Skip to main content
NCBI home page
Toxicology Research logoLink to Toxicology Research
. 2016 Sep 19;5(6):1711–1719. doi: 10.1039/c6tx00288a

Effect of dietary protein or calcium supplement on the expression of collagen I and dentine phosphoprotein of rats with dental fluorosis

Min Wang a,b,c,†, Tianlong Han a,b,c,†, Huacheng Chen a, Jundong Wang a,✉
PMCID: PMC6061536  PMID: 30090470

graphic file with name c6tx00288a-ga.jpgThis study aims to assess the roles of dietary protein (Pr) and calcium (Ca) levels associated with excessive fluoride (F) intake and the impact of Pr, Ca, and F on expression of collagen I (COL I) and dentine phosphoprotein (DPP) in rat incisors.

Abstract

This study aims to assess the roles of dietary protein (Pr) and calcium (Ca) levels associated with excessive fluoride (F) intake and the impact of Pr, Ca, and F on expression of collagen I (COL I) and dentine phosphoprotein (DPP) in rat incisors. Seventy-two rats were randomly allotted to six groups (NC, NC + F, LPrLCa, LPrLCa + F, HPrLCa + F and LPrHCa + F). F, Pr, and Ca were orally administrated to rats for 120 days. The genes and proteins expression levels were quantified. We found that levels of COL1A1 and DSPP gene were respectively decreased by 41.9% and 43.1% in the NC + F group compared with NC group, were respectively decreased by 47.9% and 40.8% in the LPrLCa + F group compared with LPrLCa group, were respectively increased by 71.8% and 39.5% in the HPrLCa + F group and increased by 26.5% and 21.1% in the LPrHCa + F group compared with LPrLCa + F group. Meanwhile, the proteins’ expression display with the genes’ expression changes were consistent. This study demonstrated that the gene and protein expressions of COL I and DPP were reduced by F both in normal nutrition and malnutrition, and it was reversed by Pr and Ca supplementation, with the effect of Pr being greater than that of Ca.

1. Introduction

Fluoride (F) is the main form of fluorine whose chemical property is very active in nature. It plays an important role in industry, such as in smelting or as a coolant, but it also pollutes air and crops. The amount of F in an organism is extremely small, and about 90% of it is distributed in skeletons and teeth.1 At high concentrations, F can cause damage to multiple organs and tissues, such as in the brain,2–4 reproduction organs,5–7 liver,8,9 spleen,10 thyroid,11–13 and especially to the skeleton and teeth, which can progress to fluorosis.14–16

Dental fluorosis is a well-known chronic metabolic disease caused by the prolonged presence of ingested excessive amounts of fluoride,17–19 characterized by tooth discoloration. Fluoride leads to disturbances in teeth mineralization.17,18,20 As suggested by Susheela in the 1970s, collagen protein is a target damaged by excessive F ingestion. In teeth the predominant form of collagen is type I (COL I) encoded by COL1A1 and COL1A2 genes. Many investigations have previously demonstrated negative effects of F on type I collagen (COL1A1 and COL1A2) in the ribs of rabbits21 and cashmere goats,22 the teeth of sheep23 and guinea pigs,24 and the osteoblasts of rats.25

Dentine phosphoprotein (DPP) plays an important role in dental mineralization, tertiary dentin formation, and also constitutes collagen and non-collagenous proteins as the main component in teeth.26–28 DPP is coded by the Dentin Sialophosphoprotein (DSPP) gene; it was reported that damage of the DSPP gene can cause high frequency hearing loss and dental dystrophy.29–31 Fluoride-induced alterations to the biochemical structure of DPP appear to influence the phosphorylation of these macromolecules.32 Dentin fluorosis has also resulted in reduced synthesis of dentine sialoprotein (DSP).33 Our previous experiments demonstrated that F significantly increased the expression level of the DSPP gene in teeth of sheep.23

Various investigations have demonstrated that damage of F on an organism was closely bound with nutritional status.34,35 Protein (Pr) is one of the most important nutrients. Tooth matrix was severely damaged under low Pr intake and industrial F pollution in goats with obscure and uneven boundary lines among enamel, dentine, and cementum, the weak and irregular collagen in dentine.36 Pr-supplemented diet distinctly attenuated F toxic effects on the level of bone carboxyglutamate protein (BGP) in serum of offspring rats.37 Increased Pr lessened the F content in the femur, and alleviated the F-induced low rate of growth in rabbits.38 Effects of F-induced low bone mineral content were reversed in rabbits fed high Pr diet on 30 days.39

Calcium (Ca) is the main component of teeth. Fluorine in nature in the main form is Ca-containing compounds, such as fluorspar (CaF2) and fluorapatite (Ca10(PO4)6F2). Exposure to high doses of NaF can lead to low hyperactivation via alteration of a Ca2+ signaling alleyway in sperm from adult mice.40 With Ca supplementation, the activities of serum alkaline phosphatase (ALP) and serum tartrate resistant acid phosphatase (StrACP) were efficiently stabilized, which affected F toxicity, and the serum calcitonin (CT) level was increased.37

Many studies have shown that adequate or supplementary ingestion of Pr or Ca can reduce toxic effects of F on the ribs and femurs of rabbits,21,38 and the thyroid, kidney and thymus of rats,12,41,42 and the liver and immune functions of rabbits.43–45 The question then arises: whether Pr and Ca will affect the expression of COL and DPP in F? A model of normal nutrition and malnutrition can be set up to observe the effect of F on the gene and protein expressions of COL I and DPP in incisors in rats by quantitative real-time reverse transcription polymerase chain reaction (QRT-PCR) and immunohistochemistry (IHC).

2. Materials and methods

Experimental animals and chemicals

Rats and their treatment were the same as in our earlier reports.41 Seventy-two 30-day-old male Wistar albino rats with an average weight of 58.0 ± 7.8 g were provided by the Experimental Animal Center of Shanxi Medical University of China. NaF was supplied by Sigma Company (USA). Goat anti-COL I polyclonal antibody was from Santa Cruz Biotechnology, Inc. Rabbit anti-DPP polyclonal antibody was purchased from Uscn Sciences Co. Ltd, Wuhan, China. Biotin-labeled anti-goat secondary antibody was supplied by Haoyang Biological Manufacture Co., Ltd, Tianjin, China. Biotin-labeled anti-rabbit secondary antibody was purchased from Uscn Sciences Co. Ltd, Wuhan, China. Trizol Reagent was purchased from Invitrogen (Carlsbad, CA, USA). The One-Step SYBR® RT-PCR kit and real time PCR primers were obtained from the Takara Biotechnology Company (Dalian, China). HE and Masson Trichrome kits were purchased from Baso Diagnostics, Inc., Zhuhai, China.

Establishment of animal model

Animals were handled in accordance with the principles of laboratory animal care and all experimental procedures were approved by the Research Commission for the Care and Use of Experimental Animal Center of Shanxi Medical University of China. The rats were randomly divided into six groups of twelve. Each group was maintained on diets and water regimens shown in Table 1 under standard conditions of temperature (22–25 °C), light (12 h light, 12 h dark cycle), ventilation, and hygiene.

Table 1. Fluoride (F) in the drinking water (mg F– per L), protein (Pr), calcium (Ca) and phosphorous (P) levels (%), and energy density (ED as MJ kg–1) in the diet of the rats.

Treatment Pr Ca P F ED
Normal control (NC) 17.92 0.85 0.47 0 12.8
Normal control + NaF (NC + F) 17.92 0.85 0.47 150 a 12.8
Low protein and low calcium (LPrLCa) 10.01 0.24 0.16 0 12.8
Low protein and low calcium + NaF (LPrLCa + F) 10.01 0.24 0.16 150 a 12.8
High protein and low calcium + NaF (HPrLCa + F) 25.52 0.25 0.17 150 a 12.8
Low protein and high calcium + NaF (LPrHCa + F) 10.60 1.93 0.98 150 a 12.8
Open in a new tab

aFrom 338 mg L–1 NaF.

Tissue collection

On the 120th day of the treatment, experimental rats of the six groups were sacrificed by jugular vein exsanguination, and the incisor tissues from six rats in each group were collected, the residual feed was cleaned, and soft tissue was quickly removed (excluding dental pulp). Then, after being washed three times with cold physiological saline, the tissues were stored in liquid nitrogen for total RNA extraction. The incisors from the other six rats were dipped into 4% polyoxymethylene for fixing, dehydrated, embedded in paraffin for Hematoxylin-Eosin Staining (HE) and immunohistochemistry studies, and dipped into Bouin's solution for Masson Trichrome staining.

HE and Masson trichrome staining

After being fixed (20–25 °C for 24 h), the incisors were washed three times in 0.01 M phosphate buffer solution (PBS, pH 7.4), decalcified with 10% ethylene diamine tetraacetic acid disodium salt (EDTA-2Na) and EDTA-2Na was replaced twice per day for four weeks. Then they were dehydrated, embedded in paraffin, and sliced into 5 μm sections for staining with HE and Masson Trichrome following the protocol recommended with the reagent kit.

Total RNA extraction and analysis

Rat incisors were crushed in liquid nitrogen and total cellular RNA was isolated from them using Trizol Reagent (Invitrogen, USA) and XHF-1 High-speed Disperser (Scientz, China), according to the manufacturer's recommendations. The RNA extracts were treated with RNase-free DNaseI to remove contaminating DNA, and then were dissolved in diethylpyrocarbonate-treated water; the RNA concentration and purity were estimated by reading absorbance at 260 and 280 nm on a spectrophotometer (Eppendorf, Hamburg, Germany). The ratio of absorption (260 and 280 nm) of all preparations was 1.8 to 2.0. Aliquots of the RNA samples were subjected to electrophoresis through a 1.2% agarose gel with ethidium–bromide staining to verify integrity, and stored at –80 °C.

Specific primers (Table 2) for QRT-PCR were designed based on available rat sequences in GenBank for COL1A1 (NM_053304.), DSPP (NM_012790.), and β-actin (NM_031144.) using Primer premier 5.0 and Primer 3 software. The three pairs of primers were tested for their specificity by the conventional reverse transcription polymerase chain reaction (RT-PCR) before being used in QRT-PCR studies and by melting curve analysis following QRT-PCR.

Table 2. Primer sequences with their corresponding PCR product size and position.

Gene Primers (5′ → 3′) Primer locations Product (base pairs) GenBank accession no.
β-Actin TTGCTGACAGGATGCAGAAG 1007–1131 125 NM_031144
GGACAGTGAGGCCAGGATAG
COL1A1 TTCGAGTATGGAAGCGAAGG 4084–4232 149 NM_053304
TTGAGGTTGCCAGTCTGTTG
DSPP GTTAGTGCCGCTGGAGAGAG 75–189 115 NM_012790
ATCGTCGTTAGTGGCGTTG
Open in a new tab

Quantitative real-time RT-PCR

Expression levels of COL1A1 and DSPP gene were quantified by real-time amplification of the target genes, and the house-keeping gene β-actin as control, from the above RNA preparation using the Mx3000P™ QRT-PCR system (Stratagene, USA) and One-Step SYBR® QRT-PCR kit. The QRT-PCR was performed in a 20 μL reaction mixture. Relative quantification of QRT-PCR product was performed using the comparative ΔΔCT method and SYBR green fluorescent labeling.

The QRT-PCR protocol included reverse transcription at 42 °C for 5 min and an initial denaturation at 95 °C for 10 s. This was followed by 40 PCR cycles consisting of a denaturation step at 95 °C for 5 s, an annealing step at 60 °C for 20 s, and an extension step at 72 °C for 6 s. Finally, a melting curve analysis was performed at 95 °C for 15 s, at 60 °C for 1 min, and at 95 °C for 15 s as in the protocol for the three reaction steps. The amplified products were analyzed by agarose gel electrophoresis.

Immunohistochemistry for COL I and DPP

Procedures were processed according to the protocol recommended for the COL I and DPP immunohistochemistry kit. Deparaffinized and rehydrated sections were selectively incubated separately using goat anti-COL I polyclonal antibody (1 : 100) for 3 h at 37 °C and rabbit anti-DPP polyclonal antibody (1 : 50) for 2 h at 37 °C, followed by washing 3 times in PBS. Next, biotin-labeled anti-goat secondary antibody and biotin-labeled anti-rabbit secondary antibody were introduced and incubated for 20 min at 37 °C. The specificity of the antibodies was tested by omission of the primary antibodies. After washing in PBS, tissues were visualized with DAB and counterstained with hematoxylin. Finally, the sections were dehydrated in xylene and coverslipped.

Statistical analysis

To confirm the reproducibility of results, at least five rats per group were used in each stage or treatment. All experiments were replicated at least three times for each group. An independent sample t-test (Statistical Package for the Social Sciences, SPSS 18.0) was performed to analyze differences in COL I and DPP protein expression levels in rat incisors. Differences with p < 0.05 were considered statistically significant.

3. Results

Effect of NaF on dental histology

In collecting samples, we found the fluorosed incisors surfaces had dull chalk-like white or yellow spots, abnormal abrasion, cementum hyperplasia, unusual fusion with alveolar bone, and difficult to separate. The results of HE and Masson staining were in agreement with our previous studies,23,24,36 which included F induced damage of collagen in dentin, especially in malnutrition, and remission appearing in Pr and Ca supplement groups (Fig. 1 and 2).

Fig. 1. Observations of dentin with HE staining. The dentin collagen fibers of the NC group are dense, neat, smooth, and uniform. The dentin collagen fibers of the LPrLCa group are loose with uneven staining. The dentin collagen fibers of the NC + F group are arranged irregularly, fractured and exhibit uneven staining. The dentin collagen fibers of the HPrLCa + F and LPrHCa + F groups are loose with scattered distribution and uneven staining. The dentin collagen fibers of the LPrLCa + F group are dissolved, severely broken, and exhibit uneven coloring. Scale bar = 20 μm.

Fig. 1

Open in a new tab

Fig. 2. Observations of dentin with Masson staining. The dentin collagen fibers of the NC group are dense, neat, smooth and uniform. The dentin collagen fibers of the LPrLCa group are loose and exhibit uneven staining. The dentin collagen fibers of the NC + F group are arranged irregularly, fractured, and exhibit uneven staining. The dentin collagen fibers of the HPrLCa + F and LPrHCa + F groups are loose, with scattered distribution and uneven staining. The dentin collagen fibers of the LPrLCa + F group are dissolved, severely broken, and exhibit uneven coloring. Scale bar = 20 μm.

Fig. 2

Open in a new tab

COL1A1 and DSPP gene expression

The amplification plots, melting curves, and standard curves for COL1A1 gene, DSPP gene, and β-actin gene were obtained after serial dilutions of total RNA, which started from 1 (undiluted, leftmost curve) to 0.015625 (1 : 64 diluted, rightmost curve). In the melting curves the single peak at 84.2 °C for the β-actin gene and 85.5 °C for the COL1A1 gene indicates that no other transcripts were amplified in the real-time RT-PCR. The standard curve for the β-actin gene (Y = –3.459 × log(X) + 20.50, RSq = 0.992, Eff = 94.6%) and COL1A1 gene (Y = –3.568 × log(X) + 18.19, RSq = 0.991, Eff = 90.7%) were obtained by correlation of the Ct values (threshold cycles) with the dilution series of the total RNA. In the melting curves, the single peak at 84.2 °C for β-actin gene and 82.3 °C for DSPP gene indicate that no other transcripts were amplified in the real-time RT-PCR. The standard curve for β-actin gene (Y = –3.482 × log(X) + 20.44, RSq = 0.998, Eff = 93.7%) and DSPP gene (Y = –3.573 × log(X) + 18.44, RSq = 1.000, Eff = 90.5%) were obtained by correlation of the Ct values (threshold cycles) with the dilution series of the total RNA.

Relative expression levels of the COL1A1 gene and DSPP gene in incisors from rats are shown in Fig. 3 and 4. In comparison with the NC (normal control) group, expression levels of the COL1A1 and DSPP gene in the NC + F group were decreased by 41.9% and 43.1%, respectively (P < 0.01). When compared with the LPrLCa (low protein/low calcium) group, expression levels of the COL1A1 and DSPP gene in the LPrLCa + F group were decreased by 47.9% and 40.8%, respectively (P < 0.01). Compared with the LPrLCa + F group, expression levels of the COL1A1 and DSPP gene in the HPrLCa (high protein/low calcium) + F group were increased by 71.8% and 39.5%, respectively (P < 0.01), and in the LPrHCa (low protein/high calcium) + F group they were increased by 26.5% and 21.1%, respectively (P < 0.05).

Fig. 3. The relative expression levels of COL1A1 and DSPP gene in incisors of rats on day 120 under normal nutrition (NC and NC + F) were detected using a quantitative real-time reverse transcription polymerase chain reaction. **P < 0.01 (compared with the NC group).

Fig. 3

Open in a new tab

Fig. 4. The relative expression levels of COL1A1 and DSPP gene in incisors of rats on day 120 with different conditions of Pr and Ca intake (LPrLCa, LPrLCa + F, HPrLCa + F and LPrHCa + F) were detected using a quantitative real-time reverse transcription polymerase chain reaction. **P < 0.01 (LPrLCa + F group compared with LPrLCa group); †P < 0.05, ††P < 0.01 (HPrLCa + F group or LPrHCa + F group compared with LPrLCa + F group, respectively).

Fig. 4

Open in a new tab

COL I and DPP protein expression

The COL I and DPP protein expression levels by immunohistochemical detection in the dentin of the rats are recorded in Tables 3 and 4. The immunohistochemistry image results for the COL I and DPP protein are presented in Fig. 5 and 6.

Table 3. The expression of COL I protein in dentin of rats (mean ± SEM, n = 6).

Treatment COL I Relative to NC Relative to LPrLCa Relative to LPrLCa + F
NC 19.94 ± 0.693 1.000 — —
NC + F 12.98 ± 0.616## 0.651 — —
LPrLCa 14.38 ± 0.558## 0.721 1.000 —
LPrLCa + F 9.99 ± 0.547** 0.501 0.695 1.000
HPrLCa + F 12.88 ± 0.477†† 0.646 0.896 1.289
LPrHCa + F 11.82 ± 0.659† 0.593 0.822 1.183
Open in a new tab

Table 4. The expression of DPP protein in dentin of rats (mean ± SEM, n = 6).

Treatment DPP Relative to NC Relative to LPrLCa Relative to LPrLCa + F
NC 17.71 ± 0.966 1.000 — —
NC + F 14.83 ± 0.666## 0.837 — —
LPrLCa 16.99 ± 1.024 0.959 1.000 —
LPrLCa + F 10.63 ± 0.756** 0.600 0.626 1.000
HPrLCa + F 14.59 ± 0.342†† 0.824 0.859 1.373
LPrHCa + F 12.26 ± 0.852† 0.692 0.722 1.153
Open in a new tab

Fig. 5. Photomicrographs showing expressions of COL I protein in dentin of rats treated with different conditions of F, Pr, and Ca intake for 120 days by immunohistochemistry. The brown fibers arranged in the dentin are regarded as the protein expression of COL I. Compared with the LPrLCa group, the LPrLCa + F, HPrLCa + F, and LPrHCa + F groups exhibit weaker staining intensity, accounting for the decrease in COL I expression, as found in the comparison between the NC group and the NC + F group. Scale bar = 20 μm.

Fig. 5

Open in a new tab

Fig. 6. Photomicrographs showing expressions of DPP protein in dentin of rats treated with different conditions of F, Pr, and Ca intake for 120 days by immunohistochemistry. The brown fibers arranged in the dentin are regarded as the protein expression of DPP. Compared with the LPrLCa group, the LPrLCa + F, HPrLCa + F, and LPrHCa + F groups exhibit weaker staining intensity, accounting for the decrease in DPP expression, as found in the comparison between the NC group and the NC + F group. Scale bar = 20 μm.

Fig. 6

Open in a new tab

In comparison with the NC (normal control) group, the expression levels of COL I and DPP protein in the NC + F group were decreased by 34.9% and 16.3%, respectively (P < 0.01). When compared with the LPrLCa (low protein/low calcium) group, the expression levels of COL I and DPP protein in the LPrLCa + F group were decreased by 30.5% and 37.4%, respectively (P < 0.01). Compared with the LPrLCa + F group, the expression levels of COL I and DPP protein in the HPrLCa (high protein/low calcium) + F group were increased by 28.9% and 37.3%, respectively (P < 0.01), and in the LPrHCa (low protein/high calcium) + F groups were increased by 18.3% and 15.3%, respectively (P < 0.05).

4. Discussion

Excessive F causes different damage to tissues and organisms, and teeth are the first to show it. A number of studies have shown that fluorosis could be relieved by Pr supplement in diet.35,37 WF (well-fed) and PU (protein undernourished) rats responded differently to fluoride toxicity.46 It was reported that children showing under nutrition were more likely to have moderate/severe fluorosis.47 Ca comprises the main composition, and it plays an important role in metabolism of teeth. Many research projects have been designed to study the effects of Ca and other trace elements in rivalry with F, but these have various results.37,48,49

F inhibits the body weight and development of children and many animals. High levels of F could cause a inhibition in growth and food utilization efficiency of crops and might cause a threat to them in the field.50 F affects the growth of Escherichia coli, which may be by acting on the expression of genes and protein.51 In this study, the sequence of weight gain in rats of each group during the 60-day treatment period was: NC > HPrLCa + F > LPrHCa + F > NC + F > LPrLCa > LPrLCa + F.12 Compared with the normal control (NC) group, weight gain of rats was significantly decreased in the LPrLCa group. Compared with the LPrLCa group, weight gain of rats was significantly increased in the HPrLCa + F group and LPrHCa + F group. Further, Pr supplementation was more effective than Ca supplementation over the 60-day treatment period in case of malnutrition + F. These factors indicated that Pr and Ca are essential for development and growth.

In industrial F polluted regions, teeth morphology, structure, and color with goats showed significant changes; the boundary lines between enamel and dentine or between cementum and dentine were both blurred and unclear, and had fractured, bent, and loose collagen in dentine.36 Pits on the surface of healthy teeth were tidy and uniform in size, but were irregular and uneven on fluorosed teeth as shown by scanning electron microscopy.19 In this study, there are clear separations between dentin, enamel and cementum in rat incisors, the collagen fibers are arranged in good order, and the transverse cellulose strands are shown as a uniform distribution of compact holes with similar sizes in the NC group. Clear boundaries between dentin, enamel, and cementum tissue can be difficult to find rats with malnutrition (low Pr and low Ca) or with fluoride treated rats; the dentin collagen fibers may be in loose order and arranged irregularly, and cross-sectional holes may vary in size. The extent of damage to the LPrLCa + F group is the most serious. This study showed that both Pr and Ca supplementations could alleviate dental fluorosis in cases of Pr and Ca deficiency malnutrition.

Collagen is the target of excessive F exposure.52 COL I (the main composition of collagen) is regarded as the skeleton frame.18,27 150 mg L–1 F decreased the expression of COL1A1 in incisors and molars of male guinea pigs.24 The COL1A1 gene expressions obviously were reduced in fluorosed rabbit ribs with 200 mg kg–1 F–, whereas the toxic effect of was reversed by protein or Ca supplementation.21 The results of QRT-PCR and immunohistochemistry indicated that COL1A1 gene and COL I protein expressions were restrained by F both in normal nutrition and malnutrition groups, and it can be reversed by Pr and Ca supplements.

DPP (the main composition of non-collagen, hyperphosphorylated and rich in serine and aspartic acid) is regarded as the crystal nucleus in mineralization.18,27 DPP and COL I are both crucial in the mineralization of teeth, so they become the focus of dental fluorosis research.29,53 In this study, F inhibited the gene and protein expressions of DPP, while the F toxic effect could be reversed by Pr or Ca supplements.

F is an inhibitor of various enzymes-like phosphatases.54,55 We speculate that fluoride damages the structure and formation of dentin by restraining the gene and protein expressions of COL I and DPP, and by inhibiting the correlative enzymes like phosphatases and DNA polymerase, thus leading to dystrophic mineralization of teeth. Gene expression was partially restored in the Pr and Ca supplement group; perhaps they strengthen the physiological function and resistance but this remains to be verified with further studies.

In this study, we detected RNA in the whole incisor but found protein in dentin only. Because we had to decalcify the tissues in making paraffin section the effect of F on mineralization in enamel and dentin could not be observed. Further investigations should be carried out in enamel, dentin, cementum, and pulp of incisors and molars respectively, if possible, using un-decalcified sections to conduct better observations. We designed a high dose of F for this study, but different dose gradients should be instituted in future studies.

In summary, this study demonstrated that high F and malnutrition (low Pr and low Ca) aggravated dental fluorosis, and Pr or Ca supplementation alleviated fluorosis in rats, with the effect of Pr showing better results than that of Ca.

Conflict of interest statement

The authors declare that there are no conflicts of interest.

Abbreviations

F

Fluoride

NaF

Sodium fluoride

Pr

Protein

Ca

Calcium

COL I

Collagen I

DPP

Dentine phosphoprotein

PBS

Phosphate buffered saline

DAB

Diaminobenzidine

Acknowledgments

This research was sponsored by the National Natural Science Foundation of China (NSFC, Grant No. 31372497, 31540061).

References

  1. Han T. L., Wang M., Anim. Husb. Vet. Med., 2010a, 10 , 226 –228 , [in Chinese] . [Google Scholar]
  2. Ge Y. M., Niu R. Y., Zhang J. H., Wang J. D. Arch. Toxicol. 2011;1:27–33. doi: 10.1007/s00204-010-0537-5. [DOI] [PubMed] [Google Scholar]
  3. Sarkar C., Pal S., Das N., Dinda B. Food Chem. Toxicol. 2014;4:224–236. doi: 10.1016/j.fct.2014.01.020. [DOI] [PubMed] [Google Scholar]
  4. Sudipta P., Chaitali S. Environ. Toxicol. Pharmacol. 2014;2:684–699. doi: 10.1016/j.etap.2014.07.009. [DOI] [PubMed] [Google Scholar]
  5. Sun Z. L., Niu R. Y., Wang B., Wang J. D. Environ. Toxicol. 2014;6:690–696. doi: 10.1002/tox.21796. [DOI] [PubMed] [Google Scholar]
  6. Niu R., Wang J., Sun Z., Xue X., Yan X., Wang J., Zhang J., Wang J. Environ. Toxicol. Pharmacol. 2015;9:557–562. doi: 10.1016/j.etap.2015.08.007. [DOI] [PubMed] [Google Scholar]
  7. Zhou Y. J., Zhang H. L., He J. L., Chen X. M., Ding Y. B., Wang Y. X., Liu X. Q. Food Chem. Toxicol. 2013;6:297–303. doi: 10.1016/j.fct.2013.02.026. [DOI] [PubMed] [Google Scholar]
  8. Niu R., Han H., Zhang Y., Wang J., Zhang J., Yin W., Yin X., Sun Z., Wang J. Biol. Trace Elem. Res. 2015;11:1–7. [Google Scholar]
  9. Barbara S., Beata B., Katarzyna B., Ewa B. Food Chem. Toxicol. 2012;3:972–978. [Google Scholar]
  10. Zhang G. H., Zhou B. R., Han T. L., Wang M., Du X. P., Li Q., Wang J. D. Fluoride. 2012;4:357–364. [Google Scholar]
  11. Chen J. J., Xue W. J., Cao J. L., Song J., Jia R. H., Li M. Y. Aquat. Toxicol. 2016;2:48–58. [Google Scholar]
  12. Wang H. W., Yang Z., Zhou B. H., Gao H., Yan X. Y., Wang J. D. Toxicol. Ind. Health. 2009a;25:49–57. doi: 10.1177/0748233709102720. [DOI] [PubMed] [Google Scholar]
  13. Ge Y. M., Ning H. M., Gu X. L., Yin M., Yang X. F., Qi Y. H., Wang J. D. J. Integr. Agric. 2013;3:502–508. [Google Scholar]
  14. Yan X., Hao X., Nie Q., Feng C., Wang H., Sun Z., Niu R., Wang J. Chemosphere. 2015;7:36–41. doi: 10.1016/j.chemosphere.2014.12.090. [DOI] [PubMed] [Google Scholar]
  15. Falk S., Ferhat D., Werner H., Hendrik M., Sebastian P. Community Dent Oral Epidemiol. 2015;6:521. [Google Scholar]
  16. Zoran M., Marijana C., Biljana A., Charles P. L., Momir C. Food Chem. Toxicol. 2009;6:1080–1084. [Google Scholar]
  17. Wang J. D., Zhan C. W., Chen Y. F., Li J. X., Wang W. F., Cai J. P. Fluoride. 1992;3:123–128. [Google Scholar]
  18. Hao Y. Q., Wang G. Q., Niu Z. Y., Chinese J. Conserv. Dent., 2003, 2 , 112 –114 , [in Chinese] . [Google Scholar]
  19. Wang J. D., Guo Y. H., Liang Z. X., Hao J. H. Fluoride. 2003;1:177–184. [Google Scholar]
  20. Barbara S., Arnold I., Diana K. Dent. Clin. North Am. 2015;3:583. [Google Scholar]
  21. Yan X. Y., Li W. T., Zhou B. H., Wang J. M., Wang J. D. Fluoride. 2007;2:140–148. [Google Scholar]
  22. Li W. T., Yang L. F., Ren Y. C., Yan X. Y., Wang J. D. Fluoride. 2007;1:13–18. [Google Scholar]
  23. Han T. L., Wang M., Yan X. Y., Niu R. Y., Wang J. D. Fluoride. 2010b;1:19–24. [Google Scholar]
  24. Wang M., Han T. L., Cao C. F., Wang J. D. Fluoride. 2010;1:45–51. [Google Scholar]
  25. Yan X. Y., Yan X. T., Morrison A., Han T. L., Chen Q. L., Li J., Wang J. D. Toxicol. Lett. 2011;3:133–138. doi: 10.1016/j.toxlet.2010.11.005. [DOI] [PubMed] [Google Scholar]
  26. Luo S. J., Li Y. J., Chin. J. Stomatol., 2003, 1 , 56 –58 , [in Chinese] . [PubMed] [Google Scholar]
  27. Xie Q. F., Dental anatomy and oral physiology, Peking University Medical Press, 2005, vol. 07, pp. 15–55 [in Chinese]. [Google Scholar]
  28. Shinji K., Adv. Metallic Biomater., 2015, 3 , 99 –122 , , Springer Series in Biomaterials Science and Engineering . [Google Scholar]
  29. Sreenath T., Thyagarajan T., Hall B., Glenn L., Rena D. J. Biol. Chem. 2003;27:74–80. [Google Scholar]
  30. Helen R. M., Koch M. J., Davies R. M., Mellody K. T., Kielty C. M. Hum. Mol. Genet. 2002;21:59–65. doi: 10.1093/hmg/11.21.2559. [DOI] [PubMed] [Google Scholar]
  31. Izabela M., Ewa C. J. Dent. 2012;7:542–548. [Google Scholar]
  32. Milan A., Waddington R., Embery G. Calcif. Tissue Int. 1999;3:234–238. doi: 10.1007/s002239900609. [DOI] [PubMed] [Google Scholar]
  33. Yukiko N., Pamela D. Dent. Pulp. 2014;6:191–199. [Google Scholar]
  34. Wang H. Z., Shen E. L. and Hou P. S., The progress of prevention and control of local fluorosis in China, [ISFR XX conference memoirs], Beijing, China, 1994a, pp. 23–25. [Google Scholar]
  35. Wang J. D., Hong J. H., Li J. X., Cai J. P. Fluoride. 1994b;3:136–140. [Google Scholar]
  36. Wang J. D., Hong J. H., Li J. P., Guo Y. H., Zhang J. F., Hao J. H. Fluoride. 2002;1:51–55. [Google Scholar]
  37. He Y., Niu R. Y., Wang J. M., Liu H. T., Wang J. D. Fluoride. 2008;3:192–198. [Google Scholar]
  38. Wang J. M., Cheng X. F., Zhou B. H., Yan X. Y., Guo Y. X., Wang J. D. Fluoride. 2008a;1:18–27. [Google Scholar]
  39. Wang J. M., Niu R. Y., Sun Z. L., Lv L. H., George W. S., Wang J. D. Fluoride. 2008b;4:283–291. [Google Scholar]
  40. Sun Z. L., Niu R. Y., Su K., Wang B., Wang J. M., Zhang J. H., Wang J. D. Arch. Toxicol. 2010;5:353–361. doi: 10.1007/s00204-009-0508-x. [DOI] [PubMed] [Google Scholar]
  41. Wang H. W., Zhou B. H., Cao J. L., Gu X. L., Cao C. F., Wang J. D. Environ. Toxicol. 2009b;3:218–224. doi: 10.1002/tox.20421. [DOI] [PubMed] [Google Scholar]
  42. Chen H. C., Hong J. H., Niu R. Y., Sun Z. L., Wang J. D. Fluoride. 2009;2:121–126. [Google Scholar]
  43. Liang Z. X., Niu R. Y., Wang J. M., Wang H. W., Sun Z. L., Wang J. D. Afr. J. Biotechnol. 2012;73:13801–13808. [Google Scholar]
  44. Zhou B. H., Wang H. W., Wang J. M., Zhang J. H., Yan X. Y., Wang J. D. Fluoride. 2007;3:169–177. [Google Scholar]
  45. Zhou B. H., Wang H. W., Wang J. M., Zhang J. H., Yan X. Y., Wang J. D. Fluoride. 2009;3:216–223. [Google Scholar]
  46. Olusegun L. A., Philemon D. S., Bamidele A. S., Emmanuel O. A., Gbenga A. A. J. Trace Elem. Med. Biol. 2013;4:370–374. [Google Scholar]
  47. Irigoyen-Camachoa M. E., García Pérez A., Mejía González A., Huizar Alvarez R. Sci. Total Environ. 2016;1:512–519. doi: 10.1016/j.scitotenv.2015.09.085. [DOI] [PubMed] [Google Scholar]
  48. Chinoy N. J., Sharma A. Fluoride. 1998;4:203–216. [Google Scholar]
  49. Chinoy N. J., Sorathia H. P., Jhala D. D. Fluoride. 2005;2:109–114. [Google Scholar]
  50. Chen J. J., Cao J. L., Wang J. D., Jia R. H., Xue W. J., Li Y. D., Luo Y. J., Xie L. T. Environ. Toxicol. Chem. 2013;10:2315–2321. doi: 10.1002/etc.2305. [DOI] [PubMed] [Google Scholar]
  51. Ma H. L., Wu X. H., Yang M., Wang J. M., Wang J. M., Wang J. D. Chemosphere. 2014;3:190–193. [Google Scholar]
  52. Susheela A., Sharma Y. Fluoride. 1982;4:177–190. [Google Scholar]
  53. Xu P., Guo X., Foreign Med. Sci. (Section of Med geography), 1998, 4 , 152 –157 , [in Chinese] . [Google Scholar]
  54. Batenburg J. J., Vanden Bergh S. G. Biochim. Biophys. Acta. 1972;280:495–505. doi: 10.1016/0005-2760(72)90129-4. [DOI] [PubMed] [Google Scholar]
  55. Wergedal J. E., Lau K. H., Baylink D. J. Clin. Onhop. Res. 1988;233:274. [PubMed] [Google Scholar]

Articles from Toxicology Research are provided here courtesy of Oxford University Press

RESOURCES