Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2018 Jul 23.
Published in final edited form as: Biochim Biophys Acta. 2016 Nov 14;1863(1):92–102. doi: 10.1016/j.bbadis.2016.10.008

TNFa knockdown in the retina promotes cone survival in a mouse model of autosomal dominant retinitis pigmentosa

Tapasi Rana 1, Pravallika Kotla 1, Roderick Fullard 1, Marina Gorbatyuk 1,*
PMCID: PMC6056179  NIHMSID: NIHMS973997  PMID: 27750040

Abstract

Expression of T17M rhodopsin (T17M) in rods activates the Unfolded Protein Response (UPR) and leads to the development of autosomal dominant retinitis pigmentosa (adRP). The rod death occurs in adRP retinas prior to cone photoreceptor death, so the mechanism by which cone photoreceptors die remains unclear. Therefore, the goal of the study was to verify whether UPR in rods induces TNFa-mediated signaling to the cones and to determine whether the TNFa deficit could prevent adRP cone cell death.

Primary rod photoreceptors and cone-derived 661Wcells transfected with siRNA against TNFa were treated with tunicamycin to mimic activation of UPR in T17M retinas expressing normal and reduced TNFa levels. The 661W cells were then exposed to recombinant TNFa to evaluate cell viability. In vivo, the role of TNFa was assessed in T17M TNFa+/− mice by electroretinography, optical coherence tomography, histology, immunohistochemistry, and a cytokine enzyme-linked immunosorbent assay.

Rods overexpressed and secreted TNFa in response to UPR activation. The recombinant TNFa treatment lowered the number of viable cones, inducing cell death through elevation of pro-inflammatory cytokines and caspase-3/7 activity. The TNFa deficiency significantly protected adRP retinas. The photopic ERG amplitudes and the number of surviving cones dramatically increased in T17M TNFa+/− mice. This neuroprotection was associated with a reduced level of pro-inflammatory cytokines.

Our results indicate that rod photoreceptors, following UPR activation during adRP progression, secrete TNFa and signal a self-destructive program to the cones, resulting in their cell death. TNFa therefore holds promise as a therapeutic target for treatment of adRP.

Keywords: T17M rhodopsin, Retinal degeneration, Transgenic mice, Unfolded protein response, Tumor necrosis factor, Cone survival

1. Introduction

Inherited retinal dystrophies are currently associated with >190 identified genes (RetNet; https://sph.uth.edu/retnet/), with an overall prevalence for retinitis pigmentosa (RP) in up to 1 in 4000 individuals worldwide [1]. RP is characterized by extreme genetic and allelic heterogeneity and has been described as having autosomal dominant RP (adRP), autosomal recessive RP (arRP), and X-linked RP (xlRP) transmissions [2]. In most forms of RP, the rods are affected prior to cone damage [3] and people suffering from this disease show a progressive diminution of their peripheral visual fields. Visual decline then progresses relatively quickly to the far peripheral field, resulting in tunnel vision.

The molecular mechanisms by which gene mutations lead to photoreceptor apoptosis have not been clearly elucidated. The pathological mechanisms involved in rod photoreceptor cell death in degenerating retinas include, but are not limited to, activation of the Unfolded Protein Response (UPR) [4–6], inflammatory signaling [4,7–9], and oxidative stress, [10,11] eventually resulting in both apoptotic and non-apoptotic cell death [12–15]. Expression of human mutant T17M rhodopsin (T17M) in mouse rods results in severe retinal degeneration that mimics human adRP. The UPR or ER stress response is activated beginning at postnatal day 15 (P15) [16] and is involved in retinal degeneration in these mice [4], together with calpain-activated pathway [15,17] and inflammation [4]. Recent studies have highlighted the activation of microglia in the RP retina preceding photoreceptor cell death.

All these examples demonstrate that newly discovered cellular pathways will continue, for the foreseeable future, to add to the larger picture of pathobiology of the RP retina. For example, although the presence of inflammatory markers has been recognized in rodent models of RP for a long time, the occurrence of immune system cells in the anterior vitreous cavity of RP subjects has only recently been reported by slit-lamp biomicroscopy [8]. The use of Iba1 specific antibodies by others and us has also revealed that microglial cells, which normally reside in the outer plexiform layer, become activated from the very beginning of photoreceptor death in T17M [4], Rd10 [18], and MERTK−/− [19] mice. The up-regulation of pro-inflammatory mRNAs in Rd and T17M mice also occurs prior to peak photoreceptor cell death [4,20].

In 2008, Punzo et al. [21] analyzed four different models of RP and found a common temporal feature of cone deterioration upon RP: it always started with a central-to-peripheral progression after the major phase of rod death. Interestingly, the T17M cones demonstrate loss of function as early as one month of age as measured by photopic ERG, suggesting that the pro-death signaling in these cells has already been initiated (unpublished observation). However, neither a signaling molecule nor a retinal cell type transmitting this signal to the cones in degenerating retinas has yet been identified, suggesting that future research should be focused on cell-to-cell interactions. Previous studies have proposed that deprivation of rod-derived trophic factor(s), environmental alterations (such as liberation of toxins), loss of rodcone gap junctions, microglia mobilization, or oxidative stress associated with rod apoptosis could explain secondary cone photoreceptor cell death in degenerating retinas [22]. However, Punzo and colleagues [21] demonstrated that genes involved in rod metabolism, such as those of the insulin/mTOR signaling pathway, are most affected, as indicated by the massive rod loss in four mouse models of RP. This loss, in turn, might render the cones vulnerable over time.

In addition to metabolic instability in RP retinas, a recent study has demonstrated involvement of the pro-inflammatory TNFa cytokine [14,15,23,24] and the TNF receptor-associated factor (TRAF2) [10,13], which may facilitate apoptotic rod cell death in the T17M retina through activation of the c-Jun N-terminal kinase (JNK)/c-Jun. A number of studies have supported a contribution of TNF receptors to cytotoxicity. Even non-toxic picogram concentrations of TNFa can silence survival signals and induce neuronal cell death [25]. TNFa is reportedly involved in both caspase-dependent and caspase-independent components of the mitochondrial cell death pathway, acting by modulating ion channel activity and thereby regulating neuronal excitability, synaptic plasticity, and excitotoxic injury, as well as by increasing levels of endothelin (ET)-1, a potent vasoactive peptide, which can induce optic nerve damage [26].

In 2015, Zeng and coworkers [20] reported an increase in TNF-production by microglia cells during retinal degeneration in Rd mice and they suggested that TNFa may serve as both a target and an inducer gene of NF-kB in RP. These findings prompted the present investigation into the possibility that TNFa cytokine could serve as signaling molecule, transmitted by dying rods to the cones, and trigger a major cone cell death pathway in the RP retina.

The aim of the present study was therefore to investigate whether adRP rod photoreceptors, upon experiencing UPR activation, express and secrete TNFa and to determine whether TNFa could serve as a signaling molecule that transmits a pro-death signal to the cones, promoting their cell death. The significance of the proposed study is that it seeks to validate the important hypothesis that blocking of TNFa and inflammatory signaling in RP retinas might represent a potent therapeutic approach for RP treatment.

2. Materials and methods

2.1. Animals

Age- and sex-matched C57BL/6, TNF+/− (henceforth, TNFa), T17MRHO (henceforth, T17M), and T17MRHO TNFa+/− (henceforth, T17M TNFa) mice were used in the study. Transgenic mice expressing human T17M rhodopsin, C57BL6/J, RHO−/− and TNFa knockout mice were used in this study to generate T17M RHO+/− (T17M) and T17M RHO+/− TNFa+/− (T17M TNFa+/−) carrying mutant and endogenous mouse rhodopsins. These mice were compared with control groups of C57BL6/J and TNFa+/− mice, expressing two copies of endogenous mouse rhodopsin. All the mice had the same genetic background as C57BL/6J mice. Retinas or eyes were collected at 1 and 3 months of ages. Animals were anesthetized as previously described for the ERG and OCT procedures [4]. The animal use protocol was approved by the University of Alabama at Birmingham Institutional Animal Care and Use Committee.

2.2. Photoreceptor cell culture

We used C57BL/6 mice for this experiment. Photoreceptor cell cultures were obtained by collecting the retinas, keeping them on ice, and washing with a mixture of neurobasal media and antibiotics (2000 U/ml penicillin/streptavidin in media). The retinas were then incubated with papain enzyme in neurobasal media at 37 °C for 8 min to dissociate the retinal cells. After dissociation, the cells were cultured with a mixture of neurobasal medium A (NBA; Invitrogen, Carlsbad, CA, USA), 5% FBS, supplemented with 1:50 B27 (Invitrogen) and 0.5 mM l-glutamine (Sigma Aldrich, St. Louis, MO, USA) either in small 3 cm dishes or 8-chamber slides precoated with wheat germ agglutinin (WGA). The cells were allowed to attach overnight and were then treated with tunicamycin (0.01 µg/µl) for 24 h at 37 °C. After harvesting and multiple washings, the cells were analyzed by qRT-PCR, cell viability counts, and immunohistochemistry.

The dishes and 8-chamber slides were precoated with anti-WGA lectin antibody to promote optimal attachment. Dishes and slides were incubated for 2 h at 37 °C with 2.5 µg/cm2 anti-WGA antibody (Vector Laboratories, Burlingame, CA, USA) diluted in 25 mM bicarbonate buffer, pH 8. This buffer included 0.9% NaCl and 2 mg/ml BSA (BSA, Fraction V; Sigma Aldrich). After 2 h and four washes with warm bicarbonate buffer, dishes and slides were recoated with 5 µg/cm2 WGA lectin (Vector Laboratories, Cat. # L1020, Burlingame, CA) diluted with bicarbonate buffer for 2 h at 37 °C. The dishes and chamber slides were then washed with warm phosphate buffered saline (PBS, pH 7.4) and used for further experiments [27].

The authentication of primary photoreceptor cells was performed using primer sequences and the PCR conditions described by Otteson and Phillips [28]. After conversion of the RNA extracted from cultured primary photoreceptor cells to cDNA, we amplified microglial AIF1 using 5′-forward CTGGAGAAACTTGGGGTTCC and 5′-reverse GACATCCACCTCCAATCAGG primers. Additionally, GFAP was amplified to verify the presence of glial cells using 5′-forward AAGCTCCAAGATGAAACCAACCTGA and 5′-reverse CTTGGCCACATCCATCTCCA primers. We employed 5′-forward TGCAAGAACCCAAATTCTCC and 5-reverse TGGG CGAGGTAGAAGTGC primers to identify the retinal ganglion cell marker Pou4F3. 5′-forward TCTGCTGGCTTCCCTACG and 5′-reverse ATCTCCCAGTGGATTCTTGC primers were used to confirm rhodopsin expression in isolated photoreceptors.

2.3. RNA and cDNA isolation for qRT-PCR

Photoreceptor cells (4 × 105) were collected for RNA isolation after 24 h of tunicamycin treatment. Total RNA was extracted using Trizol reagent (Invitrogen). Synthesis of cDNA from mRNA transcripts was performed using the SuperScript III first-strand synthesis kit (Invitrogen; Cat. # 18080-051). The PCR protocol included: 50 °C for 2 min and 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min. The Tnfa and Gapdh mRNA levels (Applied Biosystems, Carlsbad, CA, USA) were analyzed. qRT-PCR was performed by using 50 ng of cDNA mixed with TaqMan Universal PCR master mix (Applied Biosystems) in the StepOnePlus Real-time PCR system (Applied Biosystems). The fold changes were calculated by dividing the mean of the relative quantities (RQs) for the treatment by the mean RQ of control at each time point. The results were analyzed by plotting the data in GraphPad Prism (GraphPad Software, Inc., La Jolla, CA, USA) and using the t-test for statistical significance.

2.4. Immunocytochemistry

The primary photoreceptor culture (4 × 105 cells), as well as 661W cone-derived photoreceptor cells, were fixed with freshly prepared 4% paraformaldehyde. Cells were blocked with PBS containing 10% goat serum, 0.3 M glycine, 1% BSA, and 0.1% Tween 20 for 2 h at room temperature. The anti-TNFa primary antibody (Cat. # ab1793) was diluted 1/100 and incubated with the sample overnight at 4 °C. Alexa Fluor® 488 goat antimouse polyclonal antibody, at a dilution of 1/250, was used as the secondary antibody [29].

2.5. Cell viability assay

Primary photoreceptor cultured cells and an immortal 661W cell line were fixed with 4% paraformaldehyde for 10 min. After three washings, 5% crystal violet was added on an 8-chamber slide for 45 s, followed by three washes with water and air drying. The cells stained with crystal violet were then counted.

2.6. Culturing of 661W cells into conditioned media from primary rod photoreceptors

12 × 103 661W cells were cultured overnight with 2% FBS. The next morning, conditioned medium harvested from Tn-treated rod photoreceptors was applied to culture of 661Wcells. After 24 h of the treatment, we performed a cell viability assay as described above to determine consequences of the treatment.

2.7. Treatment of 661W cell line with recombinant TNFa

The 661W cone-derived photoreceptor cells were treated with recombinant TNFa (22 ng/ml; R & D Systems Inc., Minneapolis, MN) for 24 h, as described previously [30–32]. Cells were plated in 8-chamber slides in order to perform the crystal violet assay (2 × 104) and in tissue culture plates for western blot analysis (1.6 × 106) at different time points. A 50 µg protein sample was used for determination of caspase activity (Caspase-Glo 3/7 system kit, Cat. # G8090, Promega, Madison, WI).

2.8. Transfection of 661W cell line with siRNA for cell viability assay and western blot analysis

661W cells were seeded at a count of 5 × 104 cells into 8-chambered culture slides with DMEM containing 10% serum and antibiotic. Three hours prior to transfection, the media was replaced by OPTI-MEM (Cat. # 31985062, Life Technologies) with 2% serum. Cells were transfected with 50 nM control (non-targeting) (Cat# D-001206-13-05, Dharmacon, Lafayette, CO, USA) and mouse TNFa (Cat. # D-042302-02-0005, Dharmacon) siRNA's using OPTI-MEM and Lipofectamine RNAiMAX reagent (Cat. # 13778030, Life Technologies) as per manufacturer's protocol. Six hours after transfection, certain groups were treated with tunicamycin at a concentration of 0.01 µg/µl. A cell viability assay was performed 18 h after the tunicamycin treatment using crystal violet.

Another set of transfected 661W cells was used to determine the level of TNFa by western blot analysis 36 h after the tunicamycin treatment. Protein lysates were prepared and 60 µg of protein was used for the detection of TNFa (anti-TNFa mouse monoclonal (1:800) (Cat. # ab1793, Abcam), and GAPDH (anti-GAPDH rabbit polyclonal (1:1000), Cat. # ab9485, Abcam). Goat-antimouse IR Dye (1:10,000 Cat. # 926-32210, LI-COR Inc.) and Donkey-antirabbit IR Dye (1:10,000 Cat# 926-68073, LI-COR Inc.) were used as secondary antibodies.

2.9. Western blotting analysis

The 661W cell line (1.6 × 106) was used for western blotting analysis. In brief, cells were plated in a 100 mm Petri dish and were allowed to attach. On the following day, cells were treated with recombinant TNFa. A parallel group was kept as a control (no TNFa treatment). After 24 h of TNFa treatment, both treated and untreated cells were harvested and protein lysates were prepared using a lysis buffer containing NP40, 50 mM Tris, 150 mM NaCl, and 1% Triton X-100. Protein was estimated using the Bio-Rad assay (Cat. # 500-0006, Bio-Rad Laboratories, Hercules, CA). Forty micrograms of protein from lysates was used for detection of NF-kB (1:1000) (anti-NF-kB p65 rabbit polyclonal, Cat. # 06-418, Millipore, Billerica, MA), TRAF2 (1:1000) (Cat. # 4712, Cell Signaling, Danvers, MA), TNFa (1:1000) (anti-TNFa mouse monoclonal Cat. # ab1793), IL-6 (1:1000) (Cat. # ab6672, Abcam, Cambridge, MA) and anti-beta actin (1:1000) (mouse monoclonal (Cat # A1978, Sigma Aldrich, St. Louis, MO) expression using SDS-PAGE. Horseradish peroxidase-conjugated goat anti-rabbit (1:10,000) (Cat. # 31460, Thermo Scientific, Waltham, MA) and goat-antimouse IR Dye (1:10,000) (Cat. # 926-32210, LI-COR, Inc., Lincoln, NE) were used as the secondary antibodies. The binding of these antibodies to the blots was detected with enhanced chemiluminescence (NEL104001EA; PerkinElmer, Waltham, MA) following the manufacturer's instructions. Blots were stripped and reprobed with beta actin or GAPDH with anti-mouse secondary antibody to enable normalization of signals between samples. Band intensities were analyzed using ImageJ software [29].

2.10. Histological analysis

The mouse eyeballs were enucleated, fixed with 4% freshly prepared para-formaldehyde (Cat. # S898-09 J.T. Baker, Phillipsburg, NJ), and kept at 4 °C for 7–8 h. The eye cups were transferred to 30% sucrose after washing with PBS. Eye cups were then embedded in cryostat compound (Tissue Tek OCT, Sakura Finetek USA, Inc. Torrance, CA) and frozen at −80 °C. Twelve-micron sections were obtained using a cryostat. The nuclei of the photoreceptors were visualized by staining the sections with hematoxylin and eosin (H&E) using an H&E stain kit (Cat. # 3490, BBC Biochemical, Sunnyvale, CA). Other slides were used for immunohistochemistry. Digital images of the right and left retinas of individual mice were used and the outer segment length was calculated in the central superior and inferior retina, located equidistant from the optic nerve head. Images were analyzed by an investigator blinded to the experimental treatments. All sections were examined with a microscope equipped with a digital camera (Carl Zeiss Axioplan2 Imaging Microscope, B000707, Carl Zeiss, Gottingen, Germany) [4].

2.11. Cone photoreceptor count

Twelve-micron sections from mouse retina were fixed onto polylysine-coated glass slides. Slides were warmed for 30 min at 37 °C and washed with PBS. Slides were rinsed in PBS containing 0.05% Tween-20 and labeled using FITC-conjugates PNA lectin from Arachis hypogea (1:40) (Cat. # L7381, Sigma-Aldrich, St. Louis, MO) overnight at 4 °C. After washing, mounting medium containing DAPI was added to the slides and was allowed to dry for 1 h. Images were taken using a microscope (Carl Zeiss Axioplan2 Imaging Microscope, B000707, Carl Zeiss).

2.12. Spectral domain optical coherent tomography

SD-OCT measurements were performed on anesthetized mice at P30 using the spectral Domain Ophthalmic Imaging System (SDIOS) (Bioptigen, Morrisville, NC, USA). Horizontal volume scans through the area dorso-temporal from the optic nerve (superior) and the area ventro-temporal from the optic nerve (inferior) were used to calculate the thickness of the outer nuclear layer (ONL). The thickness of the ONL was measured by placing eight calipers in the superior and inferior hemispheres of the retinas within 100, 200, 300, and 400 µm of the ONH; the average of ten measurements was used for this thickness [4].

2.13. Electroretinography

Mice were kept in the dark for 12 h and anesthetized by IP injection of a mixture of 50 mg ketamine and xylazine/kg bodyweight. Pupils were dilated using phenylephrine (Bausch and Lomb, Tampa, FL, USA). A reference electrode was placed between the eyes, and a ground electrode was inserted into the tail. Recording for both eyes was performed simultaneously with balanced electrical impedance. Scotopic and photopic ERG was measured (LKC Technologies Bigshot Ganzfeld Stimulator, Gaithersburg, MD, USA), as previously described [4].

2.14. TNFa ELISA

Conditioned media from 661W cells (24 h and 48 h) were used for these assays. TNFa levels were detected using a Quantikine Elisa kit (R & D Systems, Minneapolis, MN) as per the manufacturer's instructions. In brief, conditioned media were added to microplates precoated with mouse polyclonal TNF alpha antibody. The plates were then incubated and washed to remove unbound TNFa and an enzyme-linked mouse polyclonal antibody was added. After addition of the substrate, the absorbance of the colored solution was measured at 450 nm using a microplate reader. Samples were measured in triplicates and TNFa concentrations were calculated from a standard curve using Softmax Prosoftware (Molecular Devices, Sunnyvale, CA), as previously described [33].

2.15. Multiplex cytokine measurement

A microparticle (bead)-based multiplex cytokine assay [12,17] (Bio-Plex Cytokine Assay; Bio-Rad Laboratories) was used for simultaneous measurement of multiple cytokines in mouse retina tissue lysates, following the manufacturer's recommended protocol. Tissue samples were diluted (200–900 µg/ml) with diluent buffer and cytokine standards were prepared using the manufacturer-supplied diluent (Bio-Plex Human Serum Diluent; Bio-Rad Laboratories). Background fluorescence was determined by running quadruplicate samples where sample diluent was substituted for tissue lysate. A vacuum filtration system was used for all washing steps. In brief, cytokine standards or diluted retina tissue samples were added to wells of a 96-well plate, which contained cytokine detection beads coated with anti–cytokine antibodies. The plate was then sealed and placed on an orbital shaker (300 rpm or otherwise, as noted) for 30 min at room temperature. After this incubation, the plate was washed, secondary antibody was added, and the plate was incubated for a further 30 min. The plate was then washed, streptavidin-phycoerythrin detection reagent was added, and the plate was incubated for 10 min. The beads were then washed, resuspended in 125 µl wash buffer, and shaken for 30 s at 1100 rpm. The plate was read with a Luminex 100 Bio-Plex Array Reader (Bio-Rad Laboratories) that uses Luminex technology (Luminex Corporation, Austin, TX, USA). The mean fluorescence of 200 beads for each cytokine was used to determine the mean fluorescence intensity of each well. The Luminex 100 software (Bio-Rad Laboratories) was used to convert fluorescence readings to cytokine concentrations using a calibration curve derived from a five-parameter logistic fit of fluorescence readings of the cytokine standards. Only concentrations within the lower and upper range were extrapolated.

2.16. Statistical analysis

The data are expressed as the mean ± S.E.M. Two-way ANOVA comparisons were used to calculate differences in the a- and b-wave ERG amplitudes and in the average ONL thickness of inferior and superior retinas in 1-, 2- and 3-month-old mice. A one-way ANOVA and t-test were used to calculate a fold change of mRNA expressions and a level of normalized proteins in P30 retinas. For all experiments, a P-value lower than 0.05 was considered significant (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001).

3. Results

3.1. The Unfolded Protein Response in primary rod photoreceptors is a powerful TNFa-inducer

The rod photoreceptors in the retina of mouse RP models expressing aberrant rhodopsins are known to undergo activation of the UPR [4,34–37]. Our previous study demonstrated that activated UPR could be associated with the inflammatory response in the retina of an experimental model [4]. Therefore, we queried whether the UPR might induce TNFa in rod photoreceptor cells. For this reason, we collected mouse retinas and isolated rod photoreceptors cells on plates treated with anti-WGA lectin antibody. Before starting the experiment, we confirmed the purity of the primary photoreceptor cells and the lack of additional sources of TNFa, such as glial cells, by RT-PCR and immunohistochemical analysis (Fig. S1). After authentication of isolated cells, the rod photoreceptors were seeded. We treated the cells with a previously validated dose of tunicamycin (Tn) [4], a known potent activator of the UPR. After 24 h of treatment, we performed immunohistochemical analysis and fluorescence microscopy revealing that UPR activation significantly induces TNFa protein production in primary rod photoreceptors and leads to reduced rod photoreceptor viability (Fig. 1A, B, and C, Table S1). The relative fluorescence measured in Photoshop6 as a total fluorescence intensity per cell was significantly higher and the number of surviving rods was significantly lower in the Tn-treated cells, implying the involvement of UPR-induced TNFa in rod cell viability. We next confirmed this result in other experiments by performing immunohistochemical analysis (Fig. 1D) and cell viability counting of 661W cells treated with Tn (Fig. 1E and Table S1). Therefore, we concluded that the UPR activation directly resulted in an increase in TNFa.

Fig. 1.

Fig. 1

Open in a new tab

Activation of UPR increases TNFa expression in primary and cultured photoreceptor cell lines. A, Primary rod photoreceptor cells were treated with tunicamycin (Tn) for 24 h to activate the Unfolded Protein Response. After the treatment, the cells were fixed and immunohistochemical analysis was performed to detect TNFa (green) and nuclei stained with DAPI (blue). B and C, Cells were also stained with crystal violet to determine the number of viable cells after the treatment. B, Image of Tn-treated primary photoreceptor cells stained with the crystal violet. C, The treatment resulted in a high rate of photoreceptor cell death. D, The cone-derived 661W cells were treated with Tn to confirm TNFa upregulation. E, Treatments of both primary rod photoreceptor and 661W photoreceptor cell lines resulted in increased relative fluorescence (measured as averaged fluorescence intensity divided per number of counted cells). F, qRT-PCR at 24 h post-treatment revealed that primary rod photoreceptors respond to Tn treatment with an over 3-fold up-regulation of Tnfa mRNA (P = 0.009). G, At this time point, the treatment also resulted in TNFa release into conditioned medium (measured with a TNFa ELISA kit) compared to untreated controls (P = 0.0003). Four replicates of each experiment were performed. Data were analyzed by the t-test and are shown as mean ± S.E.M. (**P < 0.01, ***P < 0.001). H, Conditioned media from the control and Tn-treated primary rod photoreceptors were harvested to culture 661W cells. 24 h treatment resulted in significant reduction in numbers of viable 661W cells (P =0.005) growing in Tn-positive medium. I, Images of 661W cells cultured on control and Tn-positive conditioned media stained with the crystal violet. Five replicates of each experiment were performed. Data were analyzed by the t-test and are shown as mean ± S.E.M. (**P < 0.01). J, Knockdown of TNFα significantly increased survival rate in 661Wcells treated with Tn. While no difference between Tn-treated cells and cells transfected with control siRNA prior the Tn treatment was detected (NS), transfection with siRNA targeting the TNFα significantly increased the 661W cell viability almost 2-fold as compared to control treatment with Tn (****). The difference between cells with no treatment and cells with Tn treatment following by siRNA's transfections was statistically significant (****). Data were analyzed by the one-way ANOVA and are shown as mean ± S.E.M. (**P < 0.01, ****P < 0.001). K, Image of Tn-treated 661W cells stained with the crystal violet. The Tn treatment resulted in a high rate of photoreceptor cell death while preliminary knockdown of TNFa in these cells significantly increased the survival rate. L, Transfection of 661Wcells with siRNA against TNFa following by the treatment with Tn significantly reduced the TNFa level in 36 h as measured by western blot analysis (*P < 0.05 as compared to mock or control siRNA + Tn cells), while Tn only and control siRNA + Tn cells had significant upregulation of TNFa as compared to mock, **P < 0.01). At the bottom: Representative images of blots treated with antibodies against TNFa and GAPDH as an internal control.

The primary rod photoreceptors responded to Tn treatment with over a 3-fold increase in the Tnfa mRNA and an increase in TNFa secretion into conditioned media (Fig. 1F and G). Therefore, we decided to culture 661W cells into conditioned media harvested from the control and Tn-treated primary rod photoreceptors secreting the TNFa (Fig. 1H and I). Results of the 24 h treatment demonstrated almost a 2-fold reduction in the number of viable 661W cells cultured on conditioned medium from Tn-treated photoreceptors as compared to control medium.

Because of the TNFa increase in treated primary photoreceptors, we decided to validate TNFa as a potential mediator of photoreceptor cell death and used 661W cone-derived cells extensively employed in the recent retinal cell biology research to study cytokines [38–40]. The 661W cells were preliminary transfected with siRNA, targeting the TNFa mRNA, and were then treated with Tn. After 24 h of treatment we performed cell viability count comparing siRNA against TNFa with irrelevant siRNA (Fig. 1J and K). Results of the experiment demonstrated that while 60% reduction of viable cells was found with 661W cells transfected with control siRNA and treated with Tn, cells transfected with siRNA against TNFa showed increased rate of survival upon the Tn treatment. The 39% reduction of viable cells in this group was statistically different from the cells that received the Tn only. However, this number was still lower than in control group. Increase in viability of 661W cells treated with siRNA-TNFa correlated with the decrease in TNFa measured by western blot analysis. Thirty six percent and thirty two percent downregulation of TNFa were found in 661Wcells treated with siRNA-TNFa and Tn as compared to Tn only and control siRNA + Tn, respectively (Fig. 1L).

The observation of elevated TNFa secretion and the reduced viability of 661W cells growing on conditioned medium from Tn-treated rods were of special interest. This data suggested that the UPR activation in T17M retinas could also stimulate TNFa secretion into the extracellular space by rods experiencing stress, and that secreted TNFa may be harmful for other retinal cells, such as cones. Therefore, our next experiment was designed to test the hypothesis that secreted TNFa could promote cone photoreceptor cell death and to highlight the signaling involved in cone cell death.

3.2. Treatment of cone-derived 661W cells with TNFa results in cell death through activation of pro-inflammatory signaling

Reduced viability of 661W cells cultured on TNFa secreted conditioned medium is not a direct proof that TNFa induces the 661W cell death. Therefore, in the next experiment, we treated cone-derived 661W cells with recombinant (r)TNFa for 48 h to simulate TNFa uptake by the cones in adRP retinas. The dose for the (r)TNFa treatment was chosen based on experiments described in the literature [41]. In our study, cells were either fixed and stained with crystal blue to count the number of viable cells (Fig. 2A and B, Table S1) or they were collected for individual mRNA and protein estimations (Fig. 2C and D). A 48 h treatment with TNFa reduced the number of viable cells by 63%. The cone photoreceptor cell death was associated with activation of Csp-3/7, suggesting involvement of apoptosis in rTNFa-treated cone photoreceptor cell death. In addition to apoptosis, the cone cell death was also accompanied by an almost 5-fold elevation of Tnfa mRNA, a 1.4-fold increase in NF-kB (p65) expression, and a 1.6-fold up-regulation of pro-inflammatory IL-6 cytokine. Therefore, exogenous TNFa molecule clearly promoted cone photoreceptor cell death and appeared to be a possible signaling molecule that was transmitting a pro-death signal from the dying rods to the cone photoreceptors. In this case, the cone photoreceptor cell death appeared to occur through apoptosis and activation of inflammatory signaling.

Fig. 2.

Fig. 2

Open in a new tab

Treatment of 661W cells with recombinant TNFa. Cells were treated with 22 ng/ml of TNFa for 48 h, fixed, and stained with crystal violet. A, B Images were taken using bright field microscopy to calculate the number of viable cells in the field. C, The Caspase-Glo-3/7 Luciferase assay determined that death of 661Wcells treated with recombinant TNFa occurs through Csp-3/7 activation. The treatment of 661W cells also resulted in an increase in Tnfa mRNA expression, as measured by qRT-PCR (N = 4) and an increase in TNFa, NF-kB, and IL-6 protein elevation, as detected by western blotting (N = 4). D, Western blotting of protein extracts of TNFa-treated and untreated cells run on acrylamide gels. Representative images of blots treated with antibodies against TNFa, IL-6 and NF-kB (p65) are shown. Data were analyzed by the t-test and are shown as mean ± S.E.M. (**P < 0.01, ***P < 0.001).

The next set of experiments was designed to validate the hypothesis that a deficit in TNFa in adRP retinas could delay the onset of retinal degeneration in mice and to determine whether T17M cones could benefit from TNFa knockdown in the retina.

3.3. TNFa deficit in T17M retinas prevents rod-associated functional loss

We analyzed four groups of mice: wild type (C57BL6), TNFa+/− (henceforth, TNFa), T17M, and T17M TNFa+/− (henceforth, T17M TNFa). Subsequent scotopic ERGs with 1-, 2-, and 3-month-old animals revealed that both a- and b-amplitudes were significantly preserved in T17M TNFa from the decline (Fig. 3A, Table S1, N = 6) as compared to T17M mice. For example, the a-wave amplitude was not statistically different in 1-month-old T17M TNFa and C57BL6 mice (NS); however, it was significantly elevated when compared to levels in the T17M mice (P < 0.0001). In 2- and 3-month-old mice, the a-wave amplitudes decreased in the TNFa-deficient T17M mice when compared to the C57BL6 mice (P < 0.05 and P < 0.0001, respectively); however, these amplitudes were still higher when compared to those of the T17M mice (P < 0.0001 and P < 0.05, respectively). These scotopic ERG recordings therefore revealed a significant preservation of rod-originated a-wave amplitudes in the TNFa-deficient T17M retinas at one month and confirmed a delay in rod photoreceptor functional loss in the subsequent two months of life.

Fig. 3.

Fig. 3

Open in a new tab

The deficit in TNFa in T17M mouse retinas protects against retinal degeneration, preserves retinal structure, and prevents photoreceptor cell death. A, A two-way ANOVA demonstrated that a- and b-wave amplitudes of the scotopic ERG were significantly preserved in T17M mice deficient in TNFa for the first three months of life when compared to T17M retinas (N = 6) (****P < 0.0001). The a-wave of 1-month-old and the b-waves of 1- and 2-month-old T17M TNFa mice were not statistically different from recordings registered in wild type C57BL6 retinas (NS). The a-wave amplitudes in 2- and 3-month-old and the b-wave in 3-month-old T17M TNFa mice were diminished when compared to the amplitudes of C57BL6 retinas (##P < 0.01, ####P < 0.001 and ##P < 0.01, respectively). B, We analyzed four groups of 1-month-old animals (N = 6) using SD-OCT and one-way ANOVA and presented the data as spidergrams. Data analysis of the inferior and superior retinas revealed significant preservation of the T17M TNFa retinas in terms of retinal structural integrity when compared to the degenerated T17M retinas (gray stars). However, the average outer nuclear layer (ONL) thicknesses in these animals were still lower than those of wild type C57BL6 retinas (black stars). (C) Histological analyses of cryostat sectioned retinas from C57BL6, TNFa, T17M, and T17M TNFa mice; sections were stained with hematoxylin and eosin (H&E). ANOVA results for photoreceptor counts in 3-month-old mouse retinas show preservation of photoreceptors against cell death in T17M TNFa mice. D, Representative SD-OCT images of C57BL6, TNFa, T17M and T17M TNFa mouse retinas. E, Representative images of 3-month-old C57BL6, TNFa, T17M and T17M TNFa mouse retinas stained with H&E. RGC, retinal ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer; IS, inner segments; OS, outer segments. Scale bar indicates 50 µm. Data are shown as mean ± S.E.M. (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001).

The b-wave scotopic ERG amplitudes were not significantly different in the T17M TNFa and the C57BL6 mice during the first two months of life and they declined only at 3 months of age (P < 0.01). At this time, they were not statistically different from the amplitudes recorded in T17M retinas (NS). Therefore, scotopic ERG recording demonstrated the prevention of bipolar cell functional loss in TNFa deficient mice for the first 2 months of life.

3.4. TNFa deficit in T17M retinas delays photoreceptor cell death

Analysis of the retinal structure by SD-OCT imaging analysis for four groups of one-month-old animals revealed that the prevention of photoreceptor functional loss in T17M TNFa mice was associated with preservation of retinal integrity (Fig. 3B, Table S1). The average ONL thickness was significantly higher in both the inferior and superior regions of the retinas within 400 µm interval from the optic nerve head in one-month-old T17M TNFa mouse retinas than in T17M retinas. However, the T17M TNFa ONL thickness was still lower than that of C57BL6 retinas, indicating that some morphological changes in T17M TNFa photoreceptors had already occurred.

These changes reflected some loss of photoreceptor cells, which was confirmed by counting photoreceptor nuclei in retinas from 3-month-old T17M TNFa mice (Fig. 3C, Table S1, N = 4). Three rows of photoreceptor nuclei were lost in the T17M TNFa retinas when compared to C57BL6 mice (P < 0.0001). However, the number of remaining photoreceptors was nonetheless dramatically higher than the number of remaining photoreceptors counted in T17M retinas (P < 0.0001). Next, we addressed which type of photoreceptor cells contribute to this photoreceptor cell survival by analyzing cone photoreceptor functional loss and survival in T17M TNFa retinas.

3.5. Lack of TNFa in T17M retinas prevents cone-associated functional loss and delays cone photoreceptor cell death

We initially performed a photopic ERG recording to test whether cones in T17M TNFa retinas could be preserved (Fig. 4A, Table S1, N= 6). At P40, both the a- and the b-wave amplitudes were comparable with ones registered in C57BL6 mice (NS). This would suggest that the TNFa deficit in T17M retinas is sufficient to prevent cone photoreceptors from functional decline at P40 and implies that the delay in cone photoreceptor cell death would be observed at late time points. Our subsequent analysis of retinas of 3-month-old mice revealed an increase >3-fold in the number of cones in the vision field in the T17M TNFa retinas than in the T17M retinas (P < 0.0001). However, even though the difference between T17M TNFa and C57BL6 retinas was not significant (NS) when analyzed by one-way ANOVA, the T17M TNFa retinas had 6 cones fewer per vision field when compared to C57BL6 retinas. Therefore, results of this experiment indicate that the TNFa downregulation in the adRP retina significantly prolongs cone survival and delays their functional failure. However, the question of how cones die in T17M retinas remains to be addressed. The finding that TNFa uptake by cones results in photoreceptor cell death through apoptosis and inflammatory signaling led us to the next experiment, where we analyzed both adRP groups for activation of pro- and anti-inflammatory factors.

Fig. 4.

Fig. 4

Open in a new tab

TNFa deficit in adRP mice results in prevention of functional loss and cell death of T17M TNFa cone photoreceptors. A, One-month-old animals (N = 6) were tested using photopic ERG (N = 6). The a- and b-wave amplitudes were significantly diminished in T17M retinas (P < 0.0001 as compared to C57BL6), whereas knockdown of TNFa in T17M animals led to preservation of both ERG amplitudes; no difference was noted between C57BL6 and T17M TNFa mice (NS). B, Immunohistochemical analysis of PNA-stained retinas from 3-month-old mice demonstrated protection of T17M TNFa mice from cone photoreceptor cell death (N = 4). Fluorescence microscopy images of PNA-positive cells were used to calculate cone photoreceptor cell loss in the field. One-way ANOVA demonstrated preservation of T17M TNFa retinas against declines in cone photoreceptor cell number when compared to wild type C57BL6 (NS) or T17M (P < 0.0001) retinas, whereas T17M retinas showed significant cone photoreceptor cell loss when compared to C57BL6 retinas (P < 0.0001). C, representative images of retinas from all four groups, stained with PNA (green) to show cone photoreceptors and DAPI (blue) to show the nuclei. ONL, outer nuclear layer; IS, inner segments; OS, outer segments. Data are shown as mean ± S.E.M. (****P < 0.0001). Scale bar of 10 µm is shown.

3.6. Preservation of functional loss, retinal integrity, and cone photoreceptor cell death occurs in T17M retinas through reduced secretion of the cytokines and chemokine

We used the Bio-Plex cytokine assay to analyze retinal protein extracts from four animal groups (Fig. 5, Table S1, N = 4), choosing P30, as this was a time point when we observed a neuroprotective effect. Analyzing all four groups by one way ANOVA, we did not find statistical difference among the groups. However, the T17M TNFa retinas had a trend of expressing both pro-and anti-inflammatory cytokines at lower levels as compared to ADRP control. Pro-inflammatory IL-1β, IL-6, IL-17, RANTES cytokines, and MCP-1(CCl2) chemokine as compared to T17M were lowered in ADRP retina deficient in TNFa. The most dramatic changes in the T17M TNFa retinas were found in IL-17 and RANTES levels. The T17M TNFa retinas also showed a trend of reduced concentration of anti-inflammatory IL-10 and IL-13 cytokines when compared to the T17M retinas suggesting that reduction of TNFa during the UPR activation could affect both the anti and pro-inflammatory cytokine response. Overall, the neuroprotective effect arising from a TNFa deficit in adRP retinas showed an association with a general decrease in the inflammatory response, suggesting that some cytokines play pivotal roles in the degenerating adRP retinas while others cannot provide protection.

Fig. 5.

Fig. 5

Open in a new tab

Deficit in TNFa lowers cytokine and chemokine levels in T17M adRP retinas. A multiple cytokine assay showed that concentrations of the IL-1β, IL-6, IL-17 cytokines and RANTES chemokine were lower in T17M TNFa retinal lysates and reached levels on ones found in C57BL6 retinas. Levels of IL-10 and IL-13, which are known to inhibit pro-inflammatory responses, were also modulated by TNFa deficiency and were reduced in T17M retinas deficient in TNFa. One-way ANOVA analysis did not demonstrate significant difference among all four groups, while a t-test analysis indicates significant difference in IL-6, IL-10, IL-13, IL-17 and Rantes between T17M and T17M TNFa groups (P = 0.015, P = 0.028, P = 0.021, P = 0.034 and P = 0.002, respectively).

4. Discussion

The concept of inflammation and immunity playing a role in the pathogenesis of retinitis pigmentosa has recently found significant merit. Direct immune reactivity in RP was established by exposing blood samples of RP patients to human and bovine retinal antigens [42]. Additionally, recent studies have also highlighted the activation of microglia in the RP retina prior to photoreceptor cell death; this activation could result in many biochemical events including the release of cytokines and chemokines [8,19,43,44]. For example, in 2012, Zeng et al. [20] proposed that diseased photoreceptors produce cytokines, such as MCP1 and RANTES, which activate microglia, and that the activated microglial cells exacerbate photoreceptor cell death by secreting cytokines, such as TNFa. Therefore, in the current study, we investigated whether other retinal cells can induce the secretion of TNFa.

We demonstrated that rod photoreceptors can undergo activation of the UPR, similar to that seen in mouse retinas expressing the mutant human T17M RHO, and can then serve as sources of TNFa. We also found that rod photoreceptors induce TNFa production and secretion into conditioned medium in response to the UPR and validated TNFa as a potential trigger of photoreceptor death by knocking down its level in stressed cells. Secreted into the extracellular space by rod photoreceptors, the TNFa could thereby transmit an inflammatory signal to the cone photoreceptors and in turn, the TNFa uptake could trigger cone photoreceptor cell death. We tested this hypothesis by demonstrating that the TNFa deficiency in adRP retinas significantly protects cone viability and function, and this is correlated with a trend in overall reduction of the pro-inflammatory cytokine load in the retinas. However, because our experimental set up did not allow us to produce a TNFa ablation in rods, we cannot be assured that in T17M TNFa retina, cones with their secondary mode of cell death benefit only from the knockdown of TNFa in rods and would not survive due to a reduction in intracellular TNFa signaling which also promotes cell death.

The UPR markers, ATF4 and CHOP, have previously been shown to modulate expression of IL-1β and IL-6 cytokines in 661W cultured photoreceptor cell line in response to UPR activation [4]. Here, we demonstrated that rod photoreceptors can produce powerful cytotoxic TNFa cytokine that has potential to regulate homeostasis in cone photoreceptors. This would suggest that together with microglial-derived TNFa, the rod-derived TNFa could exert a direct toxic effect on the cone photoreceptors, activating their pro-death signaling through apoptosis during the retinal degenerative process of RP. However, these findings do not preclude a role for elevated TNFa in eliciting rod deterioration, and they point out that TNFa, in addition to being a messenger between rods and cones, could also be an internal “killer” of rod cells.

Culturing 661W cells on conditioned medium with elevated TNFa secretion results in compromised viability and the TNFa treatment induces 661W cell death; however, the precise mechanism of cone photoreceptor cell death is unknown. The recent finding of a correlation between pro-death members of the extrinsic apoptotic pathway (including TNFa, Csp8, TNFRSF1A, and TRADD) with apoptotic photoreceptor cell death in three different canine models of early-onset of retinal degeneration [23] would suggest that TNFa is involved in apoptotic photoreceptor cell death in RP retinas. However, in general, TNFa is known to induce both apoptosis and necroptosis [45]. For example, TNFa has been proposed to induce apoptosis through TNFRSF1A and through the extrinsic apoptotic pathway by activation of Csp8 and Csp3 [46]. Not surprisingly, we found elevated expression of Csp-3/7 in 661W cone-derived cells treated with TNFa, indicating apoptotic cell death. Nevertheless, this does not negate the fact that TNFa may also function to activate necrosis in cones. Therefore, future studies should investigate whether TNFa release from rods and uptake by cone photoreceptors also induce cone cell necrosis.

Current evidence supports the transmission of inflammation by TNFa through up-regulation of NF-kB. We confirmed increases in both NF-kB (p65) and the pro-inflammatory cytokine IL-6 in TNFa-treated cones. Recently, NF-kB has been assigned both inflammatory and survival roles. For example, IK-kβ-deficient macrophages (M) demonstrate increased expression of MHC II, iNOS, and IL-12, which are hallmarks of M1. This finding suggests that IK-kβ, a molecular regulator of NF-kB translocation to the nucleus, favors the development of anti-inflammatory M2 macrophages [47]. Therefore, future experiments should be conducted to validate the role of NF-kB in mice with inherited retinal degeneration and correlate its expression with the level of apoptosis and with activation of M1 and M2 macrophages. Our findings are in agreement with the study of Gao and colleagues [48] who have demonstrated that therapeutic targeting of TNF-a and it's respective receptor TNFR1 in mice with diabetics retinopathy are associated with attenuation of caspase-3 activity and reduction of IL-6.

A central role for TNFa in inflammation has been demonstrated by blocking the action of TNFa as a treatment for a range of inflammatory conditions, including rheumatoid arthritis, ankylosing spondylitis, inflammatory bowel disease, psoriasis [49], and age-related retinal degeneration [42]. However, inflammation may act as a secondary effect or be a minor contributor to pathogenesis, so we next addressed the question of the extent of the impact of anti-inflammatory approaches on disease by validating the role of TNFa in retinal degeneration in T17Mmice.

At P30–P40, both rod and cone functions are preserved in adRP retinas deficient in TNFa and this preservation correlates with an overall reduced load of inflammatory cytokines in the retina. The levels of IL-1β, IL-6, RANTES, and MCP-1 are significantly downregulated, suggesting that the pro-inflammatory response is diminished in surviving retinas. This would also imply that inflammatory signaling is not a primary cause of retinal degeneration in these mice, but significantly contributes to pathogenesis of the disease. Notably, the reduction of TNFa in the adRP retina reduces the levels of anti-inflammatory cytokines. However, at P30 and P40, the T17M TNFa mice demonstrated a significant preservation of photoreceptor function, suggesting that anti-inflammatory cytokines at this stage of retinal degeneration in T17M retinas might not play an essential role, or their concentrations may be insufficient to overcome pro-inflammatory signaling.

The fact that a TNFa deficit is capable of delaying cone photoreceptor cell death in 3-month-old mice indicates that TNFa blocking therapy holds great promise for treatment of noninfectious inflammatory ocular diseases, such as inherited retinal degeneration. However, results of the recent clinical studies are not entirely clear. Thus, an anti-inflammatory approach has recently undergone a successful test in a small cohort of RP patients with macular edema [50]. The treatment resulted in structural and functional benefits and gave hope for treatment of RP patients. In other clinical studies of ocular disorders treated with TNFa inhibitors [51], it has been reported that when intravitreously injected, drugs such etanercept and adalimumab have shown limited or no effect on AMD or diabetic macular edema treatments. However, their combination (adalimumab and bevacizumab) has been proposed to be promising to treat macular diseases. These authors have concluded that further preclinical and clinical studies should be conducted in order to obtain a more robust conclusion on the use of intravitreal TNF-α inhibitors. Despite the uncertainty in results of clinical studies, the anti-inflammatory therapy has proven effective in an animal model of RP as well. For example, anti-inflammatory treatment of Rd10 mice resulted in a strong suppression of IL-1β and TNFa [20]. In another RP model (the Royal College of Surgeons rats), a nanodevice targeting the outer retina microglia significantly preserved the outer nuclear layer thickness and the electroretinogram b-wave response, in addition to reducing activation of the microglia [52]. These findings all demonstrate that anti-TNFa therapy could be efficiently applied for treatment of inherited retinal degenerative diseases, even though TNFa elevation is not a primary cause.

The results of this study confirm that therapies targeting the TNFa cytokine could represent a feasible strategy to significantly protect rod photoreceptors and dramatically slow down cone photoreceptor deterioration, thereby preventing the functional loss and cell death associated with retinal degenerative diseases like RP. Even if inflammation is a second order event occurring during retinal degeneration and the reduction of some anti-inflammatory cytokines as the result of TNFa knockdown in ADRP retina occurs, this targeted therapy may dramatically postpone the onset of RP and provide a greater quality of life for decades for RP patients.

Supplementary Material

Fig S1
Table S1

Acknowledgments

The authors thank Christopher Starr for technical assistance with western blotting. I also acknowledge the National Eye Institute (Grant R01EY020905) and the VSRC Core (Grant P30 EY003039). The authors also acknowledge Dr. Muayyad Al-Ubaidi (University of Huston) for providing 661W cells.

Abbreviations

UPR

Unfolded Protein Response

adRP

autosomal dominant retinitis pigmentosa

ERG

electroretinography

SD-OCT

spectral-domain optical coherent tomography

ONL

outer nuclear layer

ONH

optic nerve head

RPE

retinal pigment epithelium

TNFα

tumor necrosis factor alpha

Footnotes

Supplementary data to this article can be found online at doi:10.1016/j.bbadis.2016.10.008.

Transparency document

The Transparency document associated with this article can be found, in online version.

References

  • 1.Hamel C. Retinitis pigmentosa. Orphanet J. Rare Dis. 2006;1:40. doi: 10.1186/1750-1172-1-40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Puech B, Kostrubiec B, Hache JC, Francois P. Epidemiology and prevalence of hereditary retinal dystrophies in the Northern France. J. Fr. Ophtalmol. 1991;14(3):153–164. [PubMed] [Google Scholar]
  • 3.Cuenca N, et al. Cellular responses following retinal injuries and therapeutic approaches for neurodegenerative diseases. Prog. Retin. Eye Res. 2014;43:17–75. doi: 10.1016/j.preteyeres.2014.07.001. [DOI] [PubMed] [Google Scholar]
  • 4.Rana T, et al. An activated unfolded protein response promotes retinal degeneration and triggers an inflammatory response in the mouse retina. Cell Death Dis. 2014;5:e1578. doi: 10.1038/cddis.2014.539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Lobo GP, Au A, Kiser PD, Hagstrom SA. Involvement of endoplasmic reticulum stress in TULP1 induced retinal degeneration. PLoS One. 2016;11(3):e0151806. doi: 10.1371/journal.pone.0151806. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Lin JH, et al. IRE1 signaling affects cell fate during the unfolded protein response. Science. 2007;318(5852):944–949. doi: 10.1126/science.1146361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Parmeggiani F, et al. Mechanism of inflammation in age-related macular degeneration: an up-to-date on genetic landmarks. Mediat. Inflamm. 2013;2013:435607. doi: 10.1155/2013/435607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Yoshida N, et al. Clinical evidence of sustained chronic inflammatory reaction in retinitis pigmentosa. Ophthalmology. 2013;120(1):100–105. doi: 10.1016/j.ophtha.2012.07.006. [DOI] [PubMed] [Google Scholar]
  • 9.Kornhuber J, et al. The role of ceramide in major depressive disorder. Eur. Arch. Psychiatry Clin. Neurosci. 2009;259(Suppl 2):S199–S204. doi: 10.1007/s00406-009-0061-x. [DOI] [PubMed] [Google Scholar]
  • 10.Campochiaro PA, et al. Is there excess oxidative stress and damage in eyes of patients with retinitis pigmentosa? Antioxid. Redox Signal. 2015 doi: 10.1089/ars.2015.6327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Xiong W, MacColl Garfinkel AE, Li Y, Benowitz LI, Cepko CL. NRF2 promotes neuronal survival in neurodegeneration and acute nerve damage. J. Clin. Invest. 2015;125(4):1433–1445. doi: 10.1172/JCI79735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Choudhury S, Bhootada Y, Gorbatyuk O, Gorbatyuk M. Caspase-7 ablation modulates UPR, reprograms TRAF2-JNK apoptosis and protects T17M rhodopsin mice from severe retinal degeneration. Cell Death Dis. 2013;4:e528. doi: 10.1038/cddis.2013.34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Choudhury S, et al. Modulation of the rate of retinal degeneration in T17M RHO mice by reprogramming the unfolded protein response. Adv. Exp. Med. Biol. 2014;801:455–462. doi: 10.1007/978-1-4614-3209-8_58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Sothilingam V, et al. Retinitis pigmentosa: impact of different Pde6a point mutations on the disease phenotype. Hum. Mol. Genet. 2015 doi: 10.1093/hmg/ddv275. [DOI] [PubMed] [Google Scholar]
  • 15.Bhootada Y, Choudhury S, Gully C, Gorbatyuk M. Targeting caspase-12 to preserve vision in mice with inherited retinal degeneration. Invest. Ophthalmol. Vis. Sci. 2015;56(8):4725–4733. doi: 10.1167/iovs.15-16924. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kunte MM, et al. ER stress is involved in T17M rhodopsin-induced retinal degeneration. Invest. Ophthalmol. Vis. Sci. 2012;53(7):3792–3800. doi: 10.1167/iovs.11-9235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Shinde V, Kotla P, Strang C, Gorbatyuk M. Unfolded protein response-induced dys-regulation of calcium homeostasis promotes retinal degeneration in rat models of autosomal dominant retinitis pigmentosa. Cell Death Dis. 2016;7:e2085. doi: 10.1038/cddis.2015.325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Guadagni V, Novelli E, Piano I, Gargini C, Strettoi E. Pharmacological approaches to retinitis pigmentosa: a laboratory perspective. Prog. Retin. Eye Res. 2015 doi: 10.1016/j.preteyeres.2015.06.005. [DOI] [PubMed] [Google Scholar]
  • 19.Kohno H, Maeda T, Perusek L, Pearlman E, Maeda A. CCL3 production by microglial cells modulates disease severity in murine models of retinal degeneration. J. Immunol. 2014;192(8):3816–3827. doi: 10.4049/jimmunol.1301738. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zeng HY, et al. Identification of sequential events and factors associated with microglial activation, migration, and cytotoxicity in retinal degeneration in rd mice. Invest. Ophthalmol. Vis. Sci. 2005;46(8):2992–2999. doi: 10.1167/iovs.05-0118. [DOI] [PubMed] [Google Scholar]
  • 21.Punzo C, Kornacker K, Cepko CL. Stimulation of the insulin/mTOR pathway delays cone death in a mouse model of retinitis pigmentosa. Nat. Neurosci. 2009;12(1):44–52. doi: 10.1038/nn.2234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Bovolenta P, Cisneros E. Retinitis pigmentosa: cone photoreceptors starving to death. Nat. Neurosci. 2009;12(1):5–6. doi: 10.1038/nn0109-5. [DOI] [PubMed] [Google Scholar]
  • 23.Genini S, Beltran WA, Aguirre GD. Up-regulation of tumor necrosis factor super-family genes in early phases of photoreceptor degeneration. PLoS One. 2013;8(12):e85408. doi: 10.1371/journal.pone.0085408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zapata MA, et al. Correspondence to: Intravitreal tumor necrosis factor inhibitors in the treatment of refractory diabetic macular edema: a pilot study from the Pan-American Collaborative Retina Study Group. Retina. 2013;33(6):1285–1287. doi: 10.1097/IAE.0b013e31828bcb15. [DOI] [PubMed] [Google Scholar]
  • 25.Venters HD, Dantzer R, Kelley KW. A new concept in neurodegeneration: TNFalpha is a silencer of survival signals. Trends Neurosci. 2000;23(4):175–180. doi: 10.1016/s0166-2236(99)01533-7. [DOI] [PubMed] [Google Scholar]
  • 26.Al-Gayyar MM, Elsherbiny NM. Contribution of TNF-alpha to the development of retinal neurodegenerative disorders. Eur. Cytokine Netw. 2013;24(1):27–36. doi: 10.1684/ecn.2013.0334. [DOI] [PubMed] [Google Scholar]
  • 27.Zayas-Santiago A, Kang Derwent JJ. Preservation of intact adult rat photoreceptors in vitro: study of dissociation techniques and the effect of light. Mol. Vis. 2009;15:1–9. [PMC free article] [PubMed] [Google Scholar]
  • 28.Otteson DC, Phillips MJ. A conditional immortalized mouse muller glial cell line expressing glial and retinal stem cell genes. Invest. Ophthalmol. Vis. Sci. 2010;51(11):5991–6000. doi: 10.1167/iovs.10-5395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Nakazawa T, et al. Tumor necrosis factor-alpha mediates photoreceptor death in a rodent model of retinal detachment. Invest. Ophthalmol. Vis. Sci. 2011;52(3):1384–1391. doi: 10.1167/iovs.10-6509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Yang P, et al. Caspase-8-mediated apoptosis in human RPE cells. Invest. Ophthalmol. Vis. Sci. 2007;48(7):3341–3349. doi: 10.1167/iovs.06-1340. [DOI] [PubMed] [Google Scholar]
  • 31.Luo C, Chen M, Xu H. Complement gene expression and regulation in mouse retina and retinal pigment epithelium/choroid. Mol. Vis. 2011;17:1588–1597. [PMC free article] [PubMed] [Google Scholar]
  • 32.Medearis S, Han IC, Huang JK, Yang P, Jaffe GJ. The role of Bcl-xL in mouse RPE cell survival. Invest. Ophthalmol. Vis. Sci. 2011;52(9):6545–6551. doi: 10.1167/iovs.10-6772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Guadagno J, Xu X, Karajgikar M, Brown A, Cregan SP. Microglia-derived TNFalpha induces apoptosis in neural precursor cells via transcriptional activation of the Bcl-2 family member Puma. Cell Death Dis. 2013;4:e538. doi: 10.1038/cddis.2013.59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Shinde VM, Sizova OS, Lin JH, LaVail MM, Gorbatyuk MS. ER stress in retinal degeneration in S334ter Rho rats. PLoS One. 2012;7(3):e33266. doi: 10.1371/journal.pone.0033266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Kroeger H, et al. Induction of endoplasmic reticulum stress genes, BiP and chop, in genetic and environmental models of retinal degeneration. Invest. Ophthalmol. Vis. Sci. 2012;53(12):7590–7599. doi: 10.1167/iovs.12-10221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Gorbatyuk MS, et al. Restoration of visual function in P23H rhodopsin transgenic rats by gene delivery of BiP/Grp78. Proc. Natl. Acad. Sci. U. S. A. 2010;107(13):5961–5966. doi: 10.1073/pnas.0911991107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Sizova OS, Shinde VM, Lenox AR, Gorbatyuk MS. Modulation of cellular signaling pathways in P23H rhodopsin photoreceptors. Cell. Signal. 2014;26(4):665–672. doi: 10.1016/j.cellsig.2013.12.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Arroba AI, Valverde AM. Inhibition of protein tyrosine phosphatase 1B improves IGF-I receptor signaling and protects against inflammation-induced gliosis in the retina. Invest. Ophthalmol. Vis. Sci. 2015;56(13):8031–8044. doi: 10.1167/iovs.15-17234. [DOI] [PubMed] [Google Scholar]
  • 39.Kamoshita M, Fujinami K, Toda E, Tsubota K, Ozawa Y. Neuroprotective effect of activated 5′-adenosine monophosphate-activated protein kinase on cone system function during retinal inflammation. BMC Neurosci. 2016;17(1):32. doi: 10.1186/s12868-016-0268-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Tohari AM, Zhou X, Shu X. Protection against oxidative stress by vitamin D in cone cells. Cell Biochem. Funct. 2016;34(2):82–94. doi: 10.1002/cbf.3167. [DOI] [PubMed] [Google Scholar]
  • 41.Yang P, Tyrrell J, Han I, Jaffe GJ. Expression and modulation of RPE cell membrane complement regulatory proteins. Invest. Ophthalmol. Vis. Sci. 2009;50(7):3473–3481. doi: 10.1167/iovs.08-3202. [DOI] [PubMed] [Google Scholar]
  • 42.Viringipurampeer IA, Bashar AE, Gregory-Evans CY, Moritz OL, Gregory-Evans K. Targeting inflammation in emerging therapies for genetic retinal disease. Int. J. Inflamm. 2013;2013:581751. doi: 10.1155/2013/581751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Wang K, et al. Retinal structure and function preservation by polysaccharides of wolfberry in a mouse model of retinal degeneration. Sci. Rep. 2014;4:7601. doi: 10.1038/srep07601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Yoshida N, et al. Laboratory evidence of sustained chronic inflammatory reaction in retinitis pigmentosa. Ophthalmology. 2013;120(1):e5–12. doi: 10.1016/j.ophtha.2012.07.008. [DOI] [PubMed] [Google Scholar]
  • 45.Han J, Zhong CQ, Zhang DW. Programmed necrosis: backup to and competitor with apoptosis in the immune system. Nat. Immunol. 2011;12(12):1143–1149. doi: 10.1038/ni.2159. [DOI] [PubMed] [Google Scholar]
  • 46.Tezel G. TNF-alpha signaling in glaucomatous neurodegeneration. Prog. Brain Res. 2008;173:409–421. doi: 10.1016/S0079-6123(08)01128-X. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Kropf P, et al. Arginase and polyamine synthesis are key factors in the regulation of experimental leishmaniasis in vivo. FASEB J. 2005;19(8):1000–1002. doi: 10.1096/fj.04-3416fje. [DOI] [PubMed] [Google Scholar]
  • 48.Gao X, Li Y, Wang H, Li C, Ding J. Inhibition of HIF-1alpha decreases expression of pro-inflammatory IL-6 and TNF-alpha in diabetic retinopathy. Acta Ophthalmol. 2016 doi: 10.1111/aos.13096. [DOI] [PubMed] [Google Scholar]
  • 49.Bradley JR. TNF-mediated inflammatory disease. J. Pathol. 2008;214(2):149–160. doi: 10.1002/path.2287. [DOI] [PubMed] [Google Scholar]
  • 50.Srour M, et al. Intravitreal dexamethasone implant (Ozurdex) for macular edema secondary to retinitis pigmentosa. Graefes Arch. Clin. Exp. Ophthalmol. (Albrecht von Graefes Arch. Klin. Exp. Ophthalmol. 2013;251(6):1501–1506. doi: 10.1007/s00417-012-2249-4. [DOI] [PubMed] [Google Scholar]
  • 51.Pascual-Camps I, et al. Update on intravitreal anti-tumor necrosis factor alpha therapies for ocular disorders. J. Ophthalmic Inflamm. Infect. 2014;4:26. doi: 10.1186/s12348-014-0026-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Iezzi R, et al. Dendrimer-based targeted intravitreal therapy for sustained attenuation of neuroinflammation in retinal degeneration. Biomaterials. 2012;33(3):979–988. doi: 10.1016/j.biomaterials.2011.10.010. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig S1
NIHMS973997-supplement-Fig_S1.pdf (20.4KB, pdf)
Table S1
NIHMS973997-supplement-Table_S1.pdf (78.4KB, pdf)

RESOURCES