Skip to main content
NCBI home page
The Plant Cell logoLink to The Plant Cell
. 2018 May 9;30(6):1309–1321. doi: 10.1105/tpc.18.00222

The KNOXI Transcription Factor SHOOT MERISTEMLESS Regulates Floral Fate in Arabidopsis[OPEN]

Ohad Roth a, John P Alvarez b, Matan Levy c, John L Bowman b, Naomi Ori c, Eilon Shani a,1
PMCID: PMC6048794  PMID: 29743198

SHOOT MERISTEMLESS genetically interacts with APETALA1 and UNUSUAL FLORAL ORGANS to regulate flower meristem identity in Arabidopsis.

Abstract

Plants have evolved a unique and conserved developmental program that enables the conversion of leaves into floral organs. Elegant genetic and molecular work has identified key regulators of flower meristem identity. However, further understanding of flower meristem specification has been hampered by redundancy and by pleiotropic effects. The KNOXI transcription factor SHOOT MERISTEMLESS (STM) is a well-characterized regulator of shoot apical meristem maintenance. Arabidopsis thaliana stm loss-of-function mutants arrest shortly after germination; therefore, the knowledge on later roles of STM in later processes, including flower development, is limited. Here, we uncover a role for STM in the specification of flower meristem identity. Silencing STM in the APETALA1 (AP1) expression domain in the ap1-4 mutant background resulted in a leafy-flower phenotype, and an intermediate stm-2 allele enhanced the flower meristem identity phenotype of ap1-4. Transcriptional profiling of STM perturbation suggested that STM activity affects multiple floral fate genes, among them the F-box protein-encoding gene UNUSUAL FLORAL ORGANS (UFO). In agreement with this notion, stm-2 enhanced the ufo-2 floral fate phenotype, and ectopic UFO expression rescued the leafy flowers in genetic backgrounds with compromised AP1 and STM activities. This work suggests a genetic mechanism that underlies the activity of STM in the specification of flower meristem identity.

INTRODUCTION

In angiosperms, flower development is essential for the completion of the plant life cycle. The transition from vegetative to reproductive growth in Arabidopsis thaliana occurs in response to extrinsic and intrinsic cues. These cues, sensed in both leaves and the shoot apex, stimulate the transformation of the vegetative shoot apical meristem (SAM) into an inflorescence meristem in a process that is characterized by meristem enlargement due to accelerated cell division (Srikanth and Schmid, 2011; Andrés and Coupland, 2012; Verhage et al., 2014; Hyun et al., 2017). The floral transition and the subsequent formation of flowers are therefore highly dependent on inductive cues, which gradually increase the expression of flower meristem identity genes in emerging lateral primordia. In Arabidopsis, once flower formation has been initiated, there is no reversion to earlier primordium identities by either the inflorescence or flower meristem.

LEAFY (LFY) and APETALA1 (AP1) are two key transcription factors that orchestrate the specification of flower meristem identity. The lfy and ap1 mutants develop flowers with inflorescence characteristics in terms of organ identity and phyllotaxis (Irish and Sussex, 1990; Schultz and Haughn, 1991; Weigel et al., 1992; Bowman et al., 1993). In plants homozygous for loss-of-function alleles of both lfy and ap1, the transformation of flowers into inflorescence-like shoots is enhanced, revealing the synergistic interaction between these genes in conferring flower meristem identity (Huala and Sussex, 1992; Weigel et al., 1992; Bowman et al., 1993). The F-box protein UNUSUAL FLORAL ORGANS (UFO), which acts as a LFY cofactor in flower primordia, was also suggested to function as a flower meristem identity regulator (Levin and Meyerowitz, 1995; Wilkinson and Haughn, 1995; Lee et al., 1997; Samach et al., 1999; Chae et al., 2008). Unlike AP1 and LFY, which are expressed in lateral primordia that initiate from the inflorescence meristem, UFO is also expressed in the inflorescence meristem itself (Mandel et al., 1992; Weigel et al., 1992; Lee et al., 1997; Samach et al., 1999). Following the acquisition of floral fate, flower meristems form floral organs in a mechanism described by the ABCE and the floral quartet models (Bowman et al., 1991; Pelaz et al., 2000; Honma and Goto, 2001; Ditta et al., 2004; Smaczniak et al., 2012).

The search for factors responsible for flower development has relied primarily on forward genetic screens. Therefore, the involvement of genes that are also required at early stages of plant development, with loss-of-function alleles leading to lethality at early developmental stages, might have been overlooked. Although the Arabidopsis Class 1 KNOTTED1-LIKE HOMEOBOX (KNOXI) transcription factor encoded by SHOOT MERISTEMLESS (STM) was first identified more than two decades ago, our knowledge regarding its function is mostly restricted to the vegetative meristem, due to the seedling-stage arrest phenotype of its loss-of-function mutants (Barton and Poethig, 1993). Previous studies have revealed the importance of STM in both the establishment and maintenance of the SAM in maize (Zea mays), Arabidopsis, and other species (Barton and Poethig, 1993; Endrizzi et al., 1996; Kerstetter et al., 1997; Shani et al., 2009; Hay and Tsiantis, 2010). STM orchestrates the accumulation of antagonistic plant hormones, such as cytokinin (CK) and gibberellin (GA), thus promoting the maintenance of pluripotency at the SAM and preventing precocious differentiation (Jasinski et al., 2005; Yanai et al., 2005). The role of STM in SAM maintenance is partially redundant with the related KNOXI genes BREVIPEDICELLUS (BP/KNAT1) and KNOTTED-LIKE FROM ARABIDOPSIS THALIANA6 (KNAT6) (Byrne et al., 2002) and is mediated by heterodimerization with the BEL1-like HOMEODOMAIN (BELL) protein PENNYWISE (PNY) (Byrne et al., 2003). The BELL protein POUNDFOOLISH (PNF) was also shown to heterodimerize with STM; however, unlike pny, pnf loss-of-function alleles do not enhance stm alleles (Kanrar et al., 2006). ChIP-seq analyses in maize and rice (Oryza sativa) have identified targets of STM orthologs in those species (Bolduc et al., 2012; Tsuda and Hake, 2015). Interestingly, in addition to targets associated with known STM activities such as SAM maintenance and organ separation, members of distinct transcription factor families such as MADS box transcription factors were enriched (as detected by ChIP-seq analyses in maize and rice), implying additional KNOXI transcriptional regulation.

Several lines of evidence suggest that STM plays important roles during the reproductive phase and flower development. First, STM expression in the SAM continues after the transition from vegetative to inflorescence meristem and is detected in flower meristems beginning at early stage 2 (Long et al., 1996; Long and Barton, 2000; stages of flower development are based on Smyth et al. [1990]). In addition, the weak stm-2 allele and STM-RNAi plants have arrested flowers with reduced numbers of petals and stamens and no carpels (Clark et al., 1996; Endrizzi et al., 1996; Scofield et al., 2007). STM overexpression results in enlarged gynoecia consisting of carpeloid ovules, a phenotype that is dependent on intact AGAMOUS (AG) function (Scofield et al., 2007). Finally, STM genetically interacts with the FLOWERING LOCUS T (FT)-FD floral transition complex (Abe et al., 2005; Wigge et al., 2005). stm-10 ft and stm-10 fd double mutant plants enhance the phenotypes of ft/fd late flowering single mutants and in some cases do not generate flowers at all (Smith et al., 2011).

Here, we investigated the role of STM in the reproductive phase and uncovered its activity in floral fate acquisition in emerging flower meristems.

RESULTS

STM Activity Is Required for Flower Meristem Competence

To investigate the role of STM during late developmental stages, we aimed to overcome the meristem arrest effect of STM loss of function during the early vegetative stage and its potential redundant function with its close homolog, the KNOXI gene BP (Byrne et al., 2002). To this end, we generated an artificial microRNA (amiR) designed to target both STM and BP transcripts and expressed it in Arabidopsis at different developmental stages using a transactivation system (Moore et al., 1998). ProSTM>>amiR-STM/BP plants phenocopied the stm-1 phenotype of aborted SAM (Figure 1A), which confirmed the functionality of the amiR-STM/BP in impairing STM function.

Figure 1.

Figure 1.

Open in a new tab

Silencing of STM and BP in the AP1 Expression Domain Causes Reduced Floral Organ Number and Short Pedicels.

(A) Three-week-old Ler, stm-1, and ProSTM>>amiR-STM/BP seedlings. White arrows indicate aborted SAM.

(B) Inflorescences (top) and flowers (bottom) of Ler, stm-2, bp-1, and ProAP1>>amiR-STM/BP. Bars = 1 mm.

We used the amiR-STM/BP to study the role of STM in emerging floral buds, where its expression pattern differs from that of BP, with STM detected throughout the flower meristem beginning at stage 2 of flower development and BP transcripts confined to the floral primordium base (Lincoln et al., 1994; Long and Barton, 2000; Smith and Hake, 2003). Expression of amiR-STM/BP driven by the AP1 promoter (ProAP1>>amiR-STM/BP) allowed STM to be downregulated in early stage 2 flower meristems (where STM and AP1 are coexpressed) and resulted in a significant reduction in petal and stamen number and the loss of carpels (Figure 1B; Supplemental Table 1). Thus, stage-specific STM expression contributes to flower meristem competence and is in line with the phenotype of the stm-2 intermediate allele (Figure 1B) and an STM inducible RNAi line (Clark et al., 1996; Endrizzi et al., 1996; Scofield et al., 2007). ProAP1>>amiR-STM/BP inflorescences displayed the typical downward-facing flowers characteristic of bp alleles (Venglat et al., 2002) (Figure 1B), in agreement with AP1 expression in flower pedicles (Gustafson-Brown et al., 1994). Further analysis indicated that ProAP1>>amiR-STM/BP flower meristems were significantly smaller than those of Landsberg erecta (Ler), accompanied by a reduction in the intensity of the ProCLAVATA3:YFP-ER stem cells fluorescent marker (Supplemental Figure 1). If the reduction in flower organs in ProAP1>>amiR-STM/BP is indeed a result of smaller flower meristem size, we reasoned that organ initiation could be rescued by increasing flower meristem size. To test this, we introduced the increased meristem size mutant clavata3-2 (clv3-2; Clark et al., 1995) (Supplemental Figure 1D) into the ProAP1>>amiR STM/BP background. ProAP1>>amiR STM/BP clv3-2 plants partially rescued the arrested flower phenotype (Supplemental Figure 1E). It is possible that STM regulates CLV3 expression indirectly by maintaining flower meristem size. Together, the results suggest that STM contributes to flower meristem maintenance.

STM Regulates Flower Meristem Identity Synergistically with AP1

Silencing STM during stage 2 of flower development using ProAP1>>amiR-STM/BP resulted in a reduction in flower meristem size and floral organ number, indicating a function in emerging flower meristems (Figures 2A and 2B). Since the acquisition of floral fate during the first stages of flower development is known to be based on the synergistic activities of several players, we sought to investigate whether STM contributes to this process. Therefore, we introduced ProAP1>>amiR-STM/BP into the ap1-4 mutant background. ap1-4 mutant plants are characterized by the partial conversion of flowers into inflorescences, with secondary flowers initiating from the axils of bracts (Figure 2C) (Bowman et al., 1993). Strikingly, ProAP1>>amiR-STM/BP ap1-4 plants presented a leafy-flower phenotype (Figure 2D; Supplemental Table 1), reminiscent of the ap1 lfy double mutant (Huala and Sussex, 1992; Weigel et al., 1992; Bowman et al., 1993). Scanning electron microscopy demonstrated that ProAP1>>amiR-STM/BP ap1-4 plants developed flowers with impaired whorled floral phyllotaxis, with leaf-like organs initiating in a spiral-like manner (Figures 2E and 2F). Thus, ProAP1>>amiR-STM/BP enhanced the ap1-4 phenotype with respect to the conversion of flower meristems to shoot-like structures, indicating a synergistic interaction between AP1 and STM in the promotion of flower meristem identity.

Figure 2.

Figure 2.

Open in a new tab

STM Downregulation in the AP1 Expression Domain Enhances the Loss of Flower Meristem Identity in ap1-4.

(A) to (D) Inflorescences (left) and flowers (right) of the indicated genotypes.

(C) and (D) Horizontal view of inflorescence (left), top view of inflorescence (middle), and top view of flower (right).

(E) and (F) Scanning electron micrograph of ap1-4 and ProAP1>>amiR-STM/BP ap1-4 inflorescences (left) and flowers (right). Red arrows indicate stamen primordia initiating in a whorled phyllotaxy in ap1-4 flower, while the flower meristem of ProAP1>>amiR-STM/BP ap1-4 develops leaves initiating in a nonwhorled pattern (white arrows).

(G) and (H) Two independent Op:amiR STM lines in the ProAP1:LhG4 ap1-4 background.

(G) Images of line #1 inflorescence (left) and flower (right).

(H) Image of line #2 inflorescence. White arrows indicate flower-internode elongation. Strong phenotypes for both lines are presented.

Bars = 1 mm for stereoscope images. For scanning electron microscopy images, bars = 100 µm and 20 µm for inflorescences and flowers, respectively.

To further characterize the leafy phenotype of ProAP1>>amiR-STM/BP ap1-4 flowers, we introduced floral organ identity markers into this background. The ProAPETALA3:GUS and ProAG:GUS reporter lines showed no signal in ProAP1>>amiR-STM/BP ap1-4 leafy-flowers compared with GUS signals from ProAP1>>amiR-STM/BP (Supplemental Figure 2). This indicates that ProAP1>>amiR-STM/BP ap1-4 flowers produced leaf-like organs lacking morphological and molecular characteristics of floral organs.

To test whether the leafy phenotype of ProAP1>>amiR-STM/BP ap1-4 flowers is indeed due to stage-specific perturbation of STM activity, we generated another amiRNA exclusively targeting STM and introduced it into the transactivation system in the ap1-4 background. Similar to ProAP1>>amiR-STM/BP, ProAP1>>amiR-STM enhanced flower to leafy-flower conversion, exhibiting a similar phenotype to ProAP1>>amiR-STM/BP ap1-4 flowers (Figure 2G), as well as internode elongation following the first leaves and an increase in leaf number per flower (Figure 2H; Supplemental Table 1). The synergistic interaction was significant but varied within and between lines. In line with the BP expression pattern (Lincoln et al., 1994; Smith and Hake, 2003), the bp loss-of-function allele did not enhance the ap1-4 phenotype, and only an additive interaction was observed in ap1-4 bp-1 double mutant plants (Supplemental Figure 3). These observations strengthen the hypothesis that STM specifies flower meristem identity.

To further investigate whether the leafy phenotype is indeed a result of STM and AP1 interaction in the flower meristem, as can be interpreted from their shared expression domain during stage 2, we expressed amiR-STM/BP under the control of the FILAMENTOUS FLOWER (FIL) promoter and introduced it into the ap1-1 mutant. The FIL promoter allows genes to be exclusively expressed in the abaxial and marginal domains of emergent organ primordia (Siegfried et al., 1999; Goldshmidt et al., 2008). In agreement, ProFIL:amiR-YAB1 exhibited a phenotype equivalent to fil-8 yab3-2 double mutant plants, varifying ProFIL activity (Supplemental Figure 4). As expected, the meristematic competence of ProFIL:amiR-STM/BP flowers was not affected (Figure 3) as a result of functional STM in the flower meristem. In agreement with this finding, gynoecia developed normally. No enhancement of the ap1-1 phenotype was observed in ProFIL:amiR-STM/BP ap1-1 flowers (Figure 3D). This result suggests that STM and AP1 genetically interact specifically in the flower meristem to regulate its identity.

Figure 3.

Figure 3.

Open in a new tab

ProFIL:amiR-STM/BP Does Not Affect the Flower Phenotype of ap1-1.

(A) Ler inflorescence.

(B) ProFIL:amiR-STM/BP inflorescence. White arrow indicates normal silique.

(C) ap1-1 inflorescence.

(D) ProFIL:amiR-STM/BP ap1-1 inflorescence (left) and flower (right).

Bars = 1 mm.

STM Regulates Flower Identity Genes

To further understand the molecular mechanisms that mediate STM activity during the reproductive phase, we examined the transcriptional responses to STM induction and STM/BP downregulation in flowers. To this end, we extracted RNA from inflorescence meristems and developing flowers prior to anthesis in wild-type Ler, ap1-4, ProAP1>>amiR STM/BP ap1-4, Pro35S:STM-GR, and Ler after 5 h of mock treatment or STM induction with 10 µM dexamethasone (DEX). Our RNA-sequencing (RNA-seq) analysis identified 1963 differentially expressed genes in Pro35S:STM-GR plants upon DEX treatment compared with Pro35S:STM-GR mock treatment and Ler DEX treatment, representing genes responding to STM induction (Figure 4; Supplemental Data Set 1). Among the 1963 genes, the expression of 468 genes was also significantly altered in ProAP1>>amiR-STM/BP ap1-4 compared with ap1-4 plants (Figure 4A; Supplemental Data Set 1). Functional category analysis showed a significant enrichment for genes involved in responses to various hormones, including GA, CK, auxin, abscisic acid, and ethylene (Supplemental Data Set 2). Previous studies in Arabidopsis, rice, maize, and tomato (Solanum lycopersicum) have demonstrated an involvement of KNOXI proteins in the regulation of CK, GA, auxin, and brassinosteroid metabolism and/or responses (Jasinski et al., 2005; Yanai et al., 2005; Shani et al., 2010; Bolduc et al., 2012; Tsuda et al., 2014). In addition to an effect on these hormones pathways, our RNA-seq data identified a significant enrichment for genes involved in abscisic acid and ethylene responses, which have not previously been shown to be regulated by KNOXI proteins. Using the stringent list of 293 genes that significantly responded to STM induction and to STM/BP silencing but whose expression was not altered in ap1-4 compared with Ler (Figure 4A; Supplemental Data Set 1), the expression patterns were ordered hierarchically by Pearson correlation. A heat map of gene regulation patterns showed that many of these gene clusters exhibited opposite responses in the ProAP1>>amiR-STM/BP ap1-4 and Pro35S:STM-GR backgrounds (Figure 4B).

Figure 4.

Figure 4.

Open in a new tab

Regulators of the Floral Transition and Identity Respond to 5 h of STM Induction and stm Loss of Activity.

(A) Venn diagram presenting a comparison of the number of differentially expressed genes identified from flower-specific RNA-seq data on STM activation (Pro35S:STM-GR 5 h DEX induction versus Pro35S:STM-GR 5 h mock and Ler 5 h DEX) and STM and BP silencing (ProAP1>>amiR-STMP/BP ap1-4 versus ap1-4 and Ler).

(B) Hierarchical cluster analysis of the 293 genes differentially expressed in response to STM in the indicated samples. The numerical values were mapped into a blue-to-red gradient using the minimum and maximum value of each row independently.

(C) Hierarchical cluster analysis of known floral transition and identity genes that significantly respond to perturbation of STM activity.

D, Dex; M, mock; amiR-STMP/BP, ProAP1>>amiR-STMP/BP.

ProAP1>>amiR-STM/BP ap1-4 flowers exhibited characteristics of flower-to-shoot conversion, such as impaired whorled phyllotaxis and the complete loss of floral organ identity. In agreement with the results of our GUS reporter assays (Supplemental Figure 2), all B and C class genes, including AP3, PISTILLATA (PI), and AG, were downregulated in ProAP1>>amiR-STM/BP ap1-4 compared with ap1-4 (AP3 and PI downregulation was enhanced in comparison to ap1-4 versus Ler) (Figure 4C; Supplemental Table 2). This transcriptional profile, together with the flower meristem conversion phenotype, reinforces the hypothesis that STM and AP1 do not genetically interact to regulate the identity of a specific whorl, instead functioning in the earlier process of setting flower meristem identity. In line with this interpretation, several genes that affect flower meristem identity were differentially expressed in ProAP1>>amiR-STM/BP ap1-4 compared with ap1-4. Most notably are the flowering time genes SHORT VEGETATIVE PHASE (SVP) and AGAMOUS-LIKE24 (AGL24), the ectopic expression of which was shown to disrupt floral fate acquisition (Liu et al., 2007). Both SVP and AGL24 were upregulated in a similar manner in ProAP1>>amiR STM/BP ap1-4 compared with ap1-4, while only the expression of AGL24 was upregulated in ap1-4 compared with Ler (Figure 4C; Supplemental Table 2).

We next sought to examine whether genes that regulate floral identity processes were also affected by 5 h of STM induction in the wild-type background. Excluding BLADE ON PETIOLE2 (BOP2) and AG, none of the genes that were differentially expressed in ProAP1>>amiR-STM/BP ap1-4 compared with ap1-4 were also included among STM-responsive genes (Figure 4C; Supplemental Table 3). Further analysis indicated that BOP2 was upregulated in response to both STM induction and silencing and that the upregulation of AG upon STM induction was relatively minor. However, a significant number of floral transition, fate, and patterning genes responded to 5 h of STM induction. The floral transition genes FD and FD-PARALOG (FDP) were upregulated in a similar pattern, while SQUAMOSA PROMOTER BINDING PROTEIN-LIKE9 (SPL9) was downregulated (Figure 4C; Supplemental Table 3). Interestingly, the flower meristem identity genes AP1 and LFY were transcriptionally activated following 5 h of STM induction (Figure 4C; Supplemental Table 3). Notably, the expression level of the FT-FD target SUPPRESSOR OF OVEREXPRESSION CONSTANS1 (SOC1) and the SOC1 targets SPLs did not change, implying that the upregulation of LFY occurred in an FT-FD-independent manner. The ability of STM to affect both AP1 and LFY expression after 5 h of induction reinforces its requirement for floral fate acquisition and its synergistic genetic interaction with AP1. The F-box-encoding gene UFO, which regulates floral fate and patterning in a LFY-dependent manner (Lee et al., 1997), showed the strongest response to STM induction among the abovementioned genes.

STM and UFO Genetically Interact to Initiate the Floral Program

The strong response of UFO to STM induction in our RNA-seq experiment and in the subsequent qPCR assay (Supplemental Figure 5), both conducted on reproductive tissues (inflorescence meristems and floral buds prior to anthesis), is in line with STM-dependent UFO expression during embryogenesis (Long and Barton, 1998). These observations imply that STM is involved in the regulation of UFO expression throughout plant development. Throughout postembryonic development, UFO is expressed in a ring-like pattern surrounding the central zone of both vegetative and inflorescence meristems (Lee et al., 1997). Similar to STM, UFO expression in the flower meristem commences during early stage 2 of flower development (Lee et al., 1997; Samach et al., 1999). To examine the genetic interaction between STM and UFO, we introduced the ufo-2 loss-of-function allele into the intermediate stm-2 allele. The vegetative growth of stm-2 ufo-2 plants did not differ from that of stm-2 plants, and no enhancement of the stm-2 phenotype was observed (Supplemental Figure 6). In addition, Pro35S:UFO could not rescue the stm-1 seedling-stage arrested phenotype (Supplemental Figure 6A). ufo-2 plants have defects in flower meristem identity, as evidenced by a small increase in secondary inflorescences, flowers subtended by bracts or filaments, impaired whorled phyllotaxis, and later floral organ identity defects, with the conversion of petal and stamen identity (Levin and Meyerowitz, 1995) (Figure 5). Remarkably, stm-2 ufo-2 double mutant plants seldom developed flowers. Following bolting and internode elongation, these plants produced leaf-like organs that in some cases exhibited carpeloid features instead of flowers (Figure 5D).

Figure 5.

Figure 5.

Open in a new tab

stm-2 Genetically Interacts with ap1-4 and ufo-2 to Regulate Floral Fate Acquisition.

(A) stm-2 inflorescence.

(B) ufo-2 inflorescence. White arrow indicates a bract at the base of a ufo-2 flower.

(C) ap1-4 inflorescence.

(D) stm-2 ufo-2 double mutant inflorescences. Double mutant plants seldom produce flowers. White arrows indicate elongated petiole in terminal leaves. Red arrow indicates stigmatic papillae on top of the terminal leaves.

(E) stm-2 ap1-4 double mutant typical inflorescence (left), flower (middle), and inflorescence develops leaves only (right). Red arrows indicate impaired whorled phyllotaxy of trichome-bearing stamen. White arrow indicates stigmatic papillae on top of the terminal leaves.

(F) Magnified images of anthers of the indicated genotypes. The stm-2 ap1-4 double mutant shows trichome development from the abaxial epidermal layer of the anther (red arrows).

(G) ufo-2 ap1-4 double mutant inflorescence.

(H) stm-2 ufo-2 ap1-4 triple mutant inflorescences. Shown are a typical inflorescence (left) and an occasionally observed flower-producing inflorescence (right).

Bars = 1 mm for stereoscope images and 100 µm for scanning electron microscopy images.

In line with the enhancement of the ap1-4 meristem identity phenotype by ProAP1>>amiR-STM/BP and ProAP1>>amiR-STM, the ap1-4 phenotype was also enhanced by the intermediate stm-2 allele, although to a lesser extent. stm-2 ap1-4 plants occasionally showed a complete loss of the ability to produce flowers (Figure 5E). More frequently, these plants formed flowers with leafy organs. For example, 21% of the flowers examined exhibited leafy stamens characterized by the formation of trichomes (satellite and simple) from the abaxial anther surface (Figure 5F). The milder phenotype of stm-2 ap1-4 in comparison to ProAP1>>amiR-STM/BP ap1-4 is expected due to the intermediate nature of the stm-2 allele. The phenotype of stm-2 ufo-2 ap1-4 triple mutants was significantly enhanced compared with that of ufo-2 ap1-4 with respect to the ability to generate flowers (Figure 5H). The few flowers that did develop were reminiscent of the leafy flowers produced by ProAP1>>amiR-STM/BP ap1-4. Therefore, STM genetically interacts with UFO and AP1 to initiate the floral program.

Ectopic Expression of UFO Is Sufficient to Restore Floral Identity in ProAP1>>amiR-STM/BP ap1 Flowers

UFO showed a significant transcriptional upregulation in response to STM activation coupled with phenotypic enhancement of stm-2 in stm-2 ufo-2 double mutant plants. We therefore sought to investigate whether ectopic expression of UFO is sufficient to rescue the floral identity aspects of ProAP1>>amiR-STM/BP ap1 flowers. To this end, we generated ProAP1>>amiR-STM/BP ap1-4 Pro35S:UFO and ProAP1>>amiR-STM/BP,UFO ap1 plants. Two phenotypically different independent Pro35S:UFO ap1-4 lines were used. Pro35S:UFOline#1 ap1-4 rescued petal formation and suppressed the secondary flowers of ap1-4 (Figure 6). Pro35S:UFOline#2 ap1-4 flowers were composed of one to two leaf-like organs and multiple, mostly sterile, stamens (Figure 6F). Remarkably, petal identity was fully restored in ProAP1>>amiR-STM/BP ap1-4 Pro35S:UFO for both lines 1 and 2 (Figure 6G). In ProAP1>>UFO ap1-1 flowers, the typical ap1-1 bracts were converted into sepal-like organs or petals, and similar to Pro35S:UFOline#1 ap1-4, petals were rescued in the second whorl. ProAP1>>UFO ap1-1 flowers were indeterminate, which is similar to ap1-1 flowers (Figure 6H). Strikingly, both petal and stamen identity were correctly specified in most examined ProAP1>>amiR-STM/BP,UFO ap1 flowers (Figure 6I, Table 1). Scanning electron microscopy analysis of floral buds indicated that ProAP1>>UFO also rescued the whorled organization of floral organs, in contrast to the spiral-like pattern of ProAP1>>amiR-STM/BP ap1-4 (Figure 6J). However, unlike ProAP1>>UFO ap1-1, petals or petaloid organs did not develop in the first whorl of ProAP1>>amiR-STM/BP,UFO ap1 flowers. Notably, like ProAP1>>amiR-STM/BP, ProAP1>>amiR-STM/BP,UFO ap1 flowers did not form carpels and had a bp-like inflorescence architecture. Hence, coexpression of UFO and amiR-STM/BP driven by the AP1 promoter in the ap1 background neutralized the typical loss of floral identity of ProAP1>>amiR-STM/BP ap1. Together, these observations strongly support a role for UFO in mediating STM activity in flower meristem identity.

Figure 6.

Figure 6.

Open in a new tab

UFO Rescues ProAP1>>amiR-STM/BP ap1 Floral Identity.

(A) to (I) Inflorescences (left) and flowers (right) of the indicated genotypes. Pro35S:UFO ap1-4 lines in (E) and (F) are in the ProAP1:LhG4 background. White arrow in (F) indicates secondary flower composed of sterile stamens only.

(J) Scanning electron microscopy analysis of floral buds of the indicated genotypes. Red arrows indicate stamen primordia initiating in a whorled phyllotaxy compared with the nonwhorled pattern in ProAP1>>amiR-STM/BP ap1-4. In (I) and (J), UFO and amiR-STM/BP are driven by the ProAP1>>Op:LhG4 system and plants are biallelic to ap1 (ap1-4/ap1-1).

Bars = 1 mm for stereoscope images and 20 µm for scanning electron microscopy images.

Table 1. UFO Rescues ProAP1>>amiR STM/BP ap1-4 Floral Identity.

Floral Organ ProAP1>>amiR-STM/BP ProAP1>>amiR-STM/BP ap1-4 ProAP1>>amiR-STM/BP,UFO ap1
Sepal 4 – –
Leaf – 6.82 2.92
Petal 1.75 – 1.66
Leaf-petal (F) – 0.08 1.85
Stamen 2.45 0.02 4
Stamen-petal (F) – – 0.16
Stamen-carpel (F) – 0.02 0.41
Carpel – – 0.166
Carpeloid organ – 0.5 –
Stamenoid organ – 0.1 –
n 20 50 13
Open in a new tab

The mean number of floral organs is indicated for each genotype. F, fused.

DISCUSSION

Previous studies of STM function primarily focused on its role in the maintenance of the SAM, as null loss-of-function alleles are seedling lethal. Hypomorphic loss-of-function alleles suggest a similar role for this KNOXI transcription factor in the inflorescence and flower meristem (Clark et al., 1996; Endrizzi et al., 1996). The potential role of STM in other processes was largely unknown due to the severe phenotypes of loss-of-function mutants. Aiming to investigate the requirement for STM specifically in flower meristem development, we undertook an approach limiting the reduction of STM function to specific stages of flower development.

STM and AP1 Synergistically Regulate Flower Meristem Identity

Following the initial outgrowth of floral primordia, STM expression reappears in a pattern reminiscent of its expression in the SAM (Long et al., 1996). Concomitant with the establishment of meristematic competence of the flower meristem, its identity as a flower is specified, raising the possibility that STM might be involved in both developmental processes. Using amiRs targeting STM in the AP1 expression domain in the ap1-4 background revealed a role for STM in flower meristem specification. The intermediate stm-2 allele enhanced the phenotype of ap1-4, with the double mutant exhibiting characteristics of flower-to-shoot conversion, a phenotype also observed when STM/BP activity was reduced specifically in flower meristems in ProAP1>>amiR-STM/BP plants. Remarkably, a significant rescue was detected when UFO was ectopically expressed in ProAP1>>amiR-STM/BP ap1 plants, in line with the significant response of UFO to STM induction. UFO was reported to act in a LFY-dependent manner (Levin and Meyerowitz, 1995; Lee et al., 1997; Chae et al., 2008; Risseeuw et al., 2013), suggesting that the rescue of ProAP1>>amiR-STM/BP ap1-4 by UFO may require LFY activity. It was hypothesized that a UFO-LFY interaction provides spatial specificity for LFY, as well as increasing its activity via a turnover enhancement mechanism (Parcy et al., 1998; Chae et al., 2008). It is therefore possible that the ectopic expression of UFO is required for LFY activity, and/or increases its turnover, in rescuing the ProAP1>>amiR-STM/BP ap1-4 flowers. Since both UFO and LFY responded to STM induction, their spatial expression patterns in ProAP1>>amiR-STM/BP ap1-4 stage 2 flowers should be examined.

The Contribution of STM to Floral Fate Might Not Be Restricted to Floral Primordia

The reproductive phase initiates when lateral shoots adopt a floral fate as flower primordia following the flowering transition. During the transition to flowering, integrators such as the FT-FD complex, SOC1, AGL24, and SPLs promote the floral fate of lateral primordia via transcriptional activation of flower meristem identity genes (Abe et al., 2005; Wigge et al., 2005; Lee et al., 2008; Liu et al., 2008; Wang et al., 2009; Yamaguchi et al., 2009).

Aiming to reproduce the ProAP1>>amiR-STM/BP ap1-4 phenotype using stable alleles, as well as to study stm ufo interactions, we constructed combinations of the stm-2, ap1-4, and ufo-2 alleles. Inflorescences consisting only of leaf-like organs, occasionally carpeloid, were observed in stm-2 ufo-2 plants and to some extent also in stm-2 ap1-4 plants. This indicates that STM may be important for the acquisition of floral fate prior to the establishment of the flower meristem, in line with the phenotypes of stm-10 ft/fd double mutant plants (Smith et al., 2011). This raises the question whether STM acts exclusively from the flower primordia or also from the inflorescence meristem to enable a proper floral transition. The STM expression pattern may reinforce the latter notion, as it is downregulated in stages 0 to 1 of flower development, when the expression of flower meristem identity genes such as LFY, AP1, and CAULIFLOWER are first detected. Dissecting the activity of STM at specific stages of inflorescence development requires further investigation.

How Does STM Acquire Different Activities in Distinct Apical Meristems?

Our work, together with the observation of stm-10 interactions with ft/fd mutants (Smith et al., 2011), indicates an involvement of STM in additional developmental processes, apart from stem cell niche maintenance. How does STM function in distinct activities at different developmental stages and in different apical meristems? KNOX family proteins interact with another group of TALE proteins, the BELL proteins (Hay and Tsiantis, 2010). STM activity in SAM maintenance is in part mediated by the BELL cofactor PNY (Byrne et al., 2003), with STM-PNY interactions affecting the nuclear localization of STM (Cole et al., 2006). PNY, together with its homolog PNF, promotes the floral transition, with pny pnf double mutants failing to develop a proper inflorescence and lacking flowers despite SOC1 expression in the shoot apex (Smith et al., 2004). Similarly, pny mutations enhance lfy mutant alleles, with the double mutants defective in conferring floral fate to lateral shoots initiating from the inflorescence meristem (Kanrar et al., 2008) and pny pnf/+lfy-10 plants developing flowers consisting of only sepal-like organs (Yu et al., 2009). It was reported that PNY affects the floral transition via direct downregulation of BOP genes in lateral primordia, thus allowing for transcriptional activation of AP1 by the FT-FD complex (Andres et al., 2015). However, our RNA-seq data show an opposite trend, with BOP2 upregulated more than 4-fold in response to STM induction (Supplemental Table 3). This is unexpected if a “classic” STM-PNY complex acts in this process. Further investigation is required to understand the importance of the STM-PNY interaction throughout plant development. One approach would be to compare the rapid transcriptional responses to STM at the tissue or cell-type level between different backgrounds such as the wild type, pny, and pny pnf. These assays might help to unravel the BELL-dependent activities of STM. Nevertheless, even if the STM-PNY complex is assembled to regulate different developmental processes, the question of how this complex acquires tissue specificity remains. STM might assemble specialized BELL complexes for distinct activities, or alternatively, STM-BELL might form a constant complex that could interact with third-party proteins in different developmental contexts and cell types.

METHODS

Plant Materials

All Arabidopsis thaliana lines are in the Ler background. Arabidopsis plants were grown under long-day fluorescent light conditions (16 h light per day, 21°C, 150–200 μE m−2 s−1 light intensity; Philips Lighting F17T8/TL841/PLUS/ALTO 30PK for growth chambers and Philips Lighting TL RS 40W/54-765 1SL/25 for growth rooms). Transactivation manipulations were produced using the LhG4 transactivation system (Moore et al., 1998). In this system, driver lines express the synthetic transcription factor LhG4 in a promoter-specific manner (Pro:LhG4). The responder line was generated by introducing a gene of interest under the control of 10 copies of the Escherichia coli operator that is recognized by LhG4 (Op:GENE). The following Arabidopsis lines were previously described: ProSTM:LhG4 (Yanai et al., 2005), ProAP1:LhG4 (Goldshmidt et al., 2008), and Pro35S:STM-GR (Gallois et al., 2002). ProCLV3:YFP-ER seeds were a gift from Matthew Tucker (University of Adelaide, Australia). Two ap1 alleles were used in this study, ap1-1 and ap1-4, which are strong and intermediate alleles, respectively (Irish and Sussex, 1990; Bowman et al., 1993). All ap1-related lines are homozygous to ap1-1 or ap1-4, as indicated for each experiment, with the exception of ProAP1>>amiR-STM/BP, UFO ap1, which is biallelic (ap1-1/ap1-4).

Cloning and Plant Transformation

Op:amiR-STM/BP was designed in the miR 164b backbone and cloned as described previously (Alvarez et al., 2006). Briefly, the amiR-STM/BP was synthesized and inserted into a BlueScript vector. After sequence verification, the amiR-STM/BP fragment was cloned behind an OP array (10OP-TATA-BJ36) using the XhoI and BamHI restriction enzymes in the BJ36 plasmid to generate a responder line and transferred into the binary pMLBART vector using the NotI restriction enzyme. Arabidopsis transgenic lines were generated by the floral dip method (Clough and Bent, 1998), and BASTA-resistant transformants were selected on soil. The amiR-STM/BP in miR 164b backbone sequence is as follows, with XhoI and BamHI sites underlined, and STM and BP target sequences in bold: CTCGAGGAGAATGATGAAGGTGTGTGATGAGCAAGATGTAGTGAGGATGAGCCATGATTACTAGCTCATATATACACTCTCACCACAAATGCGTGTATATATGCGGAATTTTGTGATATAGATGTGTGTGTGTGTTGAGTGTGATGATATGGATGAGTTAGTTCTAATGGCTCAAACTCACAACATCATGACCACTCCACCTTGGTGACGATGACGACGAGGGTTCAAGTGTTACGCACGTGGGAATATACTTATATCGATAAACACACACGTGCGGGATCC.

The amiR-STM (WMD3 algorithm, http://wmd3.weigelworld.org/cgi-bin/webapp.cgi) was designed in the miR319a backbone and cloned using the Gateway recombination system (Invitrogen). The following sequence in which amiR-STM is flanked by L1 and L2 sites was synthesized and cloned into the pUC57 vector. Next, LR reaction was performed to a 10OP destination vector to create Op:amiR-STM. Resistant transformants were selected on Murashige and Skoog medium plates containing 50 µg/mL kanamycin. The amiR-STM in miR 319a sequence is as follows, with L1 and L2 sites underlined, and STM target sequence in bold: CAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCAAACACACGCTCGGACGCATATTACACATGTTCATACACTTAATACTCGCTGTTTTGAATTGATGTTTTAGGAATATATATGTAGATGACCGCTTATGTGAATTGTTTCACAGGTCGTGATATGATTCAATTAGCTTCCGACTCATTCATCCAAATACCGAGTCGCCAAAATTCAAACTAGACTCGTTAAATGAATGAATGATGCGGTAGACAAATTGGATCATTGATTCTCTTTGATACAATTGACATAAGCGGCCATCTCTCTTTTGTATTCCAATTTTCTTGATTAATCTTTCCTGCACAAAAACATGCTTGATCCACTAAGTGACATATATGCTGCCTTCGTATATATAGTTCTGGTAAAATTAACATTTTGGGTTTATCTTTATTTAAGGCATCGCCATGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTG.

The ProFIL:amiR-STM/BP and ProFIL:amiR-YAB1 lines were constructed using the Gateway recombination system (Invitrogen). A 7-kb promoter fragment up to, but not including, the ATG translation start site of FIL was introduced into a pDONR vector and used to construct the pMB7pFILm21GW, a multisite Gateway destination vector with promoter (ProFIL) and the ccdB gene between R2 and R1 sites modified from pB7m34GW (Karimi et al., 2007). Primers are as follows: ProFIL F_attB4, 5′-GGGGACAACTTTGTATAGAAAAGTTGCATCAAAGATCCACCCATGTGAC-3′; ProFIL R_attB1, 5′-GGGGACTGCTTTTTTGTACAAACTTGCTTTTTTGTAAGAAGGGGAAA AATATTGGAAG.

The amiR-STM/BP and amiR-YAB1 were PCR amplified with adjoined attB1 and attB2 adapter sequences and introduced into the pENTR2B vectors to create entry clones with the fragments flanked by L1 and L2 sites to be recombined into pMB7pFILm21GW. Transformants were selected on soil on based on resistance to 0.1% of the herbicide BASTA. ProFIL:amiR-STM/BP was transformed into wild-type Ler and ap1-1 mutants plants. In nearly all Ler (19/21) and ap1-1 (11/12) T1 plants, there was no overt phenotype, except for some Ler plants where floral organ fusion was observed and less compound flower development was apparent in some ap1-1 flowers. Nearly all ProFIL:amiR-YAB1 Ler T1 transformants (15/17) exhibited a phenotype equivalent to that of fil-8 yab3-2 double mutant plants (Supplemental Figure 4).

To generate Pro35S:UFO, UFO cDNA was amplified using the primers 5′-CACCATGGATTCAACTGTGTTCATC-3′ (forward primer) and 5′-GCAGTCTTAACGTCAGAAGTG-3′ (reverse primer). The CACC sequence (underlined) was added upstream of the ATG in the forward primer for the first step of cloning into the pENTR/D-TOPO vector (Invitrogen). The LR recombination reaction was carried introduce the sequence into the pH2GW7 destination vector (Karimi et al., 2002). Resistant transformants were selected on Murashige and Skoog medium plates containing 25 µg/mL hygromycin. All Arabidopsis transgenic lines were generated by the floral dip method (Clough and Bent, 1998), using the Agrobacterium tumefaciens GV3101 strain,

To generate Op:UFO, UFO cDNA was amplified using the primers 5′- AAGTCGACATGGATTCAACTGTGTTCATCAATAACC-3′ (forward primer) and 5′-TTTCTAGACTAACAGACTCCAGGAAATGGAAGTG-3′ (reverse primer) and cloned into the pSC vector (StrataClone) before being subcloned behind an operator array. The OP constructs were subcloned into the binary pMLBART vector using the NotI restriction enzyme.

Genetics

Transactivated lines were created by crossing driver and responder lines. In cases of self-infertility, transactivated lines were phenotypically analyzed in the F1 generation. For instance, AP1>>amiR-STM/BP ap1-4 was generated by introducing ProAP1:LhG4 and Op:amiR-STM/BP separately into the ap1-4 background (kanamycin and BASTA selection, respectively). Homozygous lines were crossed to produce F1 plants. Primers used for plants genotyping are described in Supplemental Table 4.

Scanning Electron Microscopy

Samples were fixed in 2.5% glutaraldehyde in phosphate buffer saline and dehydrated by successive ethanol treatments. After critical point drying (Balzer’s critical point drier), the samples were mounted on aluminum stubs and sputter-coated (SC7620; Quorum) with gold. Images were captured using a Jeol JCM-6000 scanning electron microscope.

DEX Treatment

STM activity was induced by 10 µM DEX (Sigma-Aldrich) application by spraying. The DEX solutions contained 0.02% Silwet-L-77.

RNA-Seq

Each biological replicate was collected from the first three inflorescence meristems of five different plants. The phenotype of ProAP1>>amiR-STM/BP ap1-4 collected for RNA-seq was significantly silenced compared with the strong phenotype from the first generations. RNA extraction was performed using a Qiagen RNeasy plant mini kit, and the samples were treated with Turbo DNase (Ambion). Libraries were prepared from 2 μg of total RNA using a TruSeq kit (Illumina) and sequenced on an Illumina NextSeq 500. We obtained between 21.1 and 29.9 million 75-bp single-end reads per library (average of 25.5 million). Reads were aligned to the Arabidopsis reference sequence TAIR10 (https://www.arabidopsis.org/download_files/Genes/TAIR10_genome_release/TAIR10_chromosome_files/TAIR10_chr_all.fas) using TopHat v2.0.6 (Kim et al., 2013). An average of 93.8% reads was uniquely aligned to the reference genome. Reads were attributed to genes using HTseq v0.62 (Anders et al., 2015). Sample normalization was performed based on sample size. Differential expression was analyzed using DEseq2 (Love et al., 2014; Supplemental Data Set 3). One of the amiRNA STM/BP ap1-4 samples was removed after PCA (a 2D PCA) analysis since the variation components showed a great difference between replicates (Supplemental Figure 7). Heat maps were generated using GENE (https://software.broadinstitute.org/GENE-E/) and Gene Ontology analysis was performed using the GO databases (http://geneontology.org).

Histochemical GUS Staining

GUS assays were performed as previously described (Jefferson et al., 1987) with minor modifications. Plant tissues were incubated for ∼16 h at 37°C in 100 mM sodium phosphate buffer (pH 7.0) containing 0.1% Triton X-100, 1 mM 5-bromo-4-chloro-3-indolyl-β-d-glucuronic acid cyclohexylammonium salt (X-gluc; Sigma-Aldrich), 2 mM potassium ferricyanide, and 2 mM potassium ferrocyanide. Tissues were immersed in 70% ethanol until transparent. GUS-stained tissues were examined and imaged using a Zeiss Stemi 2000-C with ZEN software (Zeiss imaging software). GUS staining for all experiments was repeated at least twice.

Quantitative RT-PCR

RNA was isolated from the indicated plant materials using an RNeasy Plant Mini Kit. The samples were treated with Turbo DNase (Ambion). RNA was converted into cDNA using a high capacity cDNA reverse transcription kit (ABI). Quantitative RT-PCR was performed with Fast SYBR Green Master Mix (ABI 4385612) using the Step One Plus System and software (ABI). The reaction conditions included 40 amplification cycles (3 s at 95°C; 30 s at 60°C). Three technical replicates were performed for each cDNA sample, and three biological repeats (separate biological material) were used for each treatment. The relative quantification was calculated with the ΔΔCt method using PP2A (encoding protein phosphatase 2A subunit A2) as the reference gene. Primers are listed in Supplemental Table 4.

Statistical Analysis

Student’s t tests were performed whenever two groups were compared and are described for each figure. Statistical significance was determined at the indicated P values.

Phenotypic Analyses

Seedlings, inflorescences and flowers were imaged with Zeiss Stemi 2000-C stereomicroscope. For meristem size measurements, flower meristems were imaged by scanning electron microscopy and measured using ImageJ software (http://rsbweb.nih.gov/ij/index.html).

Confocal Imaging and Image Analysis

Flower imaging procedure was conducted based on Prunet et al. (2016), with optimization for inverted confocal microscopy (Zeiss LSM 780). Following propidium iodide staining, the samples were transferred to a glass-bottom culture dish (Greiner; item number 627860) containing 0.2% agar and immediately imaged. Fluorescence intensity quantification was carried on the confocal stack that presented the strongest signal for each flower using ZEN blue software.

Accession Numbers

Raw data from the RNA-seq experiment have been deposited in NCBI under accession number GSE113894. Sequence data from this article can be found in the Arabidopsis TAIR database (www.arabidopsis.org) under the following accession numbers: STM (AT1G62360), BP (AT4G08150), AP1 (AT1G69120), and UFO (AT1G30950).

Supplemental Data

Acknowledgments

We thank Yuval Eshed (Weizmann Institute of Science) for critically reading the article and for helpful suggestions. This work was supported by grants from the Israel Science Foundation (1832/14 and 596/17 to E.S.), the German Israeli Foundation for Scientific Research and Development (I-236-203.17-2014 to E.S.), the Human Frontier Science Program (HFSP-RGY0075/2015 to E.S.), and European Research Council Starting Grants (757683- RobustHormoneTrans to E.S.).

AUTHOR CONTRIBUTIONS

O.R., J.P.A., J.L.B, N.O., and E.S. designed the research. O.R., J.P.A., and E.S. performed the research. M.L. analyzed the RNA-seq data. O.R., J.P.A., J.L.B, N.O., and E.S. wrote the manuscript.

Footnotes

[OPEN]

Articles can be viewed without a subscription.

References

  1. Abe M., Kobayashi Y., Yamamoto S., Daimon Y., Yamaguchi A., Ikeda Y., Ichinoki H., Notaguchi M., Goto K., Araki T. (2005). FD, a bZIP protein mediating signals from the floral pathway integrator FT at the shoot apex. Science 309: 1052–1056. [DOI] [PubMed] [Google Scholar]
  2. Alvarez J.P., Pekker I., Goldshmidt A., Blum E., Amsellem Z., Eshed Y. (2006). Endogenous and synthetic microRNAs stimulate simultaneous, efficient, and localized regulation of multiple targets in diverse species. Plant Cell 18: 1134–1151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Anders S., Pyl P.T., Huber W. (2015). HTSeq--a Python framework to work with high-throughput sequencing data. Bioinformatics 31: 166–169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Andres F., Romera-Branchat M., Martínez-Gallegos R., Patel V., Schneeberger K., Jang S., Altmüller J., Nürnberg P., Coupland G. (2015). Floral induction in Arabidopsis thaliana by FLOWERING LOCUS T requires direct repression of BLADE-ON-PETIOLE genes by homeodomain protein PENNYWISE. Plant Physiol. 169: 2187–2199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Andrés F., Coupland G. (2012). The genetic basis of flowering responses to seasonal cues. Nature Rev. Genet. 13: 627–639. [DOI] [PubMed] [Google Scholar]
  6. Barton M.K., Poethig R.S. (1993). Formation of the shoot apical meristem in Arabidopsis thaliana: An analysis of development in the wild type and in the shoot meristemless mutant. Development 119: 823–831. [Google Scholar]
  7. Bolduc N., Yilmaz A., Mejia-Guerra M.K., Morohashi K., O’Connor D., Grotewold E., Hake S. (2012). Unraveling the KNOTTED1 regulatory network in maize meristems. Genes Dev. 26: 1685–1690. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Bowman J.L., Smyth D.R., Meyerowitz E.M. (1991). Genetic interactions among floral homeotic genes of Arabidopsis. Development 112: 1–20. [DOI] [PubMed] [Google Scholar]
  9. Bowman J.L., Alvarez J., Weigel D., Meyerowitz E.M., Smyth D.R. (1993). Control of flower development in Arabidopsis thaliana by APETALA1 and interacting genes. Development 119: 721–743. [Google Scholar]
  10. Byrne M.E., Simorowski J., Martienssen R.A. (2002). ASYMMETRIC LEAVES1 reveals knox gene redundancy in Arabidopsis. Development 129: 1957–1965. [DOI] [PubMed] [Google Scholar]
  11. Byrne M.E., Groover A.T., Fontana J.R., Martienssen R.A. (2003). Phyllotactic pattern and stem cell fate are determined by the Arabidopsis homeobox gene BELLRINGER. Development 130: 3941–3950. [DOI] [PubMed] [Google Scholar]
  12. Chae E., Tan Q.K.-G., Hill T.A., Irish V.F. (2008). An Arabidopsis F-box protein acts as a transcriptional co-factor to regulate floral development. Development 135: 1235–1245. [DOI] [PubMed] [Google Scholar]
  13. Clark S.E., Running M.P., Meyerowitz E.M. (1995). CLAVATA3 is a specific regulator of shoot and floral meristem development affecting the same processes as CLAVATA1. Development 121: 2057–2067. [Google Scholar]
  14. Clark S.E., Jacobsen S.E., Levin J.Z., Meyerowitz E.M. (1996). The CLAVATA and SHOOT MERISTEMLESS loci competitively regulate meristem activity in Arabidopsis. Development 122: 1567–1575. [DOI] [PubMed] [Google Scholar]
  15. Clough S.J., Bent A.F. (1998). Floral dip: a simplified method for Agrobacterium‐mediated transformation of Arabidopsis thaliana. Plant J. 16: 735–743. [DOI] [PubMed] [Google Scholar]
  16. Cole M., Nolte C., Werr W. (2006). Nuclear import of the transcription factor SHOOT MERISTEMLESS depends on heterodimerization with BLH proteins expressed in discrete sub-domains of the shoot apical meristem of Arabidopsis thaliana. Nucleic Acids Res. 34: 1281–1292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Ditta G., Pinyopich A., Robles P., Pelaz S., Yanofsky M.F. (2004). The SEP4 gene of Arabidopsis thaliana functions in floral organ and meristem identity. Current Biol. 14: 1935–1940. [DOI] [PubMed] [Google Scholar]
  18. Endrizzi K., Moussian B., Haecker A., Levin J.Z., Laux T. (1996). The SHOOT MERISTEMLESS gene is required for maintenance of undifferentiated cells in Arabidopsis shoot and floral meristems and acts at a different regulatory level than the meristem genes WUSCHEL and ZWILLE. Plant J. 10: 967–979. [DOI] [PubMed] [Google Scholar]
  19. Gallois J.L., Woodward C., Reddy G.V., Sablowski R. (2002). Combined SHOOT MERISTEMLESS and WUSCHEL trigger ectopic organogenesis in Arabidopsis. Development 129: 3207–3217. [DOI] [PubMed] [Google Scholar]
  20. Goldshmidt A., Alvarez J.P., Bowman J.L., Eshed Y. (2008). Signals derived from YABBY gene activities in organ primordia regulate growth and partitioning of Arabidopsis shoot apical meristems. Plant Cell 20: 1217–1230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Gustafson-Brown C., Savidge B., Yanofsky M.F. (1994). Regulation of the Arabidopsis floral homeotic gene APETALA1. Cell 76: 131–143. [DOI] [PubMed] [Google Scholar]
  22. Hay A., Tsiantis M. (2010). KNOX genes: versatile regulators of plant development and diversity. Development 137: 3153–3165. [DOI] [PubMed] [Google Scholar]
  23. Honma T., Goto K. (2001). Complexes of MADS-box proteins are sufficient to convert leaves into floral organs. Nature 409: 525–529. [DOI] [PubMed] [Google Scholar]
  24. Huala E., Sussex I.M. (1992). LEAFY interacts with floral homeotic genes to regulate Arabidopsis floral development. Plant Cell 4: 901–913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Hyun Y., Richter R., Coupland G. (2017). Competence to flower: age-controlled sensitivity to environmental cues. Plant Physiol. 173: 36–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Irish V.F., Sussex I.M. (1990). Function of the Apetala-1 gene during Arabidopsis floral development. Plant Cell 2: 741–753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Jasinski S., Piazza P., Craft J., Hay A., Woolley L., Rieu I., Phillips A., Hedden P., Tsiantis M. (2005). KNOX action in Arabidopsis is mediated by coordinate regulation of cytokinin and gibberellin activities. Curr. Biol. 15: 1560–1565. [DOI] [PubMed] [Google Scholar]
  28. Jefferson R.A., Kavanagh T.A., Bevan M.W. (1987). GUS fusions: Beta‐glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6: 3901–3907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kanrar S., Onguka O., Smith H.M.S. (2006). Arabidopsis inflorescence architecture requires the activities of KNOX-BELL homeodomain heterodimers. Planta 224: 1163–1173. [DOI] [PubMed] [Google Scholar]
  30. Kanrar S., Bhattacharya M., Arthur B., Courtier J., Smith H.M. (2008). Regulatory networks that function to specify flower meristems require the function of homeobox genes PENNYWISE and POUND-FOOLISH in Arabidopsis. Plant J. 54: 924–937. [DOI] [PubMed] [Google Scholar]
  31. Karimi M., Inzé D., Depicker A. (2002). GATEWAY vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci. 7: 193–195. [DOI] [PubMed] [Google Scholar]
  32. Karimi M., Bleys A., Vanderhaeghen R., Hilson P. (2007). Building blocks for plant gene assembly. Plant Physiol. 145: 1183–1191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Kerstetter R.A., Laudencia-Chingcuanco D., Smith L.G., Hake S. (1997). Loss-of-function mutations in the maize homeobox gene, knotted1, are defective in shoot meristem maintenance. Development 124: 3045–3054. [DOI] [PubMed] [Google Scholar]
  34. Kim D., Pertea G., Trapnell C., Pimentel H., Kelley R., Salzberg S.L. (2013). TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 14: R36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Lee I., Wolfe D.S., Nilsson O., Weigel D. (1997). A LEAFY co-regulator encoded by UNUSUAL FLORAL ORGANS. Curr. Biol. 7: 95–104. [DOI] [PubMed] [Google Scholar]
  36. Lee J., Oh M., Park H., Lee I. (2008). SOC1 translocated to the nucleus by interaction with AGL24 directly regulates leafy. Plant J. 55: 832–843. [DOI] [PubMed] [Google Scholar]
  37. Levin J.Z., Meyerowitz E.M. (1995). UFO: An Arabidopsis gene involved in both floral meristem and floral organ development. Plant Cell 7: 529–548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Lincoln C., Long J., Yamaguchi J., Serikawa K., Hake S. (1994). A knotted1-like homeobox gene in Arabidopsis is expressed in the vegetative meristem and dramatically alters leaf morphology when overexpressed in transgenic plants. Plant Cell 6: 1859–1876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Liu C., Zhou J., Bracha-Drori K., Yalovsky S., Ito T., Yu H. (2007). Specification of Arabidopsis floral meristem identity by repression of flowering time genes. Development 134: 1901–1910. [DOI] [PubMed] [Google Scholar]
  40. Liu Chang, Chen H., Ling Er H., Soo H.M., Kumar P.P., Han J.-H., Liou Y.C., Yu H. (2008). Direct interaction of AGL24 and SOC1 integrates flowering signals in Arabidopsis. Development 135: 1481–1491. [DOI] [PubMed] [Google Scholar]
  41. Long J.A., Barton M.K. (1998). The development of apical embryonic pattern in Arabidopsis. Development 125: 3027–3035. [DOI] [PubMed] [Google Scholar]
  42. Long J., Barton M.K. (2000). Initiation of axillary and floral meristems in Arabidopsis. Dev. Biol. 218: 341–353. [DOI] [PubMed] [Google Scholar]
  43. Long J.A., Moan E.I., Medford J.I., Barton M.K. (1996). A Member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379: 66. [DOI] [PubMed] [Google Scholar]
  44. Love M.I., Huber W., Anders S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15: 550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Mandel M.A., Gustafson-Brown C., Savidge B., Yanofsky M.F. (1992). Molecular characterization of the Arabidopsis floral homeotic gene APETALA1. Nature 360: 273–277. [DOI] [PubMed] [Google Scholar]
  46. Moore I., Gälweiler L., Grosskopf D., Schell J., Palme K. (1998). A transcription activation system for regulated gene expression in transgenic plants. Proc. Natl. Acad. Sci. USA 95: 376–381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Parcy F., Nilsson O., Busch M.A., Lee I., Weigel D. (1998). A genetic framework for floral patterning. Nature 395: 561–566. [DOI] [PubMed] [Google Scholar]
  48. Pelaz S., Ditta G.S., Baumann E., Wisman E., Yanofsky M.F. (2000). B and C floral organ identity functions require SEPALLATA MADS-box genes. Nature 405: 200–203. [DOI] [PubMed] [Google Scholar]
  49. Prunet N., Jack T.P., Meyerowitz E.M. (2016). Live confocal imaging of Arabidopsis flower buds. J. Dev. Biol. 419: 114–120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Risseeuw E., Venglat P., Xiang D., Komendant K., Daskalchuk T., Babic V., Crosby W., Datla R. (2013). An activated form of UFO alters leaf development and produces ectopic floral and inflorescence meristems. PLoS One 8: e83807. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Samach A., Klenz J.E., Kohalmi S.E., Risseeuw E., Haughn G.W., Crosby W.L. (1999). The UNUSUAL FLORAL ORGANS gene of Arabidopsis thaliana is an F-box protein required for normal patterning and growth in the floral meristem. Plant J. 20: 433–445. [DOI] [PubMed] [Google Scholar]
  52. Schultz E.A., Haughn G.W. (1991). LEAFY, a homeotic gene that regulates inflorescence development in Arabidopsis. Plant Cell 3: 771–781. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Scofield S., Dewitte W., Murray J.A. (2007). The KNOX gene SHOOT MERISTEMLESS is required for the development of reproductive meristematic tissues in Arabidopsis. Plant J. 50: 767–781. [DOI] [PubMed] [Google Scholar]
  54. Shani E., Burko Y., Ben-Yaakov L., Berger Y., Amsellem Z., Goldshmidt A., Sharon E., Ori N. (2009). Stage-specific regulation of Solanum lycopersicum leaf maturation by Class 1 KNOTTED1-LIKE HOMEOBOX proteins. Plant Cell 21: 3078–3092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Shani E., Ben-Gera H., Shleizer-Burko S., Burko Y., Weiss D., Ori N. (2010). Cytokinin regulates compound leaf development in tomato. Plant Cell 22: 3206–3217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Siegfried K.R., Eshed Y., Baum S.F., Otsuga D., Drews G.N., Bowman J.L. (1999). Members of the YABBY gene family specify abaxial cell fate in Arabidopsis. Development 126: 4117–4128. [DOI] [PubMed] [Google Scholar]
  57. Smaczniak C., Immink R.G.H., Muiño J.M., Blanvillain R., Busscher M., Busscher-Lange J., Dinh Q.D.P., Liu S., Westphal A.H., Boeren S. (2012). Characterization of MADS-domain transcription factor complexes in Arabidopsis flower development. Proc. Natl. Acad. Sci. USA 109: 1560–1565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Smith H.M.S., Hake S. (2003). The interaction of two homeobox genes, BREVIPEDICELLUS and PENNYWISE, regulates internode patterning in the Arabidopsis inflorescence. Plant Cell 15: 1717–1727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Smith H.M.S., Campbell B.C., Hake S. (2004). Competence to respond to floral inductive signals requires the homeobox genes PENNYWISE and POUND-FOOLISH. Curr. Biol. 14: 812–817. [DOI] [PubMed] [Google Scholar]
  60. Smith H.M.S., Ung N., Lal S., Courtier J. (2011). Specification of reproductive meristems requires the combined function of SHOOT MERISTEMLESS and floral integrators FLOWERING LOCUS T and FD during Arabidopsis inflorescence development. J. Exp. Bot. 62: 583–593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Smyth D.R., Bowman J.L., Meyerowitz E.M. (1990). Early flower development in Arabidopsis. Plant Cell 2: 755–767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Srikanth A., Schmid M. (2011). Regulation of flowering time: all roads lead to Rome. Cell. Mol. Life Sci. 68: 2013–2037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Tsuda K., Hake S. (2015). Diverse functions of KNOX transcription factors in the diploid body plan of plants. Curr. Opin. Plant Biol. 27: 91–96. [DOI] [PubMed] [Google Scholar]
  64. Tsuda K., Kurata N., Ohyanagi H., Hake S. (2014). Genome-wide study of KNOX regulatory network reveals brassinosteroid catabolic genes important for shoot meristem function in rice. Plant Cell 26: 3488–3500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Venglat S.P., Dumonceaux T., Rozwadowski K., Parnell L., Babic V., Keller W., Martienssen R., Selvaraj G., Datla R. (2002). The homeobox gene BREVIPEDICELLUS is a key regulator of inflorescence architecture in Arabidopsis. Proc. Natl. Acad. Sci. USA 99: 4730–4735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Verhage L., Angenent G.C., Immink R.G.H. (2014). Research on floral timing by ambient temperature comes into blossom. Trends Plant Sci. 19: 583–591. [DOI] [PubMed] [Google Scholar]
  67. Wang J.W., Czech B., Weigel D. (2009). miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana. Cell 138: 738–749. [DOI] [PubMed] [Google Scholar]
  68. Weigel D., Alvarez J., Smyth D.R., Yanofsky M.F., Meyerowitz E.M. (1992). LEAFY controls floral meristem identity in Arabidopsis. Cell 69: 843–859. [DOI] [PubMed] [Google Scholar]
  69. Wigge P.A., Kim M.C., Jaeger K.W., Busch W., Schmid M., Lohmann J.U., Weigel D. (2005). Integration of spatial and temporal information during floral induction in Arabidopsis. Science 309: 1056–1059. [DOI] [PubMed] [Google Scholar]
  70. Wilkinson M.D., Haughn G.W. (1995). UNUSUAL FLORAL ORGANS controls meristem identity and organ primordia fate in Arabidopsis. Plant Cell 7: 1485–1499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Yamaguchi A., Wu M.F., Yang L., Wu G., Poethig R.S., Wagner D. (2009). The microRNA-regulated SBP-box transcription factor SPL3 is a direct upstream activator of LEAFY, FRUITFULL, and APETALA1. Dev. Cell 17: 268–278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Yanai O., Shani E., Dolezal K., Tarkowski P., Sablowski R., Sandberg G., Samach A., Ori N. (2005). Arabidopsis KNOXI proteins activate cytokinin biosynthesis. Curr. Biol. 15: 1566–1571. [DOI] [PubMed] [Google Scholar]
  73. Yu L., Patibanda V., Smith H.M.S. (2009). A novel role of BELL1-like homeobox genes, PENNYWISE and POUND-FOOLISH, in floral patterning. Planta 229: 693–707. [DOI] [PubMed] [Google Scholar]

Articles from The Plant Cell are provided here courtesy of Oxford University Press

RESOURCES