Abstract
The objective of this study was to examine the effects of glutamine on heat-shock protein beta 1 (HSPB1) expression in bovine embryonic fibroblast cells during myogenesis. First, to elucidate the role of glutamine on HSPB1 expression during myogenesis, we treated with glutamine in myogenic lineage determinant (MyoD) over-expressed bovine embryonic fibroblast cells (BEFS-MyoD cells). Second, knockdown of HSPB1 using small interference RNA was performed to evaluate whether muscle development by glutamine is dependent on HSPB1 in BEFS-MyoD cells. As a result, glutamine promoted the mRNA level of HSPB1, Myogenin, Desmin, and mTOR as well as myotube formation, and protein synthesis (p < 0.05). The inhibition of HSPB1 expression during myogenesis has shown to repress the expression of myogenic marker genes (MyoD, Myogenin, Desmin) (p < 0.01), formation of myotubes and protein synthesis (p < 0.05). According to the results, it is concluded that glutamine regulates HSPB1 expression during myogenesis.
Keywords: Glutamine, HSPB1, Bovine embryonic fibroblast cell, Myogenic differentiation, Protein synthesis
Introduction
Efficient muscle growth and development is critical in beef cattle industry [1]. According to the previous studies, heat-shock protein beta 1 (HSPB1) is a candidate protein for muscle growth and development in beef cattle.
HSPB1, which is a 27 kDa protein expressed many tissues including muscle for protecting tissues from physiological stress, is known to enhance muscle development in bovine both in vitro and in vivo [2–4]. HSPB1 expression is regulated by heat shock factor 1 (HSF-1) which is a transcription factor of HSPB1 controlled by l-glutamine [5]. However, in bovine muscle, the effects of l-glutamine on the HSPB1 expression is not clear. Thus, we hypothesize that glutamine activates HSPB1 expression in bovine muscle cells leading to muscle development in myogenic differentiation. During myogenesis, cellular events such as cytoskeletal structure, protein synthesis, and mitochondrial metabolism are also dramatically changed [6]. Therefore, the objective of this study was to profile the gene expression of HSPB1 as well as myogenic, protein synthesis, and mitochondrial biogenesis genes during myogenesis in myogenic lineage determinant (MyoD) over-expressed immortalized bovine embryonic fibroblast cells (BEFS-MyoD) after treatment with glutamine.
Materials and methods
Cell culture
BEFS-MyoD cell line, myogenic lineage determinant over-expressed immortalized bovine embryonic fibroblast cells, was used [7]. The cells were grown in 100-mm tissue culture dish in growth medium containing Dulbecco’s modified Eagle’s medium (DMEM; GE Healthcare Life Sciences, Chicago, IL, USA) with high-glucose, 10% fetal bovine serum (FBS; GE Healthcare Life Sciences), 1% penicillin/streptomycin (GE Healthcare Life Sciences), 1% l-glutamine (ThermoFisher Scientific Inc., Waltham, MA, USA). Cultures were maintained in an incubator with 5% CO2 and 37 °C and culture medium was replaced every 2 days. After reaching 100% confluence, cells were transferred to 6-well plates (Corning Inc., NY, USA). Then, the plate including cells were incubated until 100% confluence in growth medium for myogenic differentiation.
Induction of myogenesis
To induce myogenesis, cells were exposed to differentiation medium containing glutamine-free DMEM (GE Healthcare Life Sciences) with high glucose, 2% horse serum (GE Healthcare Life Sciences), 1% P/S (GE Healthcare Life Sciences), 10 μg/ml insulin (Sigma-Aldrich Co. LLC., St-Louis, MO, USA), 10 μg/ml doxycycline (Sigma-Aldrich Co. LLC.), and 0, 1, 2, 4 mM l-glutamine (ThermoFisher Scientific Inc.) respectively for 6 days. The medium was replaced every 2 days.
Small interference RNA treatment
HSPB1 small interference RNA (siRNA) transfection in BEFS-MyoD cells were conducted following the instruction of previous study [4]. Briefly, siRNA targeting HSPB1 mRNA (sense, 5′-GUAGCCAUCACUGGACAUCUU-3′ and anti-sense, 5′-AAGAUGUCCAGUGAUGGCUAC-3′) was transfected in BEFS-MyoD cells using lipofectamine 2000 (ThermoFisher Scientific Inc.) at 100 nM during myogenic differentiation at day 2 and 4. Negative control siRNA was used as a control group (100 nM). Cells were maintained in differentiation medium supplemented with l-glutamine (4 mM) for 6 days. The medium was also changed every 2 days.
Gene expression analysis by quantitative real-time PCR
RNA was extracted from the differentiated cells at 0, 2, and 6 days respectively. Total RNA was extracted using Trizol (ThermoFisher Scientific Inc.) based on the manufacture protocol. RNA quantity test was conducted using Nanodrop 1000 (ThermoFisher Scientific Inc.). 1 μg RNA was reverse-transcribed with cDNA synthesis kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA). After reverse-transcription, a CFX-Connect Real-time system (Bio-Rad Laboratories, Inc.) was used to conduct qRT-PCR. A total reaction volume of real-time PCR mixture containing 50 μg of cDNA, 6 pmol of forward and reverse primers respectively, and 10 μl of SYBR-green master mixture (Bio-Rad Laboratories, Inc.) is 20 μl. Reaction mixture (Bio-Rad Laboratories, Inc.) was incubated at 95 °C for 3 min and then 50 cycles of 10 s at 95 °C, 10 s at 55–60 °C, and 30 s at 72 °C. The sequence information of primers is presented in Table 1. The mRNA expression of target genes normalized to the beta-actin is calculated by ΔΔCt method [8].
Table 1.
Primers used for quantitative real-time PCR
| Gene | Primer | Sequence (5′–3′) | GeneBank accession no. |
|---|---|---|---|
| HSPB1 | Forward | CCTGGACGTCAACCACTTC | NM_001025569 |
| Reverse | GCTTGCCAGTGATCTCCAC | ||
| MyoD | Forward | CGTCTAGCAACCCAAACCAG | NM_001040478 |
| Reverse | GGCCTTCGATATAGCGGATG | ||
| Myogenin | Forward | TGGGCGTGTAAGGTGTGTAA | NM_001111325.1 |
| Reverse | TGCAGGCGCTCTATGTACTG | ||
| Desmin | Forward | GGACCTGCTCAATGTCAAGA | NM_001081575 |
| Reverse | GGAAGTTGAGGGCAGAGAAG | ||
| mTOR | Forward | ATGCTGTCCCTGGTCCTTATG | XM_001788228.1 |
| Reverse | GGGTCAGAGAGTGGCCTTCAA | ||
| PGC1-α | Forward | GTCCTTCCTCCATGCCTGAC | Q865B7 |
| Reverse | TAGCTGAGTGTTGGCTGGTG | ||
| β-actin | Forward | GCGTGGCTACAGCTTCACC | NM_173979 |
| Reverse | TTGATGTCACGGACGATTTC |
HSPB1 heat shock protein beta-1, MyoD myogenic differentiation 1, mTOR mammalian target of rapamycin, PGC1-α peroxisome proliferator-activated receptor gamma coactivator 1-alpha
Cellular protein content determination
Cells were differentiated for 6 days. The total protein was extracted from cells using radioimmunoprecipitation assay buffer (Thermo Fisher Scientific Inc.) containing 150 mM NaCl, 1% NP-40, 0.1% sodium dodecyl sulfate, 2 mM EDTA, 6 mM Na2HPO4, 4 mM NaH2PO4, 50 mM NaF, 200 µM Na3VO4, and 1x protease inhibitor (GE Healthcare Life Sciences). Protein concentrations were measured by BCA-assay kit (Thermo Fisher Scientific Inc.) according to the manufacturer’s instructions.
ATP concentration analysis
After myogenic differentiation for 6 days, ATP concentration in cells was measured with an ATP-assay kit (Abcam plc., Cambridge, MA, USA). Experiments were performed according to manufacturer’s instruction.
Statistics
Student’s t test was used to determine the significant difference between the two groups. More than three groups, data analysis was performed by one-way ANOVA with Duncan’s multiple-range test. All data were presented as mean ± standard deviation (SD). Analyses were conducted using SPSS (SPSS Inc., Chicago, IL, USA). The statistical significance was set at p < 0.05.
Results and discussion
Firstly, we investigated the effects of l-glutamine on regulating HSPB1 gene expression in bovine muscle cells during myogenesis using BEFS-MyoD cells treated with different l-glutamine concentrations (Fig. 1). As the concentration of l-glutamine increased, HSPB1 gene expression tended to increase [Fig. 1(A)]. In the day 2 of differentiation, mRNA expression was higher (p < 0.05) in 2 mM and 4 mM treatment groups compared to non-treated group. In day 6, the expression of HSPB1 gene was higher (p < 0.01) in all treatment groups of l-glutamine (1, 2, and 4 mM) than in non-treated group. Glutamine, one of the semi-essential amino acids in skeletal muscle [9], is known to induce HSPB1 expression by regulating HSF-1 which is the transcription factor of HSP genes [10]. As expected, the expression of HSPB1 was higher in glutamine-treated groups than in non-treated group during myogenesis indicating that glutamine regulates HSPB1 expression in myogenic differentiation [Fig. 1(A)]. Figure 1(B) shows cells cultured in myogenic differentiation conditions with glutamine (4 mM) formed a lot of fused myotubues, whereas cells without glutamine maintained their initial morphology. Consistent with these findings, as myogenic markers, the mRNA levels of Myogenin and Desmin were highly increased in 4 mM-treated group in the day 2 (p < 0.05), and day 6 (p < 0.01), respectively [Fig. 1(D, E)]. In contrast, MyoD mRNA level was decreased in glutamine treated group in day 2 compared with non-treated group [Fig. 1(C)]. Myogenesis is regulated by several myogenic genes such as MyoD, Myogenin, MRF4, and Desmin [11]. These myogenic marker genes are known to be upregulated during myogenic differentiation [12]. Similar to HSPB1 expression, Myogenin, and Desmin expressions were higher in glutamine-treated group in our results [Fig. 1(D, E)]. However, it is still unclear how HSPB1 regulates myogenesis. A recent study suggests that HSPB1, a major factor of actin polymerization in muscle, is known for maintaining muscle structure [13]. HSPB1 also has chaperone function including preventing protein degradation, inhibiting muscle atrophy, and stabilizing muscle protein [14]. It is speculated that HSPB1 enhances muscle development by protecting muscle proteins [15]. In contrast, MyoD expression was lower in glutamine-treated group [Fig. 1(C)]. MyoD, one of the initial myogenic marker genes, is known to regulate myogenic determination from myoblast to myotubes and early myogenesis comparing to other myogenic genes [16]. The mechanism about regulating MyoD expression is not clear. Therefore, we speculate that some of the feedback mechanism of downregulating MyoD expression was initiated due to MyoD-over expression cell characteristics [17].
Fig. 1.
The effect of l-glutamine on HSPB1 expression, myogenesis in BEFS-MyoD cells during myogenic differentiation. Confluent cells were differentiated with different l-glutamine concentration (0, 1, 2, and 4 mM). (A) Relative mRNA levels of HSPB1, (B) representative images of BEFS-MyoD cells during myogenesis for 6 days (magnification × 10; Olympus Co., Shinjuku, Tokyo, Japan), (C, D, E) relative mRNA levels of MyoD, myogenin, Desmin. All data were represented as the mean ± SD (n = 3). Bars not labeled with same letter are statistically different (p < 0.05). *p < 0.05, **p < 0.01, ***p < 0.001
A higher expression of HSPB1 by l-glutamine promotes protein synthesis [Fig. 2(A, B)]. The expression of Mammalian Target of Rapamycin (mTOR) mRNA was higher (p < 0.01) in glutamine-treated group than in non-treated group in day 6. Consistently, cellular protein concentration was higher (p < 0.01) in glutamine-treated group than in non-treated group in day 6. mTOR known for master regulator of cellular protein metabolism, is regulated by leucine primarily and critical for protein synthesis in muscle [18, 19]. During myogenesis especially in late stage of differentiation, differentiated primary myotubes go on secondary myotube maturation stage, when cellular protein synthesis and fusions are occurred dramatically in muscle cells via mTOR-pathway [20]. We speculate that there is an upregulation of transcriptional levels of mTOR even if there are abundant activated mTOR proteins in cells. Moreover, HSPB1 stabilizes protein structure and facilitates protein translation by inhibiting protein degradation in muscle cells during myogenesis [21]. We speculate that due to molecular chaperone activities by HSPB1, muscle cells go on differentiation without any physiological stress resulting in upregulating mTOR mRNA expression. Thus, our data suggests that higher HSPB1 expression by l-glutamine facilitates protein synthesis in muscle during myogenesis.
Fig. 2.
The effect of l-glutamine on protein synthesis, and mitochondiral changes in BEFS-MyoD cells during myogenic differentiation. Confluent cells were differentiated with different l-glutamine concentration (0 and 4 mM). (A) Relative mRNA levels of mTOR, (B) cellular protein concentration, (C) relative mRNA levels of PGC1-a, (D) Cellular ATP concentration. All data were represented as the mean ± SD (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001
Mitochondrial biogenesis changes showed that the mRNA expression of PGC1-α, known for mitochondrial biogenesis gene, was higher (p < 0.01) in glutamine non-treated group than in treated-group in both day 2, and day 6 [Fig. 2(C, D)]. In the result of ATP concentration assay, cellular ATP amounts was lower (p < 0.05) in glutamine-treated group than in non-treated group in day 6. In general, mitochondria is a main metabolic organelle of muscle cells [22]. Mitochondrias are generated more in myotubes than in myoblasts during myogenesis due to high demand of ATPs [23]. Mitochondiral biogenesis is regulated by PGC-1α (Peroxisome proliferator-activated receptor gamma coactivator 1-alpha) which is a main determinant of mitochondrial numbers [24]. In the present study, PGC-1α mRNA expression and cellular ATP contents were lower in glutamine-treated group than in non-treated group [Fig. 2(C, D)]. According to the previous study, HSPB1 prevents mitochondria fragmentation associated with apoptosis [25]. It is expected that PGC-1α expression is upregulated during myogenesis due to the reduced HSPB1 expression.
We next examined whether l-glutamine enhances myogenesis in BEFS-MyoD cells only via HSPB1 pathway (Fig. 3). Cells treated with l-glutamine (4 mM) were conducted HSPB1 gene knockdown by siRNA transfection during myogenic differentiation day 2 and day 4, respectively. HSPB1 knockdown caused a reduction in both HSPB1 mRNA (p < 0.01) levels in day 6 [Fig. 3(A)]. Cell images shows that reduction of HSPB1 mRNA inhibits myotubes formation [Fig. 3(B)], similarly in, MyoD and Desmin expression [Fig. 3(C, D)] (p < 0.01).
Fig. 3.
The effect of HSPB1 knockdown on glutamine-mediated myogenesis in BEFS-MyoD cells. (A) Relative mRNA levels of HSPB1, (B) representative images of BEFS-MyoD cells during myogenesis for 6 days (× 10), (C, D, E) relative mRNA levels of MyoD, Desmin, myogenin. All data were represented as the mean ± SD (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001
Reduction of HSPB1 expression by siRNA transfection to BEFS-MyoD cells induces decreased cellular protein synthesis (Fig. 4). Cellular protein concentration was reduced (p < 0.05) in siRNA transfection group compared to control group [Fig. 4(B)]. mTOR mRNA expression was not significantly different between the two groups [Fig. 4(A)]. In the results of mitochondrial biogenesis changes, there were no significant differences between two groups in PGC-1α expression, and ATP concentration respectively [Fig. 4(C, D)].
Fig. 4.
The effect of HSPB1 knockdown on protein synthesis, and mitochondiral changes during glutamine-mediated myogenesis in BEFS-MyoD cells. (A) Relative mRNA levels of mTOR, (B) cellular protein concentration, (C) relative mRNA levels of PGC1-α, (D) cellular ATP concentration. All data were represented as the mean ± SD (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001
HSPB1 knockdown inhibited myogenic differentiation during androgen-mediated myogenesis [4].
According to [Figs. 3(B)–(D), 4(B)] it is estimated that inhibition of myogenesis by HSPB1 knockdown decreases cellular protein synthesis. However, comparing to results (Figs. 1, 2), the differences between the two groups in myogenic marker genes and protein synthesis were lower. We estimated that in the results (Figs. 3, 4), adequate supplements of l-glutamine (4 mM) recover myogenic differentiation. There were no significant differences in PGC-1α mRNA expression and cellular ATP contents [Fig. 4(C, D)]. Since the difference in the expression level of HSPB1 is insignificant compared with result groups [0, 4 mM; Fig. 1(A)], it is expected that mitochondrial fragmentation was lower in HSPB1 knockdown groups (Control, siRNA).
According to results, it is unclear that glutamine regulates myogenesis only via HSPB1 pathway. However, as the expression level of HSPB1 decreased, muscle development and protein synthesis also tended to decrease. Thus, it is estimated that glutamine enhances muscle development during myogenesis stage via targeting HSPB1 expression considerably.
Acknowledgements
This work was supported by a grant from the Next-Generation BioGreen 21 Program (No. PJ011140), Rural Development Administration, Republic of Korea.
Contributor Information
Young-Shin Kim, Email: kimyssam@gmail.com.
Yoonseok Lee, Email: yoonseok95@hknu.ac.kr.
Myunggi Baik, Email: mgbaik@snu.ac.kr.
Hong-Gu Lee, Phone: +82-2-450-0523, Email: hglee66@konkuk.ac.kr.
References
- 1.He H, Chen S, Liang W, Liu X. Genome-wide proteomics analysis on longissimus muscles in Qinchuan beef cattle. Animal Genetics. 2017;48:131–140. doi: 10.1111/age.12508. [DOI] [PubMed] [Google Scholar]
- 2.Jung US, Kim MJ, Wang T, Lee JS, Jeon SW, Jo NC, Kim WS, Baik M, Lee HG. Upregulated heat shock protein beta-1 associated with caloric restriction and high feed efficiency in longissimus dorsi muscle of steer. Livestock Science. 2017;202:109–114. doi: 10.1016/j.livsci.2017.05.009. [DOI] [Google Scholar]
- 3.Zhang Q, Lee HG, Han JA, Kang SK, Lee NK, Baik M, Choi YJ. Differentially expressed proteins associated with myogenesis and adipogenesis in skeletal muscle and adipose tissue between bulls and steers. Molecular Biology Reports. 2012;39:953–960. doi: 10.1007/s11033-011-0821-3. [DOI] [PubMed] [Google Scholar]
- 4.Zhang Q, Lee HG, Kang SK, Baik M, Choi Y-J. Heat-shock protein beta 1 regulates androgen-mediated bovine myogenesis. Biotechnology Letters. 2014;36:1225–1231. doi: 10.1007/s10529-014-1489-2. [DOI] [PubMed] [Google Scholar]
- 5.Meador BM, Huey KA. Glutamine preserves skeletal muscle force during an inflammatory insult. Muscle & Nerve. 2009;40:1000–1007. doi: 10.1002/mus.21430. [DOI] [PubMed] [Google Scholar]
- 6.Bentzinger CF, Wang YX, Rudnicki MA. Building Muscle: Molecular Regulation of Myogenesis. Cold Spring Harbor Perspectives in Biology 4 (2012) [DOI] [PMC free article] [PubMed]
- 7.Yin J, Jin X, Beck S, Kang DH, Hong Z, Li Z, Jin Y, Zhang Q, Choi Y-J, Kim S-C, Kim H. In vitro myogenic and adipogenic differentiation model of genetically engineered bovine embryonic fibroblast cell lines. Biotechnology Letters. 2010;32:195–202. doi: 10.1007/s10529-009-0142-y. [DOI] [PubMed] [Google Scholar]
- 8.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 9.Xiao D, Zeng L, Yao K, Kong X, Wu G, Yin Y. The glutamine-alpha-ketoglutarate (AKG) metabolism and its nutritional implications. Amino Acids. 2016;48:2067–2080. doi: 10.1007/s00726-016-2254-8. [DOI] [PubMed] [Google Scholar]
- 10.Xue H, Slavov D, Wischmeyer PE. Glutamine-mediated Dual Regulation of Heat Shock Transcription Factor-1 Activation and Expression. Journal of Biological Chemistry. 2012;287:40400–40413. doi: 10.1074/jbc.M112.410712. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Charge SBR, Rudnicki MA. Cellular and Molecular Regulation of Muscle Regeneration. Physiological Reviews. 2004;84:209–238. doi: 10.1152/physrev.00019.2003. [DOI] [PubMed] [Google Scholar]
- 12.Sweetman D. The Myogenic Regulatory Factors: Critical Determinants of Muscle Identity in Development, Growth and Regeneration. pp. Ch. 02. In: Skeletal Muscle - From Myogenesis to Clinical Relations. Cseri J (ed). InTech, Rijeka (2012)
- 13.Sugiyama Y, Suzuki A, Kishikawa M, Akutsu R, Hirose T, Waye MMY, Tsui SKW, Yoshida S, Ohno S. Muscle Develops a Specific Form of Small Heat Shock Protein Complex Composed of MKBP/HSPB2 and HSPB3 during Myogenic Differentiation. Journal of Biological Chemistry. 2000;275:1095–1104. doi: 10.1074/jbc.275.2.1095. [DOI] [PubMed] [Google Scholar]
- 14.Tucker NR, Shelden EA. Hsp27 associates with the titin filament system in heat-shocked zebrafish cardiomyocytes. Experimental cell research. 2009;315:3176–3186. doi: 10.1016/j.yexcr.2009.06.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Perng MD, Cairns L, van den IJssel P, Prescott A, Hutcheson AM, Quinlan RA. Intermediate filament interactions can be altered by HSP27 and alphaB-crystallin. Journal of Cell Science. 1999;112:2099–2112. doi: 10.1242/jcs.112.13.2099. [DOI] [PubMed] [Google Scholar]
- 16.Sumariwalla VM, Klein WH. Similar myogenic functions for myogenin and MRF4 but not MyoD in differentiated murine embryonic stem cells. Genesis. 2001;30:239–249. doi: 10.1002/gene.1070. [DOI] [PubMed] [Google Scholar]
- 17.Xun J, Joong-Seub L, Sungwook K, Ji-Eun J, Tae-Kyung K, Chenxiong X, Zhongshan H, Zhehu L, Sun-Myoung K, Kwang Youn W, Ki-Chang H, Seungkwon Y, Yun-Jaie C, Hyunggee K. Myogenic Differentiation of p53- and Rb-deficient Immortalized and Transformed Bovine Fibroblasts in Response to MyoD. Mol. Cells. 2006;21:206–212. [PubMed] [Google Scholar]
- 18.Bodine SC, Stitt TN, Gonzalez M, Kline WO, Stover GL, Bauerlein R, Zlotchenko E, Scrimgeour A, Lawrence JC, Glass DJ, Yancopoulos GD. Akt/mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent muscle atrophy in vivo. Nat Cell Biol. 2001;3:1014–1019. doi: 10.1038/ncb1101-1014. [DOI] [PubMed] [Google Scholar]
- 19.Golberg ND, Druzhevskaya AM, Rogozkin VA, Ahmetov II. Role of mTOR in the regulation of skeletal muscle metabolism. Human Physiology. 2014;40:580–588. doi: 10.1134/S0362119714040070. [DOI] [PubMed] [Google Scholar]
- 20.Ge Y, Chen J. Mammalian Target of Rapamycin (mTOR) Signaling Network in Skeletal Myogenesis. The Journal of Biological Chemistry. 2012;287:43928–43935. doi: 10.1074/jbc.R112.406942. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Dubińska-Magiera M, Jabłońska J, Saczko J, Kulbacka J, Jagla T, Daczewska M. Contribution of small heat shock proteins to muscle development and function. FEBS Letters. 2014;588:517–530. doi: 10.1016/j.febslet.2014.01.005. [DOI] [PubMed] [Google Scholar]
- 22.Russell AP, Foletta VC, Snow RJ, Wadley GD. Skeletal muscle mitochondria: A major player in exercise, health and disease. Biochimica et Biophysica Acta (BBA) - General Subjects 1840: 1276–1284 (2014) [DOI] [PubMed]
- 23.Remels AHV, Langen RCJ, Schrauwen P, Schaart G, Schols AMWJ, Gosker HR. Regulation of mitochondrial biogenesis during myogenesis. Molecular and Cellular Endocrinology. 2010;315:113–120. doi: 10.1016/j.mce.2009.09.029. [DOI] [PubMed] [Google Scholar]
- 24.LeBleu VS, O’Connell JT, Herrera KNG, Wikman-Kocher H, Pantel K, Haigis MC, de Carvalho FM, Damascena A, Chinen LTD, Rocha RM, Asara JM, Kalluri R. PGC-1α mediates mitochondrial biogenesis and oxidative phosphorylation to promote metastasis. Nature cell biology. 2014;16:992–1003. doi: 10.1038/ncb3039. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Marunouchi T, Abe Y, Murata M, Inomata S, Sanbe A, Takagi N, Tanonaka K. Changes in Small Heat Shock Proteins HSPB1, HSPB5 and HSPB8 in Mitochondria of the Failing Heart Following Myocardial Infarction in Rats. Biological and Pharmaceutical Bulletin. 2013;36:529–539. doi: 10.1248/bpb.b12-00796. [DOI] [PubMed] [Google Scholar]




