Skip to main content
Toxicology Research logoLink to Toxicology Research
. 2017 Aug 15;6(6):866–877. doi: 10.1039/c7tx00202e

Effect of deoxynivalenol on apoptosis, barrier function, and expression levels of genes involved in nutrient transport, mitochondrial biogenesis and function in IPEC-J2 cells

Peng Liao a,✉, Meifang Liao b, Ling Li b, Bie Tan a, Yulong Yin a
PMCID: PMC6060741  PMID: 30090549

graphic file with name c7tx00202e-ga.jpgDON could affect apoptosis, barrier function, nutrient utilization, as well as mitochondrial biogenesis and function-related gene expression in the IPEC-J2.

Abstract

This study was conducted to determine the effect of 200 ng mL–1 and 2000 ng mL–1 deoxynivalenol (DON) on apoptosis, barrier function, nutrient transporter gene expression, and free amino acid variation as well as on mitochondrial biogenesis and function-related gene expression in the intestinal porcine epithelial cell line J2 (IPEC-J2) for 6 h, 12 h, and 24 h. Exposure to 200 ng mL–1 DON inhibited the cell viability and promoted cell cycle progression from the G2/M phase to the S phase (P < 0.05). The data showed that the IPEC-J2 cell content of free amino acids, such as valine, methionine, leucine, and phenylalanine, was increased (P < 0.05) after treatment for 6 h; the aspartate, threonine, and lysine contents increased (P < 0.05) after treatment for 12 h; and the aspartate, serine, glycine, alanine, isoleucine, leucine, and lysine contents decreased (P < 0.05) after treatment for 24 h. The expression levels of barrier function genes, including zonula occludens 1 (ZO-1), occludin (OCLN), and claudin 1 (CLDN1), showed a significant reduction (P < 0.05). Moreover, the expression levels of differently regulated nutrient transporter genes, including B0,+ amino acid transporter (B0,+AT) and sodium-glucose transporter 1 (SGLT1) genes, showed a significant decrease (P < 0.05), while the Na+-dependent neutral amino acid transporter 2 (ASCT2) and glucose transporter type 2 (GLUT2) showed a significant increase (P < 0.01). The expression levels of cytokine genes, including IL-8, and IL-1β genes, showed a significant increase (P < 0.05). Furthermore, the expression levels of mitochondrial biogenesis and function-related genes, including mitochondrial transcription factor A (TFAM) and nuclear respiratory factor-1 (NRF), mitochondrial single-strand DNA-binding protein (mt SSB) and mitochondrial polymerase r (mt polr), NADH dehydrogenase subunit 4 (ND4) and cytochrome c oxidase (CcOX) IV, CcOX V and cytochrome c (Cyt c), mammalian silencing information regulator-2α (SIRT-1), glucokinase and citrate synthase (CS), showed a significant increase (P < 0.05). Taken together, the present study indicated that 200 and 2000 ng mL–1 DON could affect proliferation and cell cycle progression from the G2/M phase to the S phase and could mediate the expression levels of differently regulated barrier function, nutrient transport, and mitochondrial biogenesis and function-related genes.

1. Introduction

Trichothecene deoxynivalenol (DON) is produced from Fusarium graminearum and Fusarium culmorum and is most commonly detected in food and feed worldwide, and as a result has triggered food safety concerns for humans or animals.1–4 On the one hand, our previous reports and other published reports have suggested that the ingestion of DON-contaminated agricultural commodities can trigger a serious problem in animal nutrition for piglets and ruminant animals, such as a reduced feed intake and growth performance, damage to the immunological and intestinal barrier functions, and disruption of the anti-oxidation capacity and nutrient transporter gene expression.1–9 On the other hand, at the cellular level, depending on the dose (ranging from 100 ng mL–1 to 4000 ng mL–1 in different cell lines) and time frequency of exposure, DON can inhibit protein synthesis, proinflammatory gene expression, and barrier function and can affect membrane integrity and induce apoptosis. Additionally, limited studies have focused on assessing the expression variation of nutrient transporter genes and free amino acid concentration at the intracellular levels.10–14 Considering that the genetics and physiology of pigs show a resemblance to those of humans, it can be regarded as an experimental animal model that can be applied to humans, especially for some research, such as toxicology, nutrition, and viral infections.3 The intestinal porcine epithelial cell line 1 (IPEC-1) and intestinal porcine epithelial cell line J2 (IPEC-J2) can be separated from the small intestine of a pig; in particular, the non-transformed jejunum intestinal cell line IPEC-J2 is the best reasonable porcine epithelial cell culture model because it retains most of its epithelial nature.15 Therefore, the IPEC-J2 cell line is considered the best reasonable cell culture model for nutrition and toxicology research.

Mitochondria play an important role in a wide variety of intracellular biological effects, such as adenosine triphosphate (ATP) production, signal transduction, and apoptosis. One of the most important effects of DON is the impairment of mitochondrial function.14 Previous studies have assessed the variation of the transcription profiles of genes associated with mitochondria in Saccharomyces cerevisiae and mammalian cells after T-2 toxin exposure, and some studies have also assessed the variation in mitochondrial associated genes as the largest group of deletions that confer resistance to 4 μM trichothecin (Tcin) using a genome-wide screen, and their results suggested that Tcin could disrupt the mitochondrial membrane morphology in Saccharomyces cerevisiae.16–18 However, to the best of our knowledge, studies on DON-induced variations of mitochondrial biogenesis and function-related gene expression in IPEC-J2 cells remain unclear.

The present study evaluated the differential effects of cell culture medium supplementation with 200 ng mL–1 and 2000 ng mL–1 DON on apoptosis response, barrier function, nutrient transporter gene expression, and free amino acid variations as well as on mitochondrial biogenesis and function-related gene expression in IPEC-J2 cells for 6 h, 12 h, and 24 h.

2. Materials and methods

2.1. Reagents and preparation

DON (D0156; Sigma-Aldrich, Shanghai, China) was diluted in absolute ethanol (99.6%; Sangon Biotech Co., Ltd, Shanghai, China) to prepare a 0.2 mg mL–1 stock solution, while working dilutions were prepared in cell culture medium. These represent non-transformed intestinal porcine epithelial cell lines continuously maintained in cell culture.11 IPEC-J2 cell lines were used in this study as previously described.19 A final concentration of 1% ethanol corresponding to an ethanol concentration of 2000 ng mL–1 of DON solution was tested in all the assays, and the results were not significantly different from those of the control.11 IPEC-J2 cells (Jennio Biological Technology Co., Ltd, Guangzhou, China) were grown in high-glucose Dulbecco's modified Eagle medium (DMEM) (Life Technologies, Grand Island, NY, USA) containing 10% fetal bovine serum (GE Healthcare, Salt Lake City, UT, USA), 50 μg mL–1 penicillin, and 50 μg mL–1 streptomycin (Sigma-Aldrich, Shanghai, China).19 A mycoplasma stain assay kit (Beyotime Co., Ltd, Haimeng, China) was used for mycoplasma testing to rule out the possibility of cryptic contamination. All the other chemicals were obtained from Sigma-Aldrich or other commercial sources at the highest purity available. The cells were routinely seeded at a density of 5 × 106 mL–1 with 7.5 mL medium in plastic tissue culture flasks (75 cm2, Corning Co., Ltd, Shanghai, China) and passaged every 3–4 d for a maximum of 20 times. Cells formed a confluent monolayer within 4 d and were then used as previously described.11

2.2. Analysis of cell viability

Cell viability was analyzed using the Cell Counting Kit (CCK-8) according to the manufacturer's instructions (Dojindo Molecular Technologies, Inc., Shanghai, China). IPEC-J2 cells were seeded in a 96-well plate (Corning Co., Ltd, Shanghai, China) at a density of 1 × 104 cells per well and were incubated at 37 °C in a CO2 incubator. The absorbance at 450 nm was measured by an enzyme-linked immunosorbent assay plate reader (Bio-Tek, Winooskin, VT, USA).19,20 For all subsequent differential effect studies, 200 ng mL–1 DON and 2000 ng mL–1 DON were used for 6 h, 12 h, and 24 h.

2.3. Analysis of the cell cycle by flow cytometry

The cell cycle distribution was assessed using the Cell Cycle Detection Kit according to the manufacturer's instructions (KeyGEN Biotech, Nanjing, China). Briefly, cells were washed twice with cold phosphate buffered saline (PBS) (Beyotime Co., Ltd, Haimeng, China) and were then fixed in 80% ethanol (Beyotime Co., Ltd, Haimeng, China). Thereafter, cells were washed with PBS and incubated at room temperature for 30 min with 50 mg mL–1 propidium iodide (PI) (50 μL mL–1 PI, RNAse, Shanghai, Sigma-Aldrich, China), followed by analysis with a flow cytometry system and related software (BD Biosciences, San Diego, CA, USA).

2.4. Analysis of free amino acid profile by LC-MS/MS

After treating the cells for the indicated time, they were harvested for analysis. The adherent cells were washed twice with PBS (Beyotime Co., Ltd, Haimeng, China) and then dissolved in water with methanol (v : v = 1 : 1) at 4 °C for 10 min. The free amino acid content in the cells was determined as previously described.3 Briefly, after centrifugation to separate the soluble from insoluble material, 10 mL of the supernatant was labeled with iTRAQ reagents (AA 45/32 kit, Applied Biosystems, Foster City, CA, USA) as recommended by the manufacturer and analyzed using an Applied Biosystems 3200 Q TRAP LC/MS/MS system (HPLC Ultimate 3000 and 3200 QTRAP LC-MS/MS) equipped with an RP-C18-column (150 nm in length, 4.6 mm in diameter, 5 mm particle size).

2.5. Quantification of mRNA by real-time RT-PCR analysis for barrier function genes, nutrient transporter genes, cytokine genes, and mitochondrial biogenesis, and function-related genes

Primers for the selected genes (Table 1) were designed using the Primer 5.0 software program.2,3,21–24 The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) housekeeping gene was used as an internal control to normalize the expression of the target gene transcript levels. Total RNA was isolated from IPEC-J2 using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and was then treated with DNase I according to the manufacturer's instructions. Complementary deoxyribonucleic acid (cDNA) was reverse-transcribed and amplified by quantitative real-time polymerase chain reaction (PCR) using an ABI 7900 PCR system (ABI Biotechnology, Eldersburg, MD, USA) as described previously.2,3 In brief, 2 μL of the cDNA template (Sangon Biotech Co., Ltd, Shanghai, China) was added to a total volume of 25 μL containing 12.5 μL of SYBR Green mix and 1 μmol L–1 each of forward and reverse primers. The PCR conditions were as follows: incubation for 10 min at 95 °C, followed by 40 cycles of denaturation for 15 s at 95 °C, then annealing and extension for 60 s at (56.9–64 °C). The relative levels of genes were expressed as a ratio of mRNA as R = 2–(ΔΔCt). The efficiency of real-time PCR was determined by the amplification of a dilution series of cDNA according to equation 10(–1/slope), and the results for the target mRNA were consistent with those for GAPDH. Negative controls were created by replacing cDNA with water.

Table 1. Primers used for the RT-PCR.

Gene 5′-Primer (F) 3′-Primer (R) Accession no. Size (bp) T A (°C) Ref.
Barrier function genes
GAPDH GGATGCAGAAGGAGATCACG ATCTGCTGGAAGGTGGACAG DQ845173 140 58.0 Wu et al.2
ZO-1 CCTGAGTTTGATAGTGGCGTTGA AAATAGATTTCCTGCCCAATTCC XM_003353439.2 269 59.4 Shen et al.24
Occludin ACCCAGCAACGACATA TCACGATAACGAGCATA NM_001163647.2 155 56.9 Shen et al.24
CLDN1 GCCACAGCAAGGTATGGTAAC AGTAGGGCACCTCCCAGAAG NM_001244539.1 107 64.0 Shen et al.24
 
Nutrient transporter genes
B0,+AT GCGAGTACCCGTACCTGATG TTTCACGACGACTTGAGGGG NM_001110171.1 173 62.5 Wu et al.2
SGLT1 TCATCATCGTCCTGGTCGTCTC CTTCTGGGGCTTCTTGAATGTC M34044.1 144 61.0 Wu et al.2
GLUT2 ATTGTCACAGGCATTCTTGTTAGTCA TTCACTTGATGCTTCTTCCCTTTC NM_001097417 273 58.4 Wu et al.2
y+LAT1 TTCTCTTACTCGGGCTGGGA GCGCCATGAGACCATTGAAC EU047705.1 400 61.0 Wu et al.2
ASCT2 CTGGTCTCCTGGATCATGTGG CAGGAAGCGGTAGGGGTTTT DQ231578.1 172 63.0 Wu et al.2
PepT1 CAGACTTCGACCACAACGGA TTATCCCGCCAGTACCCAGA NM_214347.1 99 61.5 Wu et al.2
 
Cytokines genes
IL-8 GCTCTCTGTGAGGCTGCAGTTC AAGGTGTGGAATGCGTATTTATGC NM_213867 107 62.5 Bracarense et al.23
IL-1β GAGCTGAAGGCTCTCCACCTC ATCGCTGTCATCTCCTTGCAC NM_001005149 87 59.4 Bracarense et al.23
IL-6 GGCAAAAGGGAAAGAATCCAG CGTTCTGTGACTGCAGCTTATCC NM_214399 122 61.3 Bracarense et al.23
IFN-γ TGGTAGCTCTGGGAAACTGAATG GGCTTTGCGCTGGATCTG NM_213948 79 61.3 Bracarense et al.23
TNF-α ACTGCACTTCGAGGTTATCGG GGCGACGGGCTTATCTGA NM_214022 67 59.3 Bracarense et al.23
 
Mitochondrial function-related genes
PGC-1α CCCGAAACAGTAGCAGAGACAAG CTGGGGTCAGAGGAAGAGATAAAG NM_213963 111 62.7 Liu et al.21
TFAM GGTCCATCACAGGTAAAGCTGAA ATAAGATCGTTTCGCCCAACTTC AY923074.1 167 59.5 Liu et al.21
NRF-1 GCCAGTGAGATGAAGAGAAACG CTACAGCAGGGACCAAAGTTCAC AK237171.1 166 63.2 Liu et al.21
mt SSB CTTTGAGGTAGTGCTGTGTCG CTCACCCCTGACGATGAAGAC AK352341.1 143 60.4 Liu et al.21
mt polr CTTTGAGGTTTTCCAGCAGCAG GCTCCCAGTTTTGGTTGACAG XM_001927064.1 119 61.4 Liu et al.21
ND4 TTATTGGTGCCGGAGGTACTG CCCAGTTTATTCCAGGGTTCTG NM_001097468 112 63.0 Liu et al.21
CcOX I ATTATCCTGACGCATACACAGCA GCAGATACTTCTCGTTTTGATGC AJ950517.1 127 60.0 Liu et al.21
CcOX IV CCAAGTGGGACTACGACAAGAAC CCTGCTCGTTTATTAGCACTGG AK233334.1 131 59.7 Liu et al.21
CcOX V ATCTGGAGGTGGTGTTCCTACTG GTTGGTGATGGAGGGGACTAAA AY786556.1 160 62.4 Liu et al.21
Cyt c TAGAAAAGGGAGGCAAACACAAG GGATTCTCCAGGTACTCCATCAG NM_001129970.1 154 63.2 Liu et al.21
ATPS TGTCCTCCTCCCTATCACACATT TAGTGGTTATGACGTTGGCTTGA AK230503 116 58.7 Liu et al.21
SIRT-1 TGACTGTGAAGCTGTACGAGGAG TGGCTCTATGAAACTGCTCTGG EU030283.2 143 59.3 Liu et al.21
Glucokinase CTTTTCCCTCCCACACTGCTAT GACTCCTCTTCCTGAGACCCTCT AK233298.1 119 61.3 Liu et al.21
CS CCTTTCAGACCCCTACTTGTCCT CACATCTTTGCCGACTTCCTTC M21197.1 127 60.7 Liu et al.21

2.6. Statistical analysis

All the results are expressed as the means ± standard error of the mean (SEM). Statistical analyses were subjected to one-way analysis of variance in SAS 8.2 (Version 8.2; SAS Inst. Inc., Cary, NC). The differences among the group means were compared using the Duncan multiple comparison test. Probability values <0.05 were taken to indicate statistical significance. All the experiments were repeated independently six times.

3. Results

3.1. Cell viability after DON exposure

Cell viability, as measured by the CCK-8 bioassay, was dose- and time-dependently inhibited after treating the IPEC-J2 cells with 200 and 2000 ng mL–1 DON for 24 h, 48 h, 72 h, 6 h, 12 h, and 24 h (Fig. 1). The 2000 ng mL–1 DON concentration decreased the CCK-8 signal in IPEC-J2 to 76.68% and 80.09% of the control after 48 h and 72 h, respectively, while 200 ng mL–1 DON decreased the CCK-8 signal in IPEC-J2 to 45.38% and 46.71% of the control after 48 h and 72 h, respectively (Fig. 1A). After treatment with 2000 ng mL–1 DON for 6 h, 12 h, and 24 h, the corresponding measurements were 25.9% (6 h), 39.9% (12 h), and 52.79% (24 h) (Fig. 1B), while in 200 ng mL–1 DON, the corresponding measurements were 16% (6 h), 20% (12 h), and 29.26% (24 h) (Fig. 1B).

Fig. 1. Effect of different concentrations of DON on the cell viability of IPEC-J2. (A) Effect of different concentrations of DON on cell viability after 24 h, 48 h, and 72 h. (B) Effect of different concentrations of DON on cell viability after 6 h, 12 h, and 24 h. The data are expressed as the mean ± SE (n = 6). *P < 0.05; **P < 0.01. DON, deoxynivalenol; IPEC-J2, intestinal porcine epithelial cell line J2.

Fig. 1

3.2. Cell cycle after DON exposure

To evaluate the effect of DON on the cell cycle distribution of IPEC-J2, the cells were treated with 200 ng mL–1 and 2000 ng mL–1 DON for 6 h, 12 h, and 24 h (Fig. 2). As shown in Fig. 2, before treatment, there were about 11% of cells in the G2/M phase; however, after treatment for 6 h, the rates of cells in the G2/M phase increased to 16.5% and 18% at 200 and 2000 ng mL–1, respectively. After treatment for 12 h, the corresponding rates of cells in the G2/M phase decreased to 10% at 200 ng mL–1 DON but increased to 20% at 2000 ng mL–1 DON. Similar results emerged 24 h after treatment with 200 ng mL–1 or 2000 ng mL–1 DON. The ratio of cells in the S phase showed similar results, where the ratio was increased in the 200 ng mL–1 DON group but decreased in the 2000 ng mL–1 DON group in 6 h, 12 h, and 24 h.

Fig. 2. Effect of different concentrations of DON on IPEC-J2 cell cycle for 6 h, 12 h, and 24 h analyzed by flow cytometry. The cells in the G1/G0, S, or G2/M phases are presented as percentages. The data are expressed as the mean ± SE (n = 6). *P < 0.05; **P < 0.01. DON, deoxynivalenol; IPEC-J2, intestinal porcine epithelial cell line J2.

Fig. 2

3.3. Profile of free amino acids after DON exposure

After treatment for 6 h (Table 2), compared with the other groups, there was a significant change in the lysine concentration among the three groups (P < 0.01). Between the two DON treatment groups, the concentrations of some amino acids decreased, including aspartate, threonine, glutamate, and tyrosine (P < 0.05); however, the concentrations of other amino acids increased, including valine, methionine, leucine, and phenylalanine (P < 0.05).

Table 2. Effect of medium supplementation with DON on the IPEC-J2 cells concentration of free amino acids.

Amino acid (μm L–1) DON concentration
SEM± P value
Control 200 ng mL–1 2000 ng mL–1
6 h after DON treatment
l-Aspartate 7.31* 7.46* 4.95** 0.9833 0.041
l-Threonine 13.26* 36.89** 17.04*,** 3.757 0.023
l-Serine 5.19 4.91 4.82 0.940 0.177
l-Glutamate 96.37* 98.42* 71.73** 4.077 0.051
l-Glycine 13.21* 5.08** 10.27*,** 2.530 0.064
l-Alanine 18.94 19.32 15.93 4.050 0.213
l-Cysteine 1.5 1.27 1.45 0.113 0.217
l-Valine 3.35* 2.94*,** 3.42* 1.550 0.036
l-Methionine 1.31* 0.88** 1.88*,** 0.177 0.038
l-Isoleucine 2.52 2.96 2.55 0.407 0.317
l-Leucine 5.04* 3.6** 5.71*,** 0.727 0.047
l-Tyrosine 1.28* 1.6*,** 0.91** 1.007 0.031
l-Phenylalanine 8.98* 3.25** 15.7*** 1.123 0.023
l-Lysine 8.89* 3.58** 13.37*** 1.177 0.001
l-Histidine 3.37* 1.94*,** 3.04* 3.207 0.071
l-Arginine 1.02 1.25 0.96 0.144 0.082
 
12 h after DON treatment
l-Aspartate 3.17* 3.97*,** 5.13** 0.814 0.044
l-Threonine 6.95 2.32 4.39 0.227 0.038
l-Serine 1.94 0.58 0.5 0.115 0.731
l-Glutamate 75.15 44.49 39.12 7.193 0.021
l-Glycine 5.9* 0.75** 0.69** 1.114 0.034
l-Alanine 13.58* 4.29** 3.01*,** 1.741 0.033
l-Cysteine 1.21 0.95 1.11 0.088 0.424
l-Valine 2.02* 1.13*,** 0.83** 1.013 0.042
l-Methionine 0.52* 0.24** 0.17*,** 0.104 0.051
l-Isoleucine 1.74* 0.94*,** 0.71*,** 0.670 0.038
l-Leucine 2.34* 1.18*,** 0.77*** 0.017 0.033
l-Tyrosine 0.5* 0.17** 0.09*** 0.121 0.019
l-Phenylalanine 2.9 1.98 1.88 1.811 0.334
l-Lysine 2.6* 1.43** 2.86*,** 2.015 0.046
l-Histidine 1.87 1.25 1.08 2.040 0.441
l-Arginine 0.69* 0.37** 0*** 0.453 0.015
 
24 h after DON treatment
l-Aspartate 7.23* 3.42** 2.32*,** 0.387 0.037
l-Threonine 9.22* 3.1** 3.12*,** 2.331 0.014
l-Serine 2.56* 1.22** 0.61*** 0.184 0.022
l-Glutamate 107.55* 68.34** 31.01*** 8.117 < 0.01
l-Glycine 3.43* 1.45** 0.53*** 1.119 0.017
l-Alanine 19.46* 8.39** 2.76*** 3.211 0.044
l-Cysteine 0.48 0.79 0.77 0.166 0.517
l-Valine 2.25 1.58 0.95 1.588 0.663
l-Methionine 0.67 0.38 0.23 2.224 0.211
l-Isoleucine 2.59* 1.60** 0.83*** 0.831 0.047
l-Leucine 3.51* 2.16** 0.98*** 2.554 0.036
l-Tyrosine 1.12* 0.35*,** 0.12*,** 1.041 0.051
l-Phenylalanine 2.81 2.3 1.88 0.277 0.411
l-Lysine 3.15* 1.99** 1.25**,*** 1.231 0.043
l-Histidine 1.83 1.66 1.03 2.214 0.122
l-Arginine 0.85* 0** 0**,*** 0.117 0.004

After treatment for 12 h (Table 2), compared with the other groups, there was a significant change in tyrosine and arginine among the three groups (p < 0.01). Between the two DON treatment groups, the concentrations of some amino acids decreased, including glutamate, glycine, alanine, valine, methionine, isoleucine, and leucine (P < 0.05); however, the concentrations of other amino acids increased, including aspartate, threonine, and lysine (P < 0.05).

After treatment for 24 h (Table 2), compared with the other groups, there was a significant change in the threonine, glutamate, and arginine contents (P < 0.01). Between the two DON treatment groups, the concentrations of some amino acids decreased, including aspartate, serine, glycine, alanine, isoleucine, leucine, and lysine (P < 0.05).

3.4. mRNA changes in barrier function genes, nutrient transporter genes, cytokine genes, and mitochondrial-related genes after DON exposure

Fig. 3 shows the mRNA expression of zonula occludens 1 (ZO-1), occludin (OCLN), and claudin 1(CLDN1) among the three groups. Compared with the control groups, the mRNA expression of ZO-1, OCLN, and CLDN1 showed a significant reduction after incubation with 200 and 2000 ng mL–1 DON for 6 h, 12 h, and 24 h (P < 0.05).

Fig. 3. Relative gene expression levels of ZO-1, OCLN, and CLDN1 after exposure to different DON concentrations. IPEC-J2 cells were treated without (0) or with different concentrations of DON (200 ng mL–1 DON (200) and 2000 ng mL–1 DON (2000)) for 6 h, 12 h, and 24 h. Real-time PCR was employed. The values are the means (n = 6), with SE represented by vertical bars. *P < 0.05; **P < 0.01. ZO-1, zonula occludens 1; OCLN, occludin; CLDN1, claudin 1; DON, deoxynivalenol; IPEC-J2, intestinal porcine epithelial cell line J2; PCR, polymerase chain reaction.

Fig. 3

Fig. 4 shows the mRNA expression of B 0,+ amino acid transporter (B0,+AT), sodium-glucose transporter 1 (SGLT1), Na+-dependent neutral amino acid transporter 2 (ASCT2), and glucose transporter type 2 (GLUT2) in the three groups. Between the two DON treatment groups, compared with the control group, the mRNA expression of B0,+AT (12 h and 24 h) and SGLT1 (12 h) showed a significant decrease (P < 0.05); however, the mRNA expression of SGLT1 (24 h) showed a significant increase in the 2000 ng mL–1 DON treatment group (P < 0.01) (Fig. 4A). Compared with the control groups, the mRNA expression of ASCT2 (12 h and 24 h) and GLUT2 (6 h and 12 h) showed a significant increase (P < 0.01) (Fig. 4B). There was no difference in the mRNA abundances of y+ L-type amino acid transporter 1 (y+ LAT1) and dipeptide transporter 1 (PepT1).

Fig. 4. Relative gene expression levels of nutrient transporters, including B 0,+AT and SGLT1 (A), ASCT2 and GLUT2 (B), after exposure to different DON concentrations. IPEC-J2 cells were treated without (0) or with different concentrations of DON (200 ng mL–1 DON (200) and 2000 ng mL–1 DON (2000)) for 6 h, 12 h, and 24 h. The real-time PCR method was employed. Values are the means (n = 6), with SE represented by vertical bars. *P < 0.05; **P < 0.01. B0,+AT, B0,+ amino acid transporter; SGLT1, sodium-glucose transporter 1; GLUT2, glucose transporter type 2; ASCT2, Na+-dependent neutral amino acid transporter 2; DON, deoxynivalenol; IPEC-J2, intestinal porcine epithelial cell line J2; PCR, polymerase chain reaction.

Fig. 4

Fig. 5 shows the mRNA expression of cytokine genes and mitochondrial-related genes in the three groups after DON exposure for 6 h, 12 h, and 24 h. Among the two DON treatment groups, compared with the control group, the mRNA expression of interleukin (IL)-8 and IL-1β showed a significant increase (P < 0.05) at 12 h and 24 h, especially in the 2000 ng mL–1 DON treatment group (P < 0.01) (Fig. 5A). There was no difference in the mRNA abundance with IL-6, interferon-γ (IFN-γ), and tumor necrosis factor-α (TNF-α).

Fig. 5. Relative gene expression levels of cytokines (A), and mitochondrial biogenesis and function-related genes following exposure to different concentrations of DON (B–F). IPEC-J2 cells were treated without (0) or with different concentrations of DON (200 ng mL–1 DON (200) and 2000 ng mL–1 DON (2000)) for 6 h, 12 h and 24 h. Real-time PCR was employed. The values are the means (n = 6), with SE represented by vertical bars. *P < 0.05; **P < 0.01. DON, deoxynivalenol; IPEC-J2, intestinal porcine epithelial cell line J2; IL-8, interleukin-8; IL-1β, interleukin-1β; TFAM, mitochondrial transcription factor A; NRF-1, nuclear respiratory factor-1; mt SSB, mitochondrial single-strand DNA-binding protein; mt polr, mitochondrial polymerase r; ND4, NADH dehydrogenase subunit 4; CcOX IV, cytochrome c oxidase IV; CcOX XV, cytochrome c oxidase XV; Cyt c, cytochrome c; SIRT-1, mammalian silencing information regulator-2α; CS, citrate synthase; PCR, polymerase chain reaction.

Fig. 5

Compared with the control groups, there were significant increases (P < 0.05) in the mRNA expression levels of mitochondrial transcription factor A (TFAM) and nuclear respiratory factor-1 (NRF) (except for 6 h) (Fig. 5B), mitochondrial single-strand DNA-binding protein (mt SSB) (except for 24 h) and mitochondrial polymerase r (mt polr) (except for 24 h) (Fig. 5C), NADH dehydrogenase subunit 4 (ND4) (except for 24 h) and CcOX I (except for 24 h) (Fig. 5D), cytochrome c oxidase (CcOX) V (except for 24 h) and cytochrome c (Cyt c) (except for 6 h) (Fig. 5E), mammalian silencing information regulator-2α (SIRT-1) (except for 12 h and 24 h) and glucokinase (except for 24 h) and citrate synthase (CS) (except for 24 h) (Fig. 5F) in the two DON treatment groups. There was no difference in the mRNA abundance of peroxisomal proliferator-activated receptor-γ coactivator-1α (PGC-1α), CcOX I and adenosine triphosphate synthase (ATP) among these three groups (P > 0.05).

4. Discussion

Several studies have demonstrated that DON could decrease cell proliferation and reduce the viability of different cells with different concentrations.12,25 In addition, DON can significantly inhibit the proliferation of IPEC-J2 cells.11,19,26,27 In our study, the cell viability assay showed a similar suppressive response to 200 ng mL–1 of DON and 2000 ng mL–1 of DON at 24 h, 48 h, and 72 h (Fig. 1A), which was not consistent with and was also slightly higher than previously reported results at the same concentration of DON and at the same time points.11 A possible explanation for the discrepancies between this latter study and our present study could be that the effect of DON on cell viability is dependent on the type of cells, the duration of exposure of cells to DON, and the dose of DON. In addition, after 200 ng mL–1 of DON and 2000 ng mL–1 of DON exposure for 6 h, 12 h, and 24 h, the cell viability assay showed that DON could decrease IPEC-J2 cell proliferation and reduce the viability from 6 h to 24 h (Fig. 1B).

A previously study showed that in the concentration range of 100 to 4000 ng mL–1, DON could clearly arrest cells in the G2/M phase of the cell cycle in intestinal-407 epithelial, human HCT-116 cells, and IPEC-J2 cells.11,28 In agreement with this result, our present data point to a cell cycle arrest in the G2/M phase in IPEC-J2, whereas the decrease in the S phase and increase in G0/G1 in IPEC-J2 favor the apoptotic pathways at 6 h and 12 h (Fig. 2). The mechanism of the cell cycle transition from the G2 to M phase involves the activation of p38 pathways and cell-cycle-related proteins, such as Cdc25C, Cdc2, and cyclin B1.11,29

Amino acids play important roles as metabolic intermediates in nutrition, immune response, and growth performance after mycotoxin exposure in piglets.2–4,30–32 In the current work, we observed that some concentrations of amino acids in IPEC-J2 cells were decreased in the two DON groups, such as aspartate, threonine, glutamate, and tyrosine after treatment for 6 h; glutamate, glycine, alanine, valine, methionine, isoleucine, and leucine after treatment for 12 h; and aspartate, serine, glycine, alanine, isoleucine, leucine, and lysine after treatment for 24 h (Table 2). These results were not consistent with our previous reports showing dietary supplementation with functional nutrients in single- or multi-dose DON exposure.3,4,30–32 A possible reason for the changes between this latter study and our present study could be that the effect of DON on free amino acids is dependent on the type of experiment model. Our results further demonstrated that a key molecular mechanism is responsible for the DON-induced free amino acid changes in IPEC-J2.

Tight junctions (TJ), the first target for DON, are the principal determinants of epithelial and endothelial paracellular barrier functions.33 Tight junction proteins include OCLN, CLDNs, junctional adhesion molecules, and tricellulin.34 The cytoplasmic scaffolding proteins, like ZO-1 proteins, provide a direct link between transmembrane TJ proteins and the actin cytoskeleton.34 The integrity of the epithelial barrier relies on TJ. In the present work, the mRNA expression of ZO-1, OCLN, and CLDN1 showed a significant reduction after incubation with 200 and 2000 ng mL–1 DON for 6 h, 12 h, and 24 h (P < 0.05) (Fig. 3), a finding that is consistent with previously reported results.35,36 Several studies have demonstrated that DON could not only up-regulate ZO-1, OCLN, and CLDN1 in vitro and in vivo,36–40 but could also down-regulate ZO-1, OCLN, and CLDN1 in vitro and in vivo.35,36 Most likely, this discrepancy is due to the use of different cell lines and animal models in vitro and in vivo.

The absorption of amino acids mainly depends on their transporters on the membrane of enterocytes, where elevated amino acid transporter expression may contribute to enhanced amino acid sensitivity.2–4 In our previous study, we found that DON-infected feed reduced B0,+ AT, SGLT1, ASCT2, and GLUT2 in growing pigs and weaning pigs.2,3 In the present work, the mRNA expression levels of B0,+ AT (at 12 h and 24 h) and SGLT1 (at12 h) showed a significant decrease (P < 0.01); however, the mRNA expression levels of ASCT2 (at 12 h and 24 h) and GLUT2 (at 6 h and 12 h) showed a significant increase (P < 0.01) (Fig. 4). There was no difference in the mRNA abundance of y+ LAT1 and PepT1 (Fig. 4). The SGLT-1 data, unlike that of GLUT2, in the present study were consistent with those of a previous study.41 The ASCT2 and GLUT2 data, however, were not consistent with our previous data obtained with DON exposure.2,3 However, the mRNA expression of amino acid transporters in the amino acid absorption ratio did not strictly correspond to the changes in the amino acid intake.32 This relationship between amino acid expression and amino acid intake in DON-contaminated pigs will require further investigation.

Cytokines play an important role in the immune, DON-infected, and inflammatory responses;32,42 therefore, their balance is important for the protection against mycotoxin infection. Several studies have focused on a wide array of cytokines that are detectable in different organs, such as the spleen, liver, and kidney, after DON exposure.43,44 In the present work, the mRNA expression of interleukin IL-8 and IL-1β showed a significant increase (P < 0.05) with 12- and 24 h DON exposure, especially in the 2000 ng mL–1 DON treatment group (P < 0.01) in both DON treatment groups (Fig. 5A). There was no difference in the mRNA abundance of IL-6, IFN-γ, and TNF-α. In previous studies, both IL-8 and IL-1β mRNA levels were increased after pigs were fed a DON-contaminated diet.35,38 By contrast, a previous study showed decreased IL-8 and IL-1β mRNA levels from the pig after chronic exposure to low-level DON; a possible reason for this could be the decreased expression of cytokines due to the indirect toxicology effect of the reduced feed consumption.45

Mitochondria are known to play important roles in the regulation of various cellular processes in eukaryotes, such as ATP production, reactive oxygen species (ROS) generation, signal transduction, and apoptosis after DON exposure, and also the regulation of mitochondrial biogenesis and function gene expression may contribute to enhanced ROS activity.19 PGC-1α, NRF1, and TFAM modulate mitochondrial biogenesis.46,47 The T-2 toxin can reduce the expression levels of PGC-1α, NRF-1, and TFAM, inhibiting mitochondrial biogenesis and then inhibiting the cardiac differentiation of murine ES cells; this effect is partly responsible for p38 signaling mediation by ROS.48 In the present study, DON significantly increased (P < 0.05) the mRNA expression level of TFAM and NRF (except for 6 h) (Fig. 5B). However, there was no difference in the mRNA levels of PGC-1α among the three groups. Mitochondrial replication and repair were also affected by mt SSB and mt polr.49 DON significantly increased (P < 0.05) the mRNA expression level of mt SSB (except at 24 h) and mt polr (except at 24 h) (Fig. 5C). Several nuclear-encoded mt-encoded respiratory subunits (CcOX IV, XV, Cyt c) are related to the function of election transport and ROS activity.50,51 DON significantly increased (P < 0.05) the mRNA expression level of ND4 (except for 24 h) and CcOX IV (except for 24 h) (Fig. 5D), CcOX V (except for 24 h), and Cyt c (except for 6 h) (Fig. 5E); however, there was no difference in the mRNA levels of CcOX I and ATPS among the three groups. Evidence from murine ES cells also showed that the T-2 toxin can lead to a specific decreased COXIV activity, whereas other respiratory chain activity was not detected.48,51 Glucokinase and CS determine the rate of glycolysis and the tricarboxylic acid (TCA) cycle and subsequent ATP formation,52 while SIRT-1 plays an essential role in mediating cell survival.53 There was a significantly increased (P < 0.05) mRNA expression of Cyt c (except for 6 h) (Fig. 5E), SIRT-1 (except for 12 h and 24 h), glucokinase (except for 24 h), and CS (except for 24 h) (Fig. 5F) in the two DON treatment groups (Fig. 5C).

5. Conclusions

The present study indicated that 200 and 2000 ng mL–1 DON could affect the proliferation and cell cycle progression from the G2/M phase to the S phase and could mediate the expression levels of differently regulated barrier function, nutrient transport, and mitochondrial biogenesis, and function-related genes. Future research is needed to shed light on how mitochondrial impairment occurs after DON exposure at different times and concentrations and how to prevent intestinal functional disorders by mitochondrial pathways.

Abbreviations

DON

Deoxynivalenol

IPEC-J2

Intestinal porcine epithelial cell line J2

Tcin

Trichothecin

ATP

Adenosine triphosphate

IPEC-1

Intestinal porcine epithelial cell line 1

DMEM

Dulbecco's modified Eagle medium

CCK-8

Cell counting kit

LC-MS/MS

Liquid chromatography-mass spectrometry

RT-PCR

Reverse transcription-polymerase chain reaction

PBS

Phosphate buffered saline

PI

Propidium iodide

RNA

Ribonucleic acid

cDNA

Complementary deoxyribonucleic acid

GAPDH

Glyceraldehyde 3-phosphate dehydrogenase

ZO-1

Zonula occludens 1

OCLN

Occludin

CLDN1

Claudin 1

B0,+AT

B0,+ amino acid transporter

SGLT1

Sodium-glucose transporter 1

GLUT2

Glucose transporter type 2

y+ LAT1

y+ L-type amino acid transporter 1

ASCT2

Na+-Dependent neutral amino acid transporter 2

PepT1

Dipeptide transporter 1

IL-8

Interleukin-8

IL-1β

Interleukin-1β

IL-6

Interleukin-6

IFN-γ

Interferon-γ

TNF-α

Tumor necrosis factor-α

PGC-1α

Peroxisomal proliferator-activated receptor-γ coactivator-1α

TFAM

Mitochondrial transcription factor A

NRF-1

Nuclear respiratory factor-1

mt SSB

Mitochondrial single-strand DNA-binding protein

mt polr

Mitochondrial polymerase r

ND4

NADH dehydrogenase subunit 4

CcOX

Cytochrome c oxidase

Cyt c

Cytochrome c

ATPS

Adenosine triphosphate synthase

SIRT-1

Mammalian silencing information regulator-2α

CS

Citrate synthase

SEM

Standard error of the mean

ANOVA

Analysis of variance

TJ

Tight junctions

ROS

Reactive oxygen species

TCA

Tricarboxylic acid cycle.

Author contributions

Peng Liao conceived and designed the experiments. Peng Liao and Meifang Liao performed the experiments and analyzed the data. Peng Liao wrote the first draft of the manuscript. Bie Tan, Ling Li, and Yulong Yin contributed reagents/materials/analytical tools.

Conflicts of interest

There are no conflicts of interest to declare.

Acknowledgments

This research was supported by the National Natural Science Foundation of China (31402088), and the Youth Innovation Team Project of ISA, CAS (2017QNCXTD_TBE).

References

  1. Wu L., Li J., Li Y., Li T., He Q., Tang Y., Liu H., Su Y., Yin Y., Liao P. J. Anim. Sci. Biotechnol. 2016;7:63. doi: 10.1186/s40104-016-0122-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Wu L., Liao P., He L., Ren W., Yin J., Duan J., Li T. BMC Vet. Res. 2015;11:144. doi: 10.1186/s12917-015-0449-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Wu L., Liao P., He L., Feng Z., Ren W., Yin J., Duan J., Li T., Yin Y. Toxins (Basel) 2015;7:1341–1354. doi: 10.3390/toxins7041341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Duan J., Yin J., Wu M., Liao P., Deng D., Liu G., Wen Q., Wang Y., Qiu W., Liu Y., Wu X., Ren W., Tan B., Chen M., Xiao H., Wu L., Li T., Nyachoti C. M., Adeola O., Yin Y. PLoS One. 2014;9:e112357. doi: 10.1371/journal.pone.0112357. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Wu M., Xiao H., Ren W., Yin J., Tan B., Liu G., Li L., Nyachoti C. M., Xiong X., Wu G. PLoS One. 2014;9:e100591. doi: 10.1371/journal.pone.0100591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Wu M., Xiao H., Ren W., Yin J., Hu J., Duan J., Liu G., Tan B., Xiong X., Oso A. O., Adeola O., Yao K., Yin Y., Li T. PLoS One. 2014;9:e113687. doi: 10.1371/journal.pone.0113687. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Xiao H., Tan B., Wu M., Yin Y., Li T., Yuan D., Li L. J. Anim. Sci. 2013;91:4750–4756. doi: 10.2527/jas.2013-6427. [DOI] [PubMed] [Google Scholar]
  8. Xiao H., Wu M., Tan B., Yin Y., Li T., Xiao D., Li L. J. Anim. Sci. 2013;91:4772–4780. doi: 10.2527/jas.2013-6426. [DOI] [PubMed] [Google Scholar]
  9. Seeling K., Danicke S. J. Anim. Feed Sci. 2005;14:3–40. [Google Scholar]
  10. Pestka J. J. Toxins. 2010;2:1300–1317. doi: 10.3390/toxins2061300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Diesing A. K., Nossol C., Panther P., Walk N., Post A., Kluess J., Kreutzmann P., Danicke S., Rothkotter H. J., Kahlert S. Toxicol. Lett. 2011;200:8–18. doi: 10.1016/j.toxlet.2010.10.006. [DOI] [PubMed] [Google Scholar]
  12. Sergent T., Parys M., Garsou S., Pussemier L., Schneider Y. J., Larondelle Y. Toxicol. Lett. 2006;164:167–176. doi: 10.1016/j.toxlet.2005.12.006. [DOI] [PubMed] [Google Scholar]
  13. Ren Z., Wang Y., Deng H., Deng Y., Deng J., Zuo Z., Wang Y., Peng X., Cui H., Shen L. Environ. Toxicol. Pharmacol. 2015;39:339–346. doi: 10.1016/j.etap.2014.11.028. [DOI] [PubMed] [Google Scholar]
  14. Wu Q. H., Wang X., Yang W., Nussler A. K., Xiong L. Y., Kuca K., Dohnal V., Zhang X. J., Yuan Z. H. Arch. Toxicol. 2014;88:1309–1326. doi: 10.1007/s00204-014-1280-0. [DOI] [PubMed] [Google Scholar]
  15. Mariani V., Palermo S., Fiorentini S., Lanubile A., Giuffra E. Vet. Immunol. Immunopathol. 2009;131:278–284. doi: 10.1016/j.vetimm.2009.04.006. [DOI] [PubMed] [Google Scholar]
  16. Bouaziz C., Martel C., Sharaf el dein O., Abid-Essefi S., Brenner C., Lemaire C., Bacha H. Toxicol. Sci. 2009;110:363–375. doi: 10.1093/toxsci/kfp117. [DOI] [PubMed] [Google Scholar]
  17. Josse L., Li X., Coker R. D., Gourlay C. W., Evans I. H. FEMS Yeast Res. 2011;11:133–150. doi: 10.1111/j.1567-1364.2010.00699.x. [DOI] [PubMed] [Google Scholar]
  18. McLaughlin J. E., Bin-Umer M. A., Tortora A., Mendez N., McCormick S., Tumer N. E. Proc. Natl. Acad. Sci. U. S. A. 2009;106:21883–21888. doi: 10.1073/pnas.0909777106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Tang Y., Li J., Li F., Hu C. A., Liao P., Tan K., Tan B., Xiong X., Liu G., Li T., Yin Y. Free Radical Biol. Med. 2015;89:944–951. doi: 10.1016/j.freeradbiomed.2015.09.012. [DOI] [PubMed] [Google Scholar]
  20. Liao P., Liu W., Li H., Gao H., Wang H., Li N., Xu N., Li J., Wan J., Liu L., Sun Y. Toxicol. Ind. Health. 2012;28:439–448. doi: 10.1177/0748233711414608. [DOI] [PubMed] [Google Scholar]
  21. Liu J., Yao Y., Yu B., Mao X., Huang Z., Chen D. Livest. Sci. 2012;146:123–132. [Google Scholar]
  22. Nygard A.-B., Jørgensen C. B., Cirera S., Fredholm M. BMC Mol. Biol. 2007;8:67. doi: 10.1186/1471-2199-8-67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Bracarense A.-P. F., Lucioli J., Grenier B., Pacheco G. D., Moll W.-D., Schatzmayr G., Oswald I. P. Br. J. Nutr. 2012;107:1776–1786. doi: 10.1017/S0007114511004946. [DOI] [PubMed] [Google Scholar]
  24. Shen J., Chen Y., Wang Z., Zhou A., He M., Mao L., Zou H., Peng Q., Xue B., Wang L. Br. J. Nutr. 2014;111:2123–2134. doi: 10.1017/S0007114514000300. [DOI] [PubMed] [Google Scholar]
  25. Wollenhaupt K., Tomek W., Tiemann U. Acta Vet. Hung. 2007;55:123–133. doi: 10.1556/AVet.55.2007.1.12. [DOI] [PubMed] [Google Scholar]
  26. Akbari P., Braber S., Varasteh S., Alizadeh A., Garssen J., Fink-Gremmels J. Arch. Toxicol. 2017;91:1007–1029. doi: 10.1007/s00204-016-1794-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Broekaert N., Devreese M., Demeyere K., Berthiller F., Michlmayr H., Varga E., Adam G., Meyer E., Croubels S. Food Chem. Toxicol. 2016;95:103–109. doi: 10.1016/j.fct.2016.06.012. [DOI] [PubMed] [Google Scholar]
  28. Yang H., Chung D. H., Kim Y. B., Choi Y. H., Moon Y. Toxicology. 2008;243:145–154. doi: 10.1016/j.tox.2007.10.002. [DOI] [PubMed] [Google Scholar]
  29. Dai Y., Xie H., Xu Y. Biochem. Biophys. Res. Commun. 2017;483:572–577. doi: 10.1016/j.bbrc.2016.12.103. [DOI] [PubMed] [Google Scholar]
  30. Duan J., Yin J., Ren W., Liu T., Cui Z., Huang X., Wu L., Kim S. W., Liu G., Wu X., Wu G., Li T., Yin Y. Amino Acids. 2016;48:53–64. doi: 10.1007/s00726-015-2065-3. [DOI] [PubMed] [Google Scholar]
  31. Yin J., Ren W., Duan J., Wu L., Chen S., Li T., Yin Y., Wu G. Amino Acids. 2014;46:883–892. doi: 10.1007/s00726-013-1643-5. [DOI] [PubMed] [Google Scholar]
  32. Wu L., Wang W., Yao K., Zhou T., Yin J., Li T., Yang L., He L., Yang X., Zhang H., Wang Q., Huang R., Yin Y. PLoS One. 2013;8:e69502. doi: 10.1371/journal.pone.0069502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Yang H. S., Wu F., Long L. N., Li T. J., Xiong X., Liao P., Liu H. N., Yin Y. L. J. Zhejiang Univ., Sci., B. 2016;17:752–762. doi: 10.1631/jzus.B1500192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Tsukita S., Furuse M., Itoh M. Nat. Rev. Mol. Cell Biol. 2001;2:285–293. doi: 10.1038/35067088. [DOI] [PubMed] [Google Scholar]
  35. Lessard M., Savard C., Deschene K., Lauzon K., Pinilla V. A., Gagnon C. A., Lapointe J., Guay F., Chorfi Y. Food Chem. Toxicol. 2015;80:7–16. doi: 10.1016/j.fct.2015.02.013. [DOI] [PubMed] [Google Scholar]
  36. Alizadeh A., Braber S., Akbari P., Garssen J., Fink-Gremmels J. Toxins. 2015;7:2071–2095. doi: 10.3390/toxins7062071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Akbari P., Braber S., Gremmels H., Koelink P. J., Verheijden K. A., Garssen J., Fink-Gremmels J. FASEB J. 2014;28:2414–2429. doi: 10.1096/fj.13-238717. [DOI] [PubMed] [Google Scholar]
  38. Bracarense A. P., Lucioli J., Grenier B., Drociunas Pacheco G., Moll W. D., Schatzmayr G., Oswald I. P. Br. J. Nutr. 2012;107:1776–1786. doi: 10.1017/S0007114511004946. [DOI] [PubMed] [Google Scholar]
  39. Pinton P., Nougayrede J. P., Del Rio J. C., Moreno C., Marin D. E., Ferrier L., Bracarense A. P., Kolf-Clauw M., Oswald I. P. Toxicol. Appl. Pharmacol. 2009;237:41–48. doi: 10.1016/j.taap.2009.03.003. [DOI] [PubMed] [Google Scholar]
  40. De Walle J. V., Sergent T., Piront N., Toussaint O., Schneider Y. J., Larondelle Y. Toxicol. Appl. Pharmacol. 2010;245:291–298. doi: 10.1016/j.taap.2010.03.012. [DOI] [PubMed] [Google Scholar]
  41. Maresca M., Mahfoud R., Garmy N., Fantini J. J. Nutr. 2002;132:2723–2731. doi: 10.1093/jn/132.9.2723. [DOI] [PubMed] [Google Scholar]
  42. Praveena P. E., Periasamy S., Kumar A. A., Singh N. Res. Vet. Sci. 2010;89:332–339. doi: 10.1016/j.rvsc.2010.04.012. [DOI] [PubMed] [Google Scholar]
  43. Amuzie C. J., Harkema J. R., Pestka J. J. Toxicology. 2008;248:39–44. doi: 10.1016/j.tox.2008.03.005. [DOI] [PubMed] [Google Scholar]
  44. Azcona-Olivera J. I., Ouyang Y., Murtha J., Chu F. S., Pestka J. J. Toxicol. Appl. Pharmacol. 1995;133:109–120. doi: 10.1006/taap.1995.1132. [DOI] [PubMed] [Google Scholar]
  45. Becker C., Reiter M., Pfaffl M. W., Meyer H. H., Bauer J., Meyer K. H. Mycotoxin Res. 2011;27:287–293. doi: 10.1007/s12550-011-0106-7. [DOI] [PubMed] [Google Scholar]
  46. Ekstrand M. I., Falkenberg M., Rantanen A., Park C. B., Gaspari M., Hultenby K., Rustin P., Gustafsson C. M., Larsson N. G. Hum. Mol. Genet. 2004;13:935–944. doi: 10.1093/hmg/ddh109. [DOI] [PubMed] [Google Scholar]
  47. Maniura-Weber K., Goffart S., Garstka H. L., Montoya J., Wiesner R. J. Nucleic Acids Res. 2004;32:6015–6027. doi: 10.1093/nar/gkh921. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Fang H., Cong L., Zhi Y., Xu H., Jia X., Peng S. Toxicol. Lett. 2016;258:259–266. doi: 10.1016/j.toxlet.2016.06.2103. [DOI] [PubMed] [Google Scholar]
  49. Scarpulla R. C. J. Cell. Biochem. 2006;97:673–683. doi: 10.1002/jcb.20743. [DOI] [PubMed] [Google Scholar]
  50. Hoffbuhr K. C., Davidson E., Filiano B. A., Davidson M., Kennaway N. G., King M. P. J. Biol. Chem. 2000;275:13994–14003. doi: 10.1074/jbc.275.18.13994. [DOI] [PubMed] [Google Scholar]
  51. Sue C. M., Karadimas C., Checcarelli N., Tanji K., Papadopoulou L. C., Pallotti F., Guo F. L., Shanske S., Hirano M., De Vivo D. C., Van Coster R., Kaplan P., Bonilla E., DiMauro S. Ann. Neurol. 2000;47:589–595. [PubMed] [Google Scholar]
  52. Wallace D. C. Annu. Rev. Genet. 2005;39:359–407. doi: 10.1146/annurev.genet.39.110304.095751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Alcendor R. R., Kirshenbaum L. A., Imai S., Vatner S. F., Sadoshima J. Circ. Res. 2004;95:971–980. doi: 10.1161/01.RES.0000147557.75257.ff. [DOI] [PubMed] [Google Scholar]

Articles from Toxicology Research are provided here courtesy of Oxford University Press

RESOURCES