Skip to main content
Parasites & Vectors logoLink to Parasites & Vectors
. 2018 Jul 20;11:430. doi: 10.1186/s13071-018-3005-3

Identification and preliminary characterization of Hc-clec-160, a novel C-type lectin domain-containing gene of the strongylid nematode Haemonchus contortus

Ling Zhang 1, Lingyun Mou 1, Xueqiu Chen 1, Yi Yang 1, Min Hu 2, Xiangrui Li 3, Xun Suo 4, Xing-Quan Zhu 5, Aifang Du 1,
PMCID: PMC6054721  PMID: 30029661

Abstract

Background

The strongylid parasite Haemonchus contortus causes severe anemia in domestic animals worldwide. Effective preventive and therapeutical agents are lacking, because of drug resistance and that little is known about the molecular mechanism of the interaction between H. contortus and host cells.

Methods

A new gene, Hc-clec-160, was discovered with RT-PCR. Transcriptional levels of Hc-clec-160 and Ce-clec-160 throughout different growth phases of corresponding nematodes were assayed by qPCR. Immunofluorescence staining of paraffin section were performed to determine the protein localization in adult worms of H. contortus. To monitor the promoter capacity of the 5'-flanking region of Ce-clec-160, micro-injection was used. Overexpression and RNAi constructs was carried out in the N2 strain of Caenorhabditis elegans to find out the gene function of Hc-clec-160.

Results

The full-length cDNA of 1224 bp of Hc-clec-160 was cloned by RT-PCR. The corresponding gene contained twelve exons. Its transcripts peaked in male adult worms. Hc-CLEC-160 was predicted to have a Willebrand factor type A (vWA) domain and a C-type lectin domain. The proteins were not detected by expression in C. elegans or paraffin section experiments in adult of H. contortus. Knockdown of Ce-clec-160 expression in C. elegans by RNAi resulted in shortened body length and decreased brood size.

Conclusions

In this experiment, a new gene Hc-clec-160 was obtained in H. contortus and its function was addressed using a model organism: C. elegans. Our study showed that Hc-clec-160 possesses characteristics similar to those of Ce-clec-160 and plays an important role in the growth and reproduction of this parasitic nematode.

Electronic supplementary material

The online version of this article (10.1186/s13071-018-3005-3) contains supplementary material, which is available to authorized users.

Keywords: Hc-clec-160, Haemonchus contortus, Caenorhabditis elegans, C-type lectin

Background

C-type lectin (CTL) is a Ca2+-dependent glycan-binding protein (GBP) that shares primary and secondary structural homology in its carbohydrate-recognition domain (CRD). The CRD of CTL is generally regarded as the CTL domain (CTLD), representing a ligand binding motif that binds to sugars, proteins, lipids and even inorganic ligands [1]. Not all CTLs with this domain bind either glycans or Ca2+. The CTLD is defined by amino acid sequences and Cys positions, as well as the folded structure. The latter is characterized by two highly conserved disulfide-stabilized bicyclic structures that participate in binding to sugars with at least four conserved cysteine residues, two to three hydrophobic cores, and up to four calcium binding sites. The main conserved residues that bind to sugars include the EPN (Glu-Pro-Asn) motif which enhances binding to Man, GlcNAc, Fuc, and Glc and the WND (Trp-Asp-Asn) motif which promotes binding to Gal and GalNAc, as seen in mouse L-selectin and rat mannose-binding protein C [1, 2]. They often oligomerize, which increases their avidity for multivalent ligands. CTLs bind to various types of glycans with high affinity. CTLs include selectins, collectins, endocytic receptors and proteoglycans. Some CTLs are exocrine whereas others are transmembrane proteins. They play a role in adhesion and signaling receptors in many pathways, including homeostasis and innate immunity, and are crucial in inflammatory responses and leukocyte and platelet trafficking. It is difficult to predict the glycan structures that bind to a particular CTL due to the relatively shallow CRD of CTL with few contacts to sugars motifs.

CTLs have been identified in some parasitic nematodes such as Trichostrongylus colubriformis, Onchocerca volvulus, Haemonchus contortus and Teladorsagia circumcincta [3]. They can significantly regulate host immune response [46]; however, their functions in H. contortus are poorly understood. Haemonchus contortus is one of the most economically important parasites of small ruminants (sheep and goats) worldwide, and can lead to anemia, weight loss and death of the host (sheep and goats) [7]. It can also cause immunosuppression and reduce the level of immunity in the host [8]. Caenorhabditis elegans is the most widely used model nematode in drug research [9], vaccine discovery [10] and helminth resistance studies [1113].

In our study, we identified and characterized a novel gene of Hc-clec-160 in H. contortus, which is an ortholog of C. elegans and possesses one CTLD. Understanding the structure and function of Hc-clec-160 may provide useful information for deciphering how this parasite interacts with its hosts and crucial elements influencing its growth, development and reproduction.

Methods

Parasites and animals

Two female sheep, 4–5 months-old and maintained under helminth-free conditions for 30 days, were infected orally with 8000 L3s of H. contortus ZJ strain each, after being dewormed twice. Three weeks later, sheep feces were collected and helminth eggs detected by microscopy. First- (L1), second- (L2) and third-stage larvae (L3) were harvested at the 1st, 3rd and 7th day, respectively, after incubation of the collected eggs at 28 °C. Adults of H. contortus (ZJ strain) were obtained from abomasa of sheep in a Hu Zhou Slaughterhouse. They were washed several times in phosphate-bufferred saline (PBS), pH 7.4. The clean adult worms were stored in liquid nitrogen. Caenorhabditis elegans wild strains (N2) were cultivated on NGM plates and fed on Escherichia coli (OP 50 strain) at 20 °C as previously described [14].

Isolation of the Hc-clec-160 gene

A homolog (>HCISE02108900.t1) was identified by using the Ce-clec-160 gene by searching the Sanger Institute genomic database for H. contortus (http://www.sanger.ac.uk/cgi-bin/blast/submitblast/h_contortus). Specific primers (Hc-clec-160 1F and Hc-clec-160 1R) (Table 1) were designed according to the CDs sequence. The PCR reaction program included: one cycle at 94 °C for 3 min; 30 cycles at 94 °C for 30 s, 57 °C for 30 s and 72 °C for 80 s; and finally one cycle at 72 °C for 10 min. The amplified fragments were cloned into the pMD18-T vector (Takara Biotechnology Co., Ltd., Dalian, China) and sent to Shanghai BioSune Co., Ltd. (Shanghai, China) for sequencing.

Table 1.

Primers used in the study. The restriction sites are underlined

Primer ID Primer sequence 5'-3'
Hc-clec-160 1F ATGCAACCCCTCTGTACCTT
Hc-clec-160 1R TTAGATGACAGGACAGTAGTGGC
Hc-clec-160 2F GGATCCATGCAACCCCTCTGTACCTT
Hc-clec-160 2R AAGCTTTTAGATGACAGGACAGTAGTGGC
Hc-clec-160 3F TCTAGAATGCAACCCCTCTGTACCTT
Hc-clec-160 3R GGTACCATGACAGGACAGTAGTGGC
Hc-clec-160 4F TCTAGAATGCAACCCCTCTGTACCTT
Hc-clec-160 4R AAGCTTTTAGATGACAGGACAGTAGTGGC
Ce-clec-160 pF CCGGACCATCAATATGGTATTGAGTAT
Ce-clec-160 pR CTGAATAATTCTTGGGTATTAAAAAAAAGA
Ce-clec-160 pF1 GTCGACCCGGACCATCAATATGGTATTGAGTAT
Ce-clec-160 pR1 TCTAGACTGAATAATTCTTGGGTATTAAAAAAAAGA
Hc-clec-160 QF AGTAGCGGCTTTGATTGTGC
Hc-clec-160 QR TGACTGCTGACCCATTGCTT
Ce-clec-160 F CCCGGGATGGATTTAAAAAGTTGGATTCTA
Ce-clec-160 R AAGCTTCTAATTGCTTGAAGGTGCACAGTA
Ce-clec-160 QF AGTTCCACCTACACATCCG
Ce-clec-160 QR AAGTCCACCTTGTCCCATT

Bioinformatics analyses

Function domains of Hc-clec-160 gene were analyzed by submitting its amino acid sequence to the NCBI conserved domains (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi). Homologues of Hc-CLEC-160 in other species: model nematodes (Caenorhabditis elegans, Pristionchus pacificus), animal parasite (Ascaris suum), zoonotic parasites (Toxocara canis, Oesophagostomum dentatum, Ancylostoma ceylanicum) and human parasites (Necator americanus, Ancylostoma duodenale) were obtained by NCBI Protein BLAST alignment (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and all amino acid sequences were analyzed using Clustal W software [15]. Using evolutionary genetic analysis software MEGA v.7, based on the Jones-Taylor-Thornton (JTT) model, phylogenetic tree analysis was performed using neighbor joining (NJ), maximum parsimony (MP) and maximum likelihood (ML) methods [16].

Transcriptional levels of Hc-clec-160 in different developmental stages of H. contortus

qPCR with specific primers (Hc-clec-160 QF-Hc-clec-160 QR and Ce-clec-160 QF-Ce-clec-160 QR) (Table 1) was carried out to determine the mRNA levels in different stages of growth and development of H. contortus and C. elegans including L1, L2, L3, L4 and adults. Total RNA was isolated with Trizol reagents (Invitrogen, Shanghai, China) according to the manufacturer’s instructions and treated with DNase I (Toyobo, Shanghai, China) to remove the DNA. The qPCR reaction program included: one cycle at 50 °C for 2 min and 95 °C for 1 min; 40 cycles at 95 °C for 15 s, 60 °C for 15 s and 72 °C for 30 s; with a dissolution curve being produced in the last cycle. Each sample was repeated three times using the β-tubulin of H. contortus and actin-1 of C. elegans as internal reference genes and an average threshold (Ct) was taken for data analysis.

Polyclonal antibody preparation

Specific primers with double restriction sites (Hc-clec-160 2F and Hc-clec-160 2R) (Table 1) were designed according to the full-length cDNA of the Hc-clec-160 gene sequence. Hc-clec-160 was cloned into the prokaryotic expression vector pET-30a to construct the plasmid pET-30a-Hc-clec-160. The vector was transformed into BL21 (DE3) cells of E. coli to produce recombinant Hc-CLEC-160 (rHc-CLEC-160), followed by treatment with 1 mM isopropy β-D-1-thiogalactopyranoside (IPTG) at 37 °C for 2 h and purification by affinity chromatography using a Ni-NTA agarose column (Qiagen, Shanghai, China) as per the manufacturer’s instructions. Anti-rHc-CLEC-160 polyclonal antibodies were produced by immunizing a New Zealand white rabbit and their titer and specificity were determined by enzyme-linked immunosorbent assay (ELISA).

Immunofluorescence staining of H. contortus adult paraffin sections

Male and female adults of H. contortus were fixed in 4% paraformaldehyde (PFA) at 4 °C for 2 days. After being washed with tap water for 12 h, they were consecutively dehydrated in an ethanol series [50%, 75%, 80%, 95%, 100% (twice), 10 min at each step]. The dehydrated worms were incubated in xylene:absolute ethanol (1:1) solution and xylene and then embedded in paraffin. Paraffin sections of 5 μm were stained with hematoxylin and eosin (H&E) and analyzed histologically. The remaining sections were subjected to immunofluorescence staining. Slices were treated with 0.01 M citrate buffer at 100 °C for 20 min for antigen repair. After overnight blocking with 2% BSA at 4 °C, polyclonal antibody and goat anti-rabbit IgG H&L (Alexa Fluor® 488) diluted 1:100 in PBS were sequentially added and incubated at 37 °C for 1 h each. The sections were stained with 4',6-diamidino-2-phenylindole (DAPI) for 40 min at 37 °C and then observed by fluorescence microscopy.

Ce-clec-160 promoter transformation of C. elegans

The Ce-clec-160 promoter was amplified by PCR using primers Ce-clec-160 pF1 and Ce-clec-160 pR1 (Table 1) containing restriction sites SalI or XbaI. The primers were designed according to the 2000 bp upstream of the start codon of Ce-clec-160. The PCR products were cloned into the multiple cloning sites upstream of the gfp gene of pPD95.77 eukaryotic expression vector, resulting in the plasmid pPD95.77-Ce-clec-160-prom. The latter was microinjected into the gonads of C. elegans along with another plasmid pRF4 carrying the rol-6 gene at a final concentration of 50 μg/ml each. The GFP expression of F2 progeny with the phenotype of roller was observed by fluorescence microscopy.

Expression of Hc-clec-160 in C. elegans

Microinjection was performed as previously described [17]. Hc-clec-160 was amplified based on the specific PCR primers Hc-clec-160 3F and Hc-clec-160 3R listed in Table 1 with XbaI/KpnI restriction enzyme sites. The amplified fragments were cloned into the plasmid pPD95.77 vector between the Ce-clec-160 promoter region and the gfp region. The recombinant plasmid CeP-pPD95.77-Hc-clec-160 with CeP-pPD95.77-Ce-clec-160 as a control was microinjected into N2 strains as described above. The F2 progeny with the roller phenotype were collected for further analysis.

Hc-clec-160 RNA interference

Ce-clec-160 and Hc-clec-160 genes were amplified by PCR with specific primers Hc-clec-160 4F-Hc-clec-160 4R and Ce-clec-160 F-Ce-clec-160 R, respectively (Table 1). The primer pairs contained the restriction sites for XbaI/HindIII and SmaI/HindIII, respectively. The amplified fragments were cloned into the L4440 vector, resulting in the recombinant plasmids L4440-Ce-clec-160 and L4440-Hc-clec-160. The latter were transformed into E. coli HT115 (DE3) strain with the empty L4440 vector as a negative control. A feeding RNAi experiment was performed according to the classic bacterial feeding manuals [18] with three repeats. The transcriptional levels of RNAi worms were detected by qPCR and the RNAi worms were selected for further phenotype analysis.

Statistical analyses

Statistical analysis for Hc-clec-160 and Ce-clec-160 transcriptional levels and parameters were carried out in Excel (v.10.1.0.7022). Graphs were performed using the GraphPad Prism5.0. P-values ≤ 0.05 were considered statistically significant.

Results

Characterization of cDNA and phylogenetic analysis of amino acid sequences

Identification and sequence analysis of the Hc-clec-160 gene revealed 1224 bp that encoded a 408-amino-acids protein with a predicted mass of 45.2 kDa. Hc-clec-160 of H. contortus contained 12 exons separated by 11 introns, which was structurally similar to Ce-clec-160 of C. elegans. Structural analysis revealed that Hc-CLEC-160 has 2 conserved domains: the von Willebrand factor type A (vWA) domain and the CTL conserved domain, carbohydrate-recognition domain (CRD) (Fig. 1a). The protein sequences of Hc-clec-160 and another 8 nematodes were phylogenetically analyzed. The phylogenetic tree revealed that Hc-CLEC-160 clustered within the clade containing C. elegans, which suggest that their evolutionary relationship is relatively close (Fig. 1b).

Fig. 1.

Fig. 1

Characterization of Hc-clec-160 gene from H. contortus. a Amino acid sequence of Hc-clec-160. The conserved domains of Hc-CLEC-160 are highlighted in different colors: the Von Willebrand factor type A (vWA) domain is highlighted in red and the C-type lectin carbohydrate-recognition domain (CRD) in green. b A neighbor-joining phylogenetic tree showing the relationship of H. contortus C-type lectin domain and its homologues from other nematode species: AAY58318.1 (Necator americanus), KKA67531.1 (Pristionchus pacificus), EPB71235.1 (Ancylostoma ceylanicum), NP_492949.1 (Caenorhabditis elegans), KHJ87598.1 ( Oesophagostomum dentatum), KHN72314.1 (Toxocara canis), ERG83551.1 (Ascaris suum) KIH63097.1 (Ancylostoma duodenale). The tree was constructed using the Jones-Tayloe-Thornton model in the program MEGA v.7.0

Transcriptional level of clec-160 throughout the life-cycles of H. contortus and C. elegans and its protein localization

The transcriptional level of clec-160 was performed throughout the life-cycles of H. contortus and C. elegans by qPCR. The result showed that adults had highest levels followed by L3 (Fig. 2). In addition, the transcriptional levels between male and female adults were particularly different (t-test: t(16) = 19.81, P < 0.0001) with adult males showing much higher transcriptional levels than adult females (Fig. 2a). The results of H&E staining of the sections showed that, regardless of the sex of adults H. contortus, parasite morphology was well maintained after sectioning and the tissue boundaries were clear (Additional file 1: Figure S1). Immunofluorescence staining of paraffin sections to detect protein localization was carried out, but no fluorescence staining was observed.

Fig. 2.

Fig. 2

Transcriptional levels of Hc-clec-160 (a) and Ce-clec-160 (b) throughout different developmental stages of H. contortus and C. elegans. The abundance of clec-160 transcripts was quantified by qPCR in different developmental stages or sexes of H. contortus and C. elegans: first-stage larvae (L1), second-stage larvae (L2), third-stage larvae (L3), female fourth-stage (L4f), male fourth-stage (L4m), adult female (Af) and adult male (Am). ***P < 0.001

Expression of Hc-clec-160 in C. elegans

The entire coding regions of Hc-clec-160 fused in frame with the gfp gene was expressed in transgenic C. elegans to detect its expression in vivo. Ce-clec-160 5'-flanking region was used as a promoter. Activity analysis of the promoter showed that GFP was mainly localized in the distal and anterior part of the intestine (Fig. 3). The reconstructed plasmid Cep-PD95.77-Hc-clec-160 and Cep-pPD95.77-Ce-clec-160 was transformed into the gonads of C. elegans by microinjecting as described above. However, neither Hc-clec-160 nor Ce-clec-160 expression worms showed GFP signal in any stage of C. elegans.

Fig. 3.

Fig. 3

Expression patterns of Ce-clec-160 promoter in C. elegans. a Transgene worm at a magnification of 20×. b, c Anterior and posterior extremities at a magnification of 40×. Scale-bars: a, 100 μm; b, c, 50 μm

RNAi in C. elegans

Transcriptional levels of the RNAi worms were detected using qPCR to testify whether Ce-clec-160 in C. elegans was successfully interfered. It was confirmed that the transcriptional levels of Ce-clec-160 of the worms fed with the Hc-clec-160 and Ce-clec-160 interference vector were significantly decreased in C. elegans by 45% (t-test: t(4) = 2.846, P = 0.0466) and 65% (t-test: t(4) = 4.436, P = 0.0114), respectively (Fig. 4). The RNAi worms revealed significant reduction in brood size (t-test: t(19) = 2.428, P = 0.0253; t-test: t(19) = 9.878, P < 0.0001) (Fig. 5a) and shortened body length (t-test: t(19) = 2.765, P = 0.0123; t-test: t(19 )= 5.986, P < 0.0001) (Fig. 5b) compared with the control group; however, the body width of Ce-clec-160 RNAi worms showed no significant differences from the control (Fig. 5c).

Fig. 4.

Fig. 4

Change in mRNA levels of RNA interference with L4440-Hc-clec-160 and L4440-Ce-clec-160 in N2 C. elegans. The abundance of Ce-clec-160 transcripts in Ce-clec-160 RNAi worms was quantified by qPCR. *P < 0.05

Fig. 5.

Fig. 5

Post-embryonic development in Ce-clec-160 knockdown C. elegans worms. a Brood size of twenty worms for three repeats of Ce-clec-160 RNAi worms, using L4440 “empty” vector as a negative control. b Body length of twenty worms for three repeats of Ce-clec-160 RNAi worms. c Body width of twenty worms for three repeats of Ce-clec-160 RNAi worms. *P < 0.05, ***P < 0.001. Abbreviation: ns, difference not significant

Discussion

In this study, the full-length cDNA sequences of two genes (Hc-clec-160 and Ce-clec-160) were determined. CTLs are highly representative of all studied metazoan phyla to date. Many proteins in the CTL superfamily contain multiple CRDs, along with additional non-lectin domains. CTLDs were classified to seventeen groups; Hc-clec-160 was similar to the group XIII DGCR2 (DGCR2/ DD/ Sez 12), which is localized in the DiGeorge syndrome (OMIM 188400) critical region [1]. In von Willebrand factor, the vWF is the archetype for a protein superfamily. The structure of vWF was discovered in various plasma proteins: complement factors B, C2, CR3 and CR4; the integrins (I-domains); collagen types VI, VII, XII and XIV; and other extracellular proteins [19, 20]. Most of the proteins containing vWF domains are exocrine. The vWF-containing proteins are involved in many biological functions such as cell adhesion, pattern formation, migration, homing, and signal transduction, concerning interactions with a large number of ligands. It is plausible that the interaction between lectins of gastrointestinal nematodes and complex mucin oligosaccharides can affect worm infection [21]. It has been reported recently that a CTL named cpclec from Cryptosporidum parvum plays an important role in binding sulfated proteoglycans of host cells [22, 23]. These findings suggest that Hc-CLEC-160 may have the ability to adhere and bind to host cells.

The relative abundance of Hc-clec-160 transcripts throughout different developmental stages determined by qPCR showed that they had generally low abundance in all life-cycle stages except for adult males (Fig. 2a). High transcriptional levels of Hc-clec-160 in the male adult stage suggests that Hc-clec-160 may be related to the mating and reproduction of H. contortus. Furthermore, higher Hc-clec-160 transcriptional levels in L3s and L4s than in eggs, L1s and L2s, indicate that Hc-clec-160 is likely to play a crucial part in the parasitic stages, i.e. L3s and L4s, for adhesion to the host cells. The microinjection of Ce-clec-160 promoter results indicated that this promoter was capable of promoting the GFP expression in C. elegans with GFP proteins being mostly located in the anterior and distal part of the intestine.

As for paraffin section immunofluorescence staining and microinjection transgene assays, the possible causes for the lack of fluorescence in H. contortus or GFP in C. elegans could be summarized as follows. First, the polyclonal antibodies can be detected by western blot rather than the immunofluorescence staining of sections, which may be because the structure of the parasite antigen immobilized by paraformaldehyde is different from the linear structure in the western blot experiment. Secondly, it is possible that the antigen of CTL was damaged during the production of the slices, resulting in the fact that the antibody cannot specifically recognize and bind to it. Thirdly, the GFP expressed in the worms microinjected with Ce-lec-160 promoter, indicating that the promoter was able to efficiently initiate the expression of GFP. However, the ability to drive the expression of clec-160 gene was weak. The most likely reason for the failures of these two experiments is due to the rather low expression levels of clec-160 in H. contortus and C. elegans.

The mechanism of RNAi is divided into two procedures. First, dsRNA (double stranded RNA) is processed into small ds RNA (siRNA) of 21 to 23 nt. Then, the antisense strands of siRNA induce a ribosome called RNA-induced silencing complex (RISC), which can target homologous mRNA to silence the gene. Hc-clec-160 and Ce-clec-160 were ligated into the L4440 plasmid vector with a bidirectional T7 promoter at both ends of the inserted gene. L4440-Hc-clec-160 and L4440-Ce-clec-160 were transformed into E. coli HT115 (DE3) to induce dsRNA with IPTG. Later on, large numbers of RNAi knockdown worms were produced by feeding C. elegans on dsRNA-expressing bacteria. The abundance of Ce-clec-160 transcripts as a result of RNA interference was determined by qPCR. The relative abundance of mRNA indicates that Hc-clec-160 can partially silence Ce-clec-160, further confirming the genetic structure and possible functional similarities between the two homologous genes. Furthermore, the Ce-clec-160 (RNAi) phenotype showed much less abundant progeny and shorter body length than negative control worms, which indicates that Ce-CLEC-160 plays a significant role in the growth and development, and reproduction of C. elegans.

Helminth parasites possess the ability of modulating the host defense system in order to establish long-term infections in mammalian hosts [24, 25]. The glycans of schistosome eggs can be recognized by L-SIGN [26], DC-SIGN [27] and other members of the CTL family of its hosts, suggesting that the CLRs constitute an ancient host innate immune pattern recognition system. The parasite itself also has CTLs [28, 29], raising the possibility that they may affect host immunity [25, 30]. CTLs can also perform other functions within the nematode phylum. Most notably, C. elegans is predicted to have a minimum of 278 CTL-like genes in its genome and some have been experimentally certified to be upregulated and protective in bacterial infections. One example is CLEC-50 [31].

Hc-CLEC-160 is a new protein and, to our knowledge, its function has not been studied so far. In this study, we cloned the Hc-clec-160 gene and first analyzed its structures. The possible roles of Hc-clec-160 in H. contortus attachment to and invasion of host cells, and also in the escape of host immunity, remain to be determined experimentally. It is very challenging, if not impossible, to directly study H. contortus growth and development and reproduction in vitro due to the necessity of culturing L3s, L4s and adults. Nevertheless, the predicted structural features and characteristic of Hc-clec-160 gene reported in the present study along with the known functions of CTL- and CTLD-containing proteins in other organisms including the model nematode C. elegans implicate that Hc-clec-160 may play a significant role in H. contortus invasion and the host-parasite cell interactions.

Conclusions

In the present study, a novel gene Hc-clec-160 encoding a cDNA of 1224 bp in H. contortus was identified. The gene possesses one conserved domain of carbohydrate-recognition domains (CRDs) and contains 12 exons. A possible promoter in the 2000 bp sequence upstream of the 5'-flanking region was demonstrated by microinjection experiments. Furthermore, partially silencing the Ce-clec-160 in N2 worms of C. elegans achieved by RNAi with Hc-clec-160 showed that Hc-clec-160 shared similar characteristics and functions with Ce-clec-160 and plays a crucial part in the development and reproduction of H. contortus.

Additional file

Additional file 1: (1.7MB, tif)

Figure S1. Morphology and histology of male (a) and female (b) adults of H. contortus. Panels a and b represent H&E staining of worm paraffin sections at 10×. Scale-bars: 10 mm. (TIF 1691 kb)

Acknowledgments

We are grateful to Dr Yang CL (Institute of Genetics and Developmental Biology, Chinese Academy of Sciences), Dr Wang XC (the National Institute of Biological Science, Beijing) and Dr Ren CH (Academy of Military Medical Science, Beijing) for their help in the microinjection technology of Caenorhabditis elegans and for donating the vector.

Funding

The project was supported by a grant from the National Key Basic Research Program (973 Program) of China (No. 2015CB150300), the National Key Research and Development Program of China (No. 2017YFD0501200), the National Natural Science Foundation of China (No. 31602041), the Opening Fund of State Key Laboratory of Veterinary Etiological Biology (No. SKLVEB2016KFKT018) and the Science and Technology Plan Project of Jiaxing (No. 2016AY23025).

Availability of data and materials

The data supporting the conclusions of this article are included within the article and its additional files.

Abbreviations

BSA

Bovine serum albumin

cDNA

Complementary deoxyribonucleic acid

CRD

Carbohydrate-recognition domain;

CTL

C-type lectin

CTLD

C-type lectin domain

DAPI

4',6'-diamidino-2-phenylindole

dsRNA

Double stranded RNA

ELISA

Enzyme-linked immunosorbent assay

EPN

Glu-Pro-Asn

Fuc

Fucose

Gal

Galactose

GalNAc

N-acetylgalactosamine

GBP

Glycan-binding protein

GFP

Green fluorescent protein

Glc

Glucose

GlcNAc

N-acetyl-D-glucosamine

H&E

Haematoxylin and eosin

IPTG

Isopropy β-D-1-thiogalactopyranoside

JTT

Jones-Taylor-Thornton

Man

Mannose

ML

Maximum likelihood

MP

Maximum parsimony

mRNA

Messenger RNA

N2

Wild type

NGM

Nematode growth media

NJ

Neighbor-joining

PBS

Phosphate-buffered saline

PCR

Polymerase chain reaction

PFA

Paraformaldehyde

qPCR

Real-time quantitative PCR

rHc-CLEC-160

Recombinant Hc-CLEC-160

RNA

Ribonucleic acid

RNAi

RNA interference

RT-PCR

Reverse transcription PCR

siRNA

Small interfering RNA

vWA

Von Willebrand factor type A

vWF

Von Willebrand factor

WND

Trp-Asp-Asn

Authors’ contributions

LZ completed the isolation of Hc-clec-160, microinjection and defined the transcriptional levels of clec-160. LM preformed promoter activity analysis and relative quantification PCR of RNAi. XC carried out the RNAi experiments and performed the prokaryotic expression of Hc-clec-160. YY showed the characteristics of Hc-clec-160 and prepared the polyclone antibody. MH, XL, XS, X-QZ and AD critically revised the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

This study was approved by the Zhejiang University Experimental Animals Ethics Committee (ZJU201308-1-10-072). All animals were treated in accordance with relevant guidelines and regulations.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Footnotes

Electronic supplementary material

The online version of this article (10.1186/s13071-018-3005-3) contains supplementary material, which is available to authorized users.

Contributor Information

Ling Zhang, Email: 21517040@zju.edu.cn.

Lingyun Mou, Email: 394257646@qq.com.

Xueqiu Chen, Email: chenxueqiu@zju.edu.cn.

Yi Yang, Email: yangyi0607@zju.edu.cn.

Xiangrui Li, Email: lixiangrui@njau.edu.cn.

Xun Suo, Email: suoxun@cau.edu.cn.

Xing-Quan Zhu, Email: zhuxingquan@caas.cn.

Aifang Du, Email: afdu@zju.edu.cn.

References

  • 1.Zelensky AN, Gready JE. The C-type lectin-like domain superfamily. FEBS. 2005;272:6179–6217. doi: 10.1111/j.1742-4658.2005.05031.x. [DOI] [PubMed] [Google Scholar]
  • 2.Drickamer K. C-type lectin-like domains. Curr Opin Struct Biol. 1999;9:585–590. doi: 10.1016/S0959-440X(99)00009-3. [DOI] [PubMed] [Google Scholar]
  • 3.Vasta GR. Roles of galectins in infection. Nat Rev Microbiol. 2009;7:424–438. doi: 10.1038/nrmicro2146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Young AR, Meeusen EN. Galectins in parasite infection and allergic inflammation. Glycoconj J. 2002;19:601–606. doi: 10.1023/B:GLYC.0000014091.00844.0a. [DOI] [PubMed] [Google Scholar]
  • 5.Rabinovich GA, Gruppi A. Galectins as immunoregulators during infectious processes: from microbial invasion to the resolution of the disease. Parasite Immunol. 2005;27:103–114. doi: 10.1111/j.1365-3024.2005.00749.x. [DOI] [PubMed] [Google Scholar]
  • 6.Kim JY, Cho MK, Choi SH, Lee KH, Ahn SC, Kim DH, et al. Inhibition of dextran sulfate sodium (DSS)-induced intestinal inflammation via enhanced IL-10 and TGF-beta production by galectin-9 homologues isolated from intestinal parasites. Mol Biochem Parasitol. 2010;174:53–61. [DOI] [PubMed]
  • 7.Chernin J. A call for collaboration. Parasitol Today. 2000;16:83. doi: 10.1016/S0169-4758(99)01547-1. [DOI] [PubMed] [Google Scholar]
  • 8.Ortolani EL, Leal ML, Minervino AH, Aires AR, Coop RL, Jackson F, et al. Effects of parasitism on cellular immune response in sheep experimentally infected with Haemonchus contortus. Vet Parasitol. 2013;196:230–4. [DOI] [PubMed]
  • 9.Taylor CM, Martin J, Rao RU, Powell K, Abubucker S, Mitreva M. Using existing drugs as leads for broad spectrum anthelmintics targeting protein kinases. PLoS Pathog. 2013;9:e1003149. doi: 10.1371/journal.ppat.1003149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.LeJambre LF, Windon RG, Smith WD. Vaccination against Haemonchus contortus: performance of native parasite gut membrane glycoproteins in Merino lambs grazing contaminated pasture. Vet Parasitol. 2008;153:302–312. doi: 10.1016/j.vetpar.2008.01.032. [DOI] [PubMed] [Google Scholar]
  • 11.Gilleard JS. Understanding anthelmintic resistance: the need for genomics and genetics. Int J Parasitol. 2006;36:1227–1239. doi: 10.1016/j.ijpara.2006.06.010. [DOI] [PubMed] [Google Scholar]
  • 12.Kaminsky R, Ducray P, Jung M, et al. A new class of anthelmintics effective against drug-resistant nematodes. Nature. 2008;452:176–180. [DOI] [PubMed]
  • 13.Redman E, Sargison N, Whitelaw F, Jackson F, Morrison A, Bartley DJ, et al. Introgression of ivermectin resistance genes into a susceptible Haemonchus contortus strain by multiple backcrossing. PLoS Pathog. 2012;8:e1002534. [DOI] [PMC free article] [PubMed]
  • 14.Brenner S. The genetics of Caenorhabditis elegans. Genetics. 1974;77:71–94. doi: 10.1093/genetics/77.1.71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:4673–4680. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33:1870–4. [DOI] [PMC free article] [PubMed]
  • 17.Ding HJ, Shi HZ, Shi Y, Guo XL, Zheng XP, Chen XQ, et al. Characterization and function analysis of a novel gene, Hc-maoc-1, in the parasitic nematode Haemonochus contortus. Parasit Vectors. 2017;10:67. [DOI] [PMC free article] [PubMed]
  • 18.Zhang SO, Box AC, Xu N, Le MJ, Yu J, Guo F, et al. Genetic and dietary regulation of lipid droplet expansion in Caenorhabditis elegans. Proc Natl Acad Sci USA. 2010;107:4640–5. [DOI] [PMC free article] [PubMed]
  • 19.Colombatti A, Bonaldo P, Doliana R. Type A modules: interacting domains found in several non-fibrillar collagens and in other extracellular matrix proteins. Matrix. 1993;13:297–306. doi: 10.1016/S0934-8832(11)80025-9. [DOI] [PubMed] [Google Scholar]
  • 20.Perkins SJ, Smith KF, Williams SC, Haris PI, Chapman D, Sim RB. The secondary structure of the von Willebrand factor type A domain in factor B of human complement by Fourier transform infrared spectroscopy. J Mol Biol. 1994;238:104–119. doi: 10.1006/jmbi.1994.1271. [DOI] [PubMed] [Google Scholar]
  • 21.Soga K, Yamauch J, Kawai Y, Yamada M, Uchikawa R, Tegoshi T, et al. Alteration of the expression profiles of acidic mucin, sialytransferase, and sulfotransferases in the intestinal epithelium of rats infected with the nematode Nippostrongylus brasiliensis. Parasitol Res. 2008;103:1427–34. [DOI] [PubMed]
  • 22.Bhalchandra S, Ludington J, Coppens I, Ward HD. Identification and characterization of Cryptosporidium parvum Clec, a novel C-type lectin domain-containing mucin-like glycoprotein. Infect Immun. 2013;81:3356–3365. doi: 10.1128/IAI.00436-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ludington JG, Ward HD. The Cryptosporidium parvum C-type lectin CpClec mediates infection of intestinal epithelial cells via interactions with sulfated proteoglycans. Infect Immun. 2016:841593–602. [DOI] [PMC free article] [PubMed]
  • 24.Behnke JM. Evasion of immunity by nematode parasites causing chronic infections. Adv Parasitol. 1987;26:1–71. doi: 10.1016/S0065-308X(08)60294-8. [DOI] [PubMed] [Google Scholar]
  • 25.Maizels RM, Yazdanbakhsh M. Regulation of the immune response by helminth parasites: cellular and molecular mechanisms. Nat Rev Immunol. 2003;3:733–743. doi: 10.1038/nri1183. [DOI] [PubMed] [Google Scholar]
  • 26.Meyer S, Tefsen B, Imberty A, Geyer R, van Die I. The C-type lectin L-SIGN differentially recognizes glycan antigens on egg glycosphingolipids and soluble egg glycoproteins from Schistosoma mansoni. Glycobiology. 2007;17:1104–1119. doi: 10.1093/glycob/cwm073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.van Die I, van Vliet SJ, Nyame AK, Cummings RD, Bank CM, Appelmelk B, et al. The dendritic cell specific C-type lectin DC-SIGN is a receptor for Schistosoma mansoni egg antigens and recognizes the glycan antigen Lewis-x. Glycobiology. 2003;13:471–8. [DOI] [PubMed]
  • 28.van Liempt E, van Vliet SJ, Engering A, García Vallejo JJ, Bank CM, Sanchez-Hernandez M, et al. Schistosoma mansoni soluble egg antigens are internalized by human dendritic cells through multiple C-type lectins and suppress TLR-induced dendritic cell activation. Mol Immunol. 2007;44:2605–15. [DOI] [PubMed]
  • 29.Loukas AC, Maizels RM. Helminth C-type lectins and host-parasite interactions. Parasitol Today. 2000;16:333–9. [DOI] [PubMed]
  • 30.Loukas AC, Doedens A, Hintz M, Maizels RM. Identification of a new C-type lectin,TES-70, secreted by infective larvae of Toxocara canis, which binds to host ligands. Parasitology. 2000;121:545–554. doi: 10.1017/S0031182099006721. [DOI] [PubMed] [Google Scholar]
  • 31.Schulenburg H, Hoeppner MP, Bornberg-Bauer E. Specificity of the innate immune system and diversity of C-type lectin domain (CTLD) proteins in the nematode Caenorhabditis elegans. Immunobiology. 2008;213:237–250. doi: 10.1016/j.imbio.2007.12.004. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Additional file 1: (1.7MB, tif)

Figure S1. Morphology and histology of male (a) and female (b) adults of H. contortus. Panels a and b represent H&E staining of worm paraffin sections at 10×. Scale-bars: 10 mm. (TIF 1691 kb)

Data Availability Statement

The data supporting the conclusions of this article are included within the article and its additional files.


Articles from Parasites & Vectors are provided here courtesy of BMC

RESOURCES