socioeconomic impact of skin disease in lupus erythematosus. Lupus 1997; 6:96–104. [DOI] [PubMed] [Google Scholar]
- 5. Moulton VR, Tsokos GC. T cell signaling abnormalities contribute to aberrant immune cell function and autoimmunity. J Clin Invest 2015; 125:2220–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Menard LC, Habte S, Gonsiorek W et al B cells from African American lupus patients exhibit an activated phenotype. JCI Insight 2016; 1: e87310. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Katkam SK, Rajasekhar L, Kumaraswami K, Kutala VK. Association of IL −6 −174 G>C polymorphism with the risk of SLE among south Indians: evidence from case–control study and meta‐analysis. Lupus 2017; 26: 1491–501. [DOI] [PubMed] [Google Scholar]
- 8. Talaat RM, Alrefaey SA, Bassyouni IH, Ashour ME, Raouf AA. Genetic polymorphisms of interleukin 6 and interleukin 10 in Egyptian patients with systemic lupus erythematosus. Lupus 2016; 25:255–64. [DOI] [PubMed] [Google Scholar]
- 9. Elloumi N, Fakhfakh R, Abida O et al Relevant genetic polymorphisms and kidney expression of Toll‐like receptor (TLR)‐5 and TLR‐9 in lupus nephritis. Clin Exp Immunol 2017; 190:328–39. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Palafox‐Sanchez CA, Oregon‐Romero E, Salazar‐Camarena DC et al Association of interleukin‐10 promoter haplotypes with disease susceptibility and IL‐10 levels in Mexican patients with systemic lupus erythematosus. Clin Exp Med 2015; 15:439–46. [DOI] [PubMed] [Google Scholar]
- 11. Gao J, Gai N, Wang L et al Meta‐analysis of programmed cell death 1 polymorphisms with systemic lupus erythematosus risk. Oncotarget 2017; 8:36885–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Sanchez E, Palomino‐Morales RJ, Ortego‐Centeno N et al Identification of a new putative functional IL18 gene variant through an association study in systemic lupus erythematosus. Hum Mol Genet 2009; 18:3739–48. [DOI] [PubMed] [Google Scholar]
- 13. Zhong W, Jiang Y, Ma H, Wu J, Jiang Z, Zhao L. Elevated levels of CCR6(+) T helper 22 cells correlate with skin and renal impairment in systemic lupus erythematosus. Sci Rep 2017; 7:12962. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Zhu JQ, Wang R, Chen SX, Zhao D, Li J. Interleukin‐22 promotes proliferation of fibroblast‐like synoviocytes from patients with rheumatoid arthritis by inducing STAT3 phosphorylation. Nan Fang Yi Ke Da Xue Xue Bao 2017; 37:1570–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Muls N, Nasr Z, Dang HA, Sindic C, van Pesch V. IL‐22, GM‐CSF and IL‐17 in peripheral CD4+ T cell subpopulations during multiple sclerosis relapses and remission. PLOS ONE 2017; 12:e0173780. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Badr AMM, Farag Y, Abdelshafy M, Riad NM. Urinary interleukin 22 binding protein as a marker of lupus nephritis in Egyptian children with juvenile systemic lupus erythematosus. Clin Rheumatol 2018; 37:451–8. [DOI] [PubMed] [Google Scholar]
- 17. Ciccia F, Guggino G, Rizzo A et al Potential involvement of IL‐22 and IL‐22‐producing cells in the inflamed salivary glands of patients with Sjogren's syndrome. Ann Rheum Dis 2012; 71:295–301. [DOI] [PubMed] [Google Scholar]
- 18. Ciccia F, Rizzo A, Alessandro R et al Activated IL‐22 pathway occurs in the muscle tissues of patients with polymyositis or dermatomyositis and is correlated with disease activity. Rheumatology 2014; 53:1307–12. [DOI] [PubMed] [Google Scholar]
- 19. Sonnenberg GF, Fouser LA, Artis D. Functional biology of the IL‐22‐IL‐22R pathway in regulating immunity and inflammation at barrier surfaces. Adv Immunol 2010; 107:1–29. [DOI] [PubMed] [Google Scholar]
- 20. Lejeune D, Dumoutier L, Constantinescu S, Kruijer W, Schuringa JJ, Renauld JC. Interleukin‐22 (IL‐22) activates the JAK/STAT, ERK, JNK, and p38 MAP kinase pathways in a rat hepatoma cell line. Pathways that are shared with and distinct from IL‐10. J Biol Chem 2002; 277:33676–82. [DOI] [PubMed] [Google Scholar]
- 21. Zhang F, Wu L, Qian J et al Identification of the long noncoding RNA NEAT1 as a novel inflammatory regulator acting through MAPK pathway in human lupus. J Autoimmun 2016; 75:96–104. [DOI] [PubMed] [Google Scholar]
- 22. Goropevsek A, Holcar M, Avcin T. The role of STAT signaling pathways in the pathogenesis of systemic lupus erythematosus. Clin Rev Allergy Immunol 2017; 52:164–81. [DOI] [PubMed] [Google Scholar]
- 23. Lin J, Yue LH, Chen WQ. Decreased serum IL‐22 levels and correlations with IL‐22‐producing T helper cells in patients with new‐onset systemic lupus erythematosus. Scand J Immunol 2014; 79:131–6. [DOI] [PubMed] [Google Scholar]
- 24. Pan HF, Zhao XF, Yuan H et al Decreased serum IL‐22 levels in patients with systemic lupus erythematosus. Clin Chim Acta 2009; 401:179–80. [DOI] [PubMed] [Google Scholar]
- 25. Weger W, Hofer A, Wolf P et al Common polymorphisms in the interleukin‐22 gene are not associated with chronic plaque psoriasis. Exp Dermatol 2009; 18:796–8. [DOI] [PubMed] [Google Scholar]
- 26. Tan EM, Cohen AS, Fries JF et al The 1982 revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum 1982; 25:1271–7. [DOI] [PubMed] [Google Scholar]
- 27. Hochberg MC. Updating the American College of Rheumatology revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum 1997; 40:1725. [DOI] [PubMed] [Google Scholar]
- 28. Xu B, Wang S, Zhou M et al The ratio of circulating follicular T helper cell to follicular T regulatory cell is correlated with disease activity in systemic lupus erythematosus. Clin Immunol 2017; 183:46–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Viallard JF, Pellegrin JL, Ranchin V et al Th1 (IL‐2, interferon‐gamma (IFN‐gamma)) and Th2 (IL‐10, IL‐4) cytokine production by peripheral blood mononuclear cells (PBMC) from patients with systemic lupus erythematosus (SLE). Clin Exp Immunol 1999; 115:189–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Tokano Y, Morimoto S, Kaneko H et al Levels of IL‐12 in the sera of patients with systemic lupus erythematosus (SLE)–relation to Th1‐ and Th2‐derived cytokines. Clin Exp Immunol 1999; 116:169–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Deleuran B, Abraham DJ. Possible implication of the effector CD4+ T‐cell subpopulation TH17 in the pathogenesis of systemic scleroderma. Nat Clin Pract Rheumatol 2007; 3:682–3. [DOI] [PubMed] [Google Scholar]
- 32. Wolk K, Haugen HS, Xu W et al IL‐22 and IL‐20 are key mediators of the epidermal alterations in psoriasis while IL‐17 and IFN‐gamma are not. J Mol Med (Berl) 2009; 87:523–36. [DOI] [PubMed] [Google Scholar]
- 33. Kreymborg K, Etzensperger R, Dumoutier L et al IL‐22 is expressed by Th17 cells in an IL‐23‐dependent fashion, but not required for the development of autoimmune encephalomyelitis. J Immunol 2007; 179:8098–104. [DOI] [PubMed] [Google Scholar]
- 34. Kim KW, Kim HR, Park JY et al Interleukin‐22 promotes osteoclastogenesis in rheumatoid arthritis through induction of RANKL in human synovial fibroblasts. Arthritis Rheum 2012; 64:1015–23. [DOI] [PubMed] [Google Scholar]
- 35. Yu B, Guan M, Peng Y et al Copy number variations of interleukin‐17F, interleukin‐21, and interleukin‐22 are associated with systemic lupus erythematosus. Arthritis Rheum 2011; 63:3487–92. [DOI] [PubMed] [Google Scholar]
- 36. Jacquier A. Group II introns: elaborate ribozymes. Biochimie 1996; 78:474–87. [DOI] [PubMed] [Google Scholar]
- 37. Qaddourah RH, Magdoud K, Saldanha FL et al IL‐10 gene promoter and intron polymorphisms and changes in IL‐10 secretion in women with idiopathic recurrent miscarriage. Hum Reprod 2014; 29:1025–34. [DOI] [PubMed] [Google Scholar]
- 38. Xu J, Lu Z, Xu M et al A heroin addiction severity‐associated intronic single nucleotide polymorphism modulates alternative pre‐mRNA splicing of the mu opioid receptor gene OPRM1 via hnRNPH interactions. J Neurosci 2014; 34: 11048–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Hu J, Li Y, Chen L et al Impact of IL‐22 gene polymorphism on human immunodeficiency virus infection in Han Chinese patients. J Microbiol Immunol Infect 2016; 49:872–8. [DOI] [PubMed] [Google Scholar]
- 40. Qin SY, Yang XW, Luo W et al Association of interleukin 22 polymorphisms with gastric cancer risk. Tumour Biol 2015; 36:2033–9. [DOI] [PubMed] [Google Scholar]
- 41. Yamamoto‐Furusho JK, Sanchez‐Morales GE, Garcia‐Rangel D, Vargas‐Alarcon G. Genetic polymorphisms of interleukin‐22 in patients with ulcerative colitis. Rev Gastroenterol Mex 2016; 81:86–90. [DOI] [PubMed] [Google Scholar]
- 42. Ding GG, Zhang GL, Chen XC, Zhang MX, Yang L, Wang Z. A study on the relationship between single nucleotide polymorphisms of interleukin‐22 and susceptibility to pulmonary tuberculosis. Zhonghua Jie He He Hu Xi Za Zhi 2012; 35:596–600. [PubMed] [Google Scholar]
- 43. Liao F, Hsu YC, Kuo SH et al Genetic polymorphisms and tissue expression of interleukin‐22 associated with risk and therapeutic response of gastric mucosa‐associated lymphoid tissue lymphoma. Blood Cancer J 2014; 4:eXX. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Eun YG, Shin IH, Lee YC et al Interleukin 22 polymorphisms and papillary thyroid cancer. J Endocrinol Invest 2013; 36:584–7. [DOI] [PubMed] [Google Scholar]