Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Jun 7.
Published in final edited form as: Mol Cell. 2018 Jun 7;70(5):854–867.e9. doi: 10.1016/j.molcel.2018.05.001

Sequence, Structure, and Context Preferences of Human RNA Binding Proteins

Daniel Dominguez 1,*, Peter Freese 2, Maria Alexis 2, Amanda Su 1, Myles Hochman 1, Tsultrim Palden 1, Cassandra Bazile 1, Nicole J Lambert 1, Eric L Van Nostrand 3,4, Gabriel A Pratt 3,4,5, Gene W Yeo 3,4,6,7, Brenton R Graveley 8, Christopher B Burge 1,9,10,*
PMCID: PMC6062212  NIHMSID: NIHMS973257  PMID: 29883606

SUMMARY

RNA-binding proteins (RBPs) orchestrate the production, processing, and function of mRNAs. Here we present the affinity landscapes of 78 human RBPs using an unbiased assay that determines the sequence, structure, and context preferences of these proteins in vitro by deep sequencing of bound RNAs. These data enable construction of “RNA maps” of RBP activity without requiring crosslinking-based assays. We found an unexpectedly low diversity of RNA motifs, implying frequent convergence of binding specificity toward a relatively small set of RNA motifs, many with low compositional complexity. Offsetting this trend, however, we find extensive preferences for contextual features distinct from short linear RNA motifs, including spaced “bipartite” motifs, biased flanking nucleotide composition, and bias away from or towards RNA structure. Our results emphasize the importance of contextual features in RNA recognition, which likely enable targeting of distinct subsets of transcripts by different RBPs that recognize the same linear motif.

Keywords: alternative splicing, CLIP, gene expression, mRNA stability, RBNS, RNA binding protein, RNA recognition motif, KH domain, Zinc finger, Pum domain, RNA secondary structure, RNA context

eTOC blurb

Dominguez et al. describe in vitro binding specificity of 78 human RNA-binding proteins (RBPs) to RNA sequences and structures. They find that many RBPs bind similar RNA motifs, but differ in affinity for spaced “bipartite” motifs, flanking composition, and RNA structure, suggesting that distinct sites are often discriminated based on sequence context.

graphic file with name nihms973257u1.jpg

INTRODUCTION

RNA binding proteins (RBPs) control the production, maturation, localization, translation, and degradation of cellular RNAs. Many RBPs contain well-defined RNA binding domains (RBDs) that engage RNA in a sequence- and/or structure-specific manner. The human genome encodes at least 1500 RBPs that contain established RBDs, the most prevalent of which include the RNA recognition motif (RRM, ~240 RBPs), the hnRNP K-homology domain (KH, ~60 RBPs) and the C3H1 zinc-finger domain (ZF, ~50 RBPs) (reviewed by (Gerstberger et al., 2014)). While RBPs containing RRM (Query et al., 1989) or KH domains (Siomi et al., 1993) were first described over two decades ago, the repertoires of RNA sequences and cellular targets bound by different members of these and other classes of RBPs still remain mostly unknown.

Structural studies have identified canonical types of RBP-RNA interactions but have also uncovered non-canonical binding modes, making it difficult to infer RNA target preferences from amino acid sequence alone (reviewed by (Cléry and Allain, 2013; Valverde et al., 2008)). For example, RRMs typically interact with RNA via subdomains termed RNPs (reviewed by (Afroz et al., 2015)), however structural studies have also shown that certain RBPs bind RNA via the linker regions, loops, or the C- or N- terminal extremities of their RRMs rather than the canonical RNP1 and RNP2 strands (reviewed by (Daubner et al., 2013)). These variable RNA binding mechanisms and the presence of multiple RBDs in most RBPs (Lunde et al., 2007) have motivated efforts to experimentally interrogate the specificity of individual RBPs.

Several methods exist for determining RBP binding sites in vivo, most notably RNA immunoprecipitation (RIP, (Gilbert and Svejstrup, 2006)) and UV crosslinking followed by immunoprecipitation (CLIP) and sequencing (Ule et al., 2003). While such techniques capture RBP-RNA interactions in their cellular contexts, it is often difficult to derive motifs from these experiments due to interactions with protein cofactors, high levels of non-specific background (Friedersdorf and Keene, 2014), and non-random transcriptome composition. Quantitative in vitro assays such as electrophoretic mobility shift assay (EMSA), surface plasmon resonance (SPR), and isothermal calorimetry (ITC) require prior knowledge of putative RNA substrates, making them unsuitable for high-throughput motif discovery. Methods such as SELEX (systematic evolution of ligands by exponential selection) typically select a few high-affinity ‘winner’ sequences, but generally do not reveal the full spectrum of RNA targets or their associated affinities (reviewed by (Cook et al., 2015)). RNAcompete is a high-throughput in vitro binding assay that captures a more complete specificity profile by quantifying the relative affinity of an RBP to a pre-defined set of ~250,000 RNA molecules (Ray et al., 2013). However, one limitation of this approach is that the designed RNAs present motifs in predominantly unstructured contexts, restricting the analysis to short, mostly unpaired motifs. More recent approaches such as RNA Bind-n-Seq (RBNS) (Lambert et al., 2014) and RNAcompeteS (Cook et al., 2017) perform high-throughput sequencing of bound RNAs selected from a random pool, yielding a more comprehensive profile of the sequence and RNA secondary structural specificity of an RBP.

The RNA binding specificity of ~100 human RBPs has been assessed using various unbiased (de novo) methods (Giudice et al., 2016), though the diversity of techniques employed precludes uniform comparison among these factors. To systematically explore the binding specificities of RBPs at high resolution, we performed RBNS on more than 70 human RBPs including diverse RRM and KH domain proteins and some other classes of RBPs, half of which had previously uncharacterized specificities. RBNS comprehensively and quantitatively maps the RNA binding specificity landscape of an RBP through a one-step in vitro binding reaction using a recombinant RBP incubated with a random pool of RNA oligonucleotides (Lambert et al., 2014). The assay was typically carried out for each RBP at five protein concentrations, totaling 400 binding assays that yielded over 6 billion protein-associated reads, enabling detection not only of simple sequence motifs but also of preferred structural and contextual features (Fig. 1A). Analyses of these data revealed a pattern in which many proteins bind to similar motifs but differ in their preferences for additional binding features such as RNA secondary structure, flanking nucleotide composition, and bipartite motifs, facilitating recognition of distinct RNA targets.

Figure 1. Overview of the high-throughput RNA Bind-n-Seq assay and computational analysis pipeline.

Figure 1

A. Schematic of RBNS assay and pipeline.

B. Number of RBPs with one or more of the three most common RBD types assayed.

C. Cumulative distribution of amino acid identity between the most similar pairs of RBDs across all RBPs and those assayed by RBNS.

D. Pearson r of R values between RBNS assays of the same RBP at different protein concentrations. Inset: correlation of 5mer R values of HNRNPL at 20 nM (most enriched concentration) and 80 nM.

RESULTS

High-throughput RNA Bind-n-Seq Assay

To determine the binding preferences of a large set of human RBPs we developed a high-throughput version of RNA Bind-n-Seq (RBNS), an in vitro method that determines the sequence, structure and context preferences of RBPs. In this assay, randomized RNA oligonucleotides (20 or 40 nt) flanked by constant adapter sequences were synthesized and incubated with varying concentrations of a recombinant protein containing the RBD(s) of an RBP tagged with streptavidin binding protein (SBP) (Fig. 1A, constructs listed in Table S1). RNA-protein complexes were isolated with streptavidin-conjugated affinity resin, washed, and bound RNA was eluted and prepared for deep sequencing. Protein purification, binding assays, and sequencing library preparations were carried out in 96-well format, increasing scalability and consistency across experiments (Methods). A typical experiment yielded ~10–20 million unique reads at each protein concentration, which were compared to a similar number of reads from a library generated from the input RNA pool (Fig. S1A, Table S2). Inclusion of sequencing adapters flanking the randomized RNA region simplified library preparation, eliminating ligation biases and amplification of contaminating bacterial RNA carried over from protein purification (Lambert et al., 2014). The RNA pool is estimated to contain nearly every 20mer. Thus, RBPs encounter motifs in a broad spectrum of secondary structural contexts, exceeding that of similar reported methods (Cook et al., 2015), and enabling fine dissection of detailed RNA binding preferences (Fig. S1B).

Binding specificities of a diverse set of RBPs

RBNS was performed on a total of 78 human RBPs (including a few described previously) containing a variety of types and numbers of RBDs (Fig. 1B). RBPs were chosen based on a combination of criteria, including: presence of well-established RBDs; evidence of a role in RNA biology (though this was not required); and secondary criteria related to expression in ENCODE cell lines K562 and HepG2 and availability of knockdown/RNA-seq and/or eCLIP datasets (Van Nostrand et al., 2017). Comparing the RBDs in this set, the range of amino acid identity was similar to that of human RBPs overall (Fig. 1C). Together, this set captures a diverse set of human RRM and KH domain-containing RBPs, and includes examples of proteins with other types of RBDs.

To assess the sequence specificity of each RBP, we calculated enrichment (“R”) values of kmers with varying lengths, where R is defined as the frequency of a kmer in protein-bound reads divided by its frequency in input reads (Fig. 1A, top right). A mean Pearson correlation across 5mer R values of 0.96 was observed among experiments performed on the same RBP at different protein concentrations, indicating high reproducibility (Fig. 1D). A comparison of previously reported binding specificities for 31 factors also assayed using an independent array-based assay (Ray et al., 2013) revealed high correlation with our data (Fig. S1C,D, mean Pearson r = 0.72).

Overlapping specificities of RBPs

To visualize and compare the primary sequence specificities, we derived sequence motif logos for each RBP by aligning enriched 5mers (Z score ≥ 3, weighted by enrichment above input using an iterative procedure that avoids overlap issues, Fig. 1A top right, Methods). For roughly half of the RBPs (41/78), this method yielded multiple sequence logos, indicating affinity to multiple distinct motifs that may reflect different binding modes or binding by distinct RBDs (motif 5mers are listed in Table S3). Clustering proteins based on their top logo, paralogs (e.g., PCBP1/2/4, RBFOX2/3) clustered tightly (Conway et al., 2016; Smith et al., 2013) (Fig. 2A). However, unexpectedly, many completely unrelated proteins, often containing distinct types of RBDs, were also grouped together. Fifteen clusters of RBPs with highly similar primary motifs (nine with three or more members) emerged, leaving 18 RBPs with more distinct motifs unclustered (Methods). Notably, eight of the 15 clusters contained two or more proteins with completely different types of RBDs (e.g., cluster 1 contained RRM-, KH- and ZF-containing proteins as well as factors with multiple RBD types). The use of 5mers rather than longer kmers might miss some more extended motifs that might cluster differently. However, similar motifs and clusterings were generally obtained when logos were generated using 6mers or 7mers rather than 5mers (Supplementary Table S3).

Figure 2. RBPs bind a small subset of the sequence space, characterized by low-entropy motifs.

Figure 2

A. From left to right: Dendrogram of hierarchical clustering of RBPs by sequence logo similarity and 15 clusters at indicated branch length cutoff (dashed line); protein name; colored circles representing nucleotide content of RBP motif (one circle if motif is >66% one base, two half-circles if motif is >33% two bases); top motif logo for each protein; RBD(s), with expressed region underlined; * indicates a natural isoform lacking a canonical RBD.

B. Network map of RBPs with overlapping specificities. Line thickness increases with number of overlapping 6mers as indicated. Node outline indicates RBD type of each protein.

C. Number of unique top 6mers among subsamplings of the 78 RBNS experiments versus randomly selected 6mers.

D. Edge count between nodes for network maps as shown in B, drawn using groups of 15 6mers with decreasing affinity ranks.

E. Entropy of nucleotide composition of RBNS motifs and simulated motifs. P-value determined by Wilcoxon rank-sum test.

F. Enrichment of RBNS motifs over simulated motifs among partitions of a 2D simplex of motif nucleotide composition. Significance along margins was determined by bootstrap Z-score (number of asterisks = Z-score).

To more rigorously assess similarities between RBP affinities, we constructed a network map with edges connecting RBPs that had significantly overlapping sets of top 6mers (which had better statistical power than 5mers for this application), requiring at least two of the 15 most enriched 6mers to overlap (P = 0.001 hypergeometric test, Fig. 2B). While the paralogs RBFOX2 and RBFOX3 were again connected only to each other (both binding 6mers containing GCAUG), many proteins belonged to larger highly connected groups, and overall this network was much more highly connected than expected (P < 10−5, Methods). Indeed, for 27 RBPs the highest ranked 6mer was also the highest ranked 6mer of at least one other RBP, compared to an expected overlap of ~1 if RBPs had motifs distributed randomly across 6mers (Fig. 2C). The excess of overlaps remained when paralogs and RBPs containing RBDs sharing at least 40% amino acid identity with another RBP were excluded (Fig. S2A,B). Regenerating the network map with 6mer sets of progressively decreasing affinity (e.g., 6mers ranked 2–16, 3–17, 4–18, etc. for each RBP) we observed a monotonic decrease in edges (overlaps of two or more), indicating that 6mers bound with highest affinity are most likely to be shared (Fig. 2D). These findings support that many RBPs have convergently evolved to bind similar subsets of motifs.

RBPs preferentially bind low-complexity motifs

We noted that most motifs were composed primarily of just one or two distinct bases (Fig. 2A). To assess motif composition objectively, we measured the Shannon entropy of the nucleotide composition of each sequence logo, which can range from 0 bits (for 100% of one base) to a maximum of 2 bits (for 25% of each base). The entropies of natural RBP motifs were substantially lower than control simulated motifs (P < 10−4, Wilcoxon rank-sum test, Methods), indicating that RBP motifs are biased toward lower compositional complexity (Fig. 2E). To examine the base compositional biases in RBP motifs, we mapped motif compositions onto a two-dimensional grid (Fig. 2F). This analysis revealed overpopulation at all four corners – reflecting enrichment for all types of homopolymeric motifs – and also at some dinucleotide edges, reflecting abundance of A/U-rich (Fig. 2F) and C/U-rich (Fig. S2C) motifs (all P < 0.05 using a permutation test described in Methods). This bias toward low-complexity motifs contributes to the trend toward reduced diversity of motifs noted above.

RNA maps from RBNS and knockdown RNA-seq data

Previously, a number of RNA 6mers have been identified as splicing regulatory elements in cell-based screens from various labs (Ke et al., 2011; Rosenberg et al., 2015; Y. Wang et al., 2012; 2013). To explore the relationship between RBNS motifs and splicing generally, we considered the set of “RBNS 6mers” as the union of the top fifteen 6mers for all RBPs studied. Consistent with many RBPs being involved in pre-mRNA splicing, we found that ~35% of RBNS 6mers matched one of these known splicing regulatory 6mers (Fig. 3A, P = 1.7 × 10−4, hypergeometric test), and RBNS 6mers conferred stronger regulation than non-RBNS 6mers (Fig. 3B left, P = 6×10−36, Wilcoxon rank-sum test). Furthermore, higher RBNS enrichment (reflecting higher affinity to an RBP) was associated with increased splicing activity (Fig. 3B, Spearman 3 = 0.08, P < 10−12).

Figure 3. RBNS-derived motifs are associated with regulation of mRNA splicing and stability in vivo.

Figure 3

A. Overlap of RBNS 6mers and 6mers with splicing regulatory activity (P-value determined by hypergeometric test).

B. Comparison of splicing regulatory scores of, left: RBNS 6mers and all other 6mers; right: all 6mers binned by their maximum R value Z-score across all RBNS experiments (P-values determined by Wilcoxon rank-sum test).

C. Left: Number of alternative exons regulated by RBM25 as determined by RNA-seq after RBM25 KD in HepG2 cells. Right: Proportion of events covered by RBNS 5mers in exonic and flanking intronic regions near alternative exons excluded upon RBM25 KD (red), included upon RBM25 KD (blue), and a control set of exons (black). Positions of significant difference from control exons upon KD determined by Wilcoxon rank-sum test and marked below the x-axis.

D. Overlap of RBNS 6mers and 6mers with 3′UTR regulatory activity (hypergeometric test).

E. Same as B, but comparison with 3′UTR regulation rather than splicing regulation.

F. Pearson r of eCLIP densities across 100 nt windows of 3′ UTRs for all pairs of eCLIP experiments. Pairs of experiments are grouped by category, with all pairs not belonging to “Replicates”, “Paralogs”, or “Similar motifs” (sharing two of top 5 5mers) placed in “Other”. P-values, Wilcoxon rank-sum test, ***P < 5x10−4, N.S.: P > 0.05.

“RNA maps” describing the pattern of context-dependent activity of splicing factors have traditionally been built using in vivo binding data from CLIP-seq combined with genome-wide assays of splicing changes in response to RBP perturbation (Witten and Ule, 2011). To ask whether in vitro data could be used in place of CLIP data to derive maps of splicing activity, we integrated RBNS data with RNA-seq data from K562 and HepG2 cells depleted of specific RBPs by shRNA (Van Nostrand et al., 2017). For example, depletion of RBM25 resulted predominantly in exclusion of cassette exons (Fig. 3C, left), and we found that introns flanking these regulated exons were enriched for RBM25 RBNS motifs relative to control introns (Fig. 3C, right). Together, these data support that RBM25 promotes exon inclusion when it binds intronic motifs near alternative exons, consistent with previous studies of RBM25 (Carlson et al., 2017). This analysis also illustrates the potential of these in vitro data to elucidate in vivo regulation.

By performing similar analyses on all 38 RBNS RBPs for which we had knockdown (KD) data, we observed that 27 of the 38 RBPs showed significant enrichment of their RBNS-derived 5mers in either activated or repressed exons or flanking introns (Fig. S3A). These RNA maps were consistent with previously known patterns of splicing factor activity in many cases, e.g., splicing activation by DAZAP1 (Choudhury et al., 2014) and PUF60 (Page-McCaw et al., 1999) and repression by HNRNPC (Choi et al., 1986) and PTBP1 (Singh et al., 1995). Some RBPs not known to participate in splicing regulation exhibited splicing maps strongly suggestive of direct function (e.g., ILF2 as a splicing activator). Of note, eight of the nine RBPs with G-rich motifs in this set were implicated as splicing activators from at least one region, consistent with the results of an unbiased screen for intronic splicing enhancers, which identified G-rich sequences (Y. Wang et al., 2012).

We also observed significant overlap between RBNS 6mers and 6mers previously shown to modulate mRNA levels when inserted into reporter 3′ UTRs (Oikonomou et al., 2014) (Fig. 3D, P = 3×10−5, hypergeometric test). As observed for splicing regulation, 3′ UTR regulatory scores were higher for RBNS 6mers than non-RBNS 6mers (Fig. 3E left, P = 4×10−10, Wilcoxon rank-sum test), and regulatory scores were higher for 6mers with higher RBNS enrichment (Fig. 3E, Spearman ρ = 0.19, P < 10−11).

We next examined motif density in 3′ UTRs of genes whose expression changed following KD of an RBP to generate 3′ UTR RNA expression maps. Roughly half of the RBPs with corresponding KD data (20/38) had RNA expression maps that were consistent with a role in regulating mRNA levels (Fig. S3A, right), equally split between stabilizing and destabilizing activity. Interestingly, SRSF5 motifs were highly enriched in 3′ UTRs (and near the end of the upstream ORF) of genes up-regulated upon KD (Fig. S3B). Binding of SRSF5 to 3′ UTRs has been observed previously (Botti et al., 2017), and may modulate gene expression levels by linking alternative mRNA processing to nuclear export (Müller-McNicoll et al., 2016). Thus, our assay uncovers patterns of regulation of both splicing and mRNA levels by sequence-specific RBPs that supplement existing CLIP-based RNA maps.

RBPs with similar motifs often bind distinct transcript locations

We found strong agreement between in vivo motifs enriched in eCLIP peaks and corresponding RBNS motifs in most cases, with 17 of 24 proteins having significant overlap between 5mers derived in both assays (Fig. S3C, adapted from (Van Nostrand et al., 2017)). Furthermore, RBNS-enriched 5mers were more enriched in peaks identified in multiple eCLIP replicates and/or cell types, which likely represent sites of more robust and reproducible in vivo binding (Fig. S3D). Together, these observations support that RBNS-identified motifs drive the in vivo RNA binding specificity of most RBPs.

We and others have observed that RBPs appear to bind to only a subset of cognate motifs in expressed transcripts (Taliaferro et al., 2016). However, the extent to which RBPs with similar binding motifs bind the same targets in vivo is incompletely understood. Comparing 3′ UTR binding sites of all RBPs with eCLIP data, we observed a positive correlation in binding locations between pairs of paralogs, but surprisingly little correlation between binding locations of pairs of non-paralogous RBPs that bound similar motifs in vitro (Fig. 3F, Methods). The mean Pearson r of 0.20 observed in these comparisons was not different from random pairs of RBPs, even though in vivo-enriched motifs generally matched those observed in vitro (Fig. S3C). For example, TIA1 and HNRNPC both bind polyU tracts in vitro and in vivo, but they appear to often bind distinct polyU sites in transcripts (Fig. S3E). The low correlation between locations of in vivo binding sites of RBPs with similar motifs could result from various factors, such as differences in RBP localization leading to differential access to transcripts and/or formation of multi-RBP complexes that may alter RNA specificity (e.g., (Damianov et al., 2016)). We hypothesized that additional RNA-intrinsic properties not captured by canonical short RNA motifs might contribute to these differences, and next focused on leveraging the depth and sensitivity of the RBNS data to explore this possibility.

RNA structure preferences of RBPs

Since potential RBP binding sites in the transcriptome exist in a variety of structural conformations, and structure is known to impact RBP binding and regulation (Hiller et al., 2007; Li et al., 2010; Warf et al., 2009), we determined RNA secondary structure preferences for each RBP by computationally folding input and compositionally-matched protein-bound reads for each RBNS experiment (Methods). We computed the ratio of the base-pairing probabilities (Ppaired) of the top RBNS 6mer and its flanking bases in pulldown libraries relative to input (Fig. 4A, Fig. S4A). The majority of RBPs favored reduced basepairing of the motif itself, with some like NUPL2 and RBM41 (marked by arrows) exhibiting extreme sensitivity to structure, and others more modest sensitivity. Just six proteins favored increased structure over their motif, with the strongest preference observed for ZNF326 (Fig. S4A, right). Structural preferences at flanking positions were more variable, including some proteins within the same cluster preferring increased structure five or more bases away from the 6mer (e.g., BOLL, cluster 10 in Fig. 4A) while others favored decreased base-pairing (e.g., PTBP3). Many RBPs showed variable secondary structure preferences at different positions within the top 6mer. For example, NUPL2, a protein that binds A6 motifs, strongly disfavored structure at all positions at all tested protein concentrations (Fig. 4B, top). In contrast, PRR3 disfavored structure at positions 1–4 of its AUAAGC motif but actually favored structure at positions 5 and 6 (Fig. 4B, bottom).

Figure 4. RNA secondary structural preferences of RBPs.

Figure 4

A. The log2(pulldown Ppaired/input Ppaired) for the most enriched pulldown library over each position of the top 6mer plus 10 flanking positions on each side; RBPs are grouped by motif clusters in Fig. 2A and from greatest to least mean log2(pulldown Ppaired/input Ppaired) over the top 6mer from top to bottom within each cluster.

B. Mean change (log2) in Ppaired over each position of the top 6mer at different concentrations of NUPL2 (top) and PRR3 (bottom) relative to the input library.

C. Enrichment of the top 6mer of NUPL2 (top) and PRR3 (bottom) in 5 bins into which all 6mers were assigned based on their average Ppaired.

D. Top: Three types of structural contexts considered and the percentage of all 6mers and RBNS 6mers (top 6mer for each of 78 RBPs) found in each context in pulldown reads. Bottom: Log-fold change of the top 6mer’s recalculated R among 6mers restricted to each structural context relative to the original R.

E, F: Left: Percentage of each position of the top 6mer found in the four structural elements for RBM22 (E) and ZNF326 (F) in pulldown reads. Structure logo for top 6mer is shown above. Right: Representative structure of the top 6mer pairing with the 5′ sequencing adapter (gray) for 6mers found at the most enriched positions within the random 20mer (RBM22, position 5; ZNF326, position 6).

G. Enrichment of the percentage of pulldown vs. input reads containing hairpin loops of various lengths, separated by RBPs that contain (n=13) or do not contain (n=65) at least one KH domain (P < 0.05, Wilcoxon rank-sum test).

H. Average Ppaired in random sequence for all 6mers binned by maximum R value Z-score across all RBNS experiments (***P < 0.0005 by Wilcoxon rank-sum test; overall Spearman ρ = −0.18, P < 10−22).

To assess the effect of RNA secondary structure on enrichment, we recomputed R values for all 6mers considering 6mer occurrences in five structure bins ranging from unpaired (mean Ppaired < 0.2, averaged over the 6 positions) to paired (average Ppaired ≥ 0.8) (Fig. 4C, Methods). Consistent with the pattern observed in Figure 4B, PRR3’s top 6mer was most highly enriched in a moderately structured context (Ppaired 0.2–0.4, Fig. 4C, bottom) while NUPL2’s top 6mer was most enriched in the least structured context (Ppaired 0–0.2, Fig. 4C, top). For PRR3 and NUPL2, the R values of the top 6mer were 3- and 4-fold higher, respectively, in the most enriched Ppaired bin relative to the least enriched bin, underscoring the impact of RNA secondary structure on affinity for these factors. Similar patterns were observed for many other proteins (full listing in Table S4). We observed a high correlation between RNA secondary structure preferences in vitro and those observed in vivo using eCLIP data (Fig. S4B), supporting that structural preferences identified in vitro are relevant in vivo.

RNA structural elements influence binding of some RBPs

To identify specific structures that influence binding, we classified each base in the pulldown and input reads as being part of a stem, hairpin loop, interior loop, or multiloop based on predicted structures (Kerpedjiev et al., 2015). On average, RBNS 6mers were about two-fold overrepresented in hairpin loops and about two-fold underrepresented in stems compared to all 6mers (Fig. 4D, top, Methods). Correspondingly, the top 6mers of many RBPs were more enriched in a loop context (Fig. 4D, bottom), including RBPs of clusters 7, 8, 11, 14, and almost all members of cluster 15. Fewer RBP motifs were preferentially enriched in stems (8 RBPs) or bulged stems (9 RBPs), with generally more modest increases in enrichment than seen in hairpin loops (all enrichments reported in Table S4). Among the strongest stem- and bulged stem-preferring RBPs were the core spliceosomal protein RBM22 (Fig. 4E) – which makes direct contacts with the catalytic RNA structural elements of the U6 snRNA and the intron lariat (Rasche et al., 2012; Zhang et al., 2017) – and the zinc-finger protein ZNF326 (Fig. 4F). RBM22 favored a stem with two bulged bases while ZNF326 favored a stem with one bulged base (Fig. 4F right). Unlike most other RBPs, the motifs for these two proteins showed an uneven distribution along sequence reads and were commonly predicted to pair with the 5′ adapter (Fig. S4C). To ensure that these binding preferences were not biased by the specific RNA pool and adapters used, we performed filter binding experiments with ZNF326 and confirmed a requirement for both the identified primary sequence motif and for structure in the absence of flanking adapters (Fig. S4D).

We also observed a correlation between RBD type and structural element preference. Large hairpin loops were strongly preferred by 10 of 13 KH-containing RBPs (all but the FUBP family), while non-KH RBPs showed much more modest preferences for hairpin loops (Fig. 4G). Given that most (7/10) of these KH RBPs contain multiple KH domains, it is possible that relatively large hairpin loops allow binding of multiple KH domains to the RNA as has been observed in a crystal structure of NOVA1 (Teplova et al., 2011) and in SELEX analysis of PCBP2 (Thisted et al., 2001).

We wondered whether RNA structure might have something to do with our observation made above (Fig. 2B,C,D) that the set of RBPs binds a relatively small subset of RNA motifs. Analyzing folding of random RNAs (Fig. 4H) and fragments of human introns or exons (Discussion), we noted that 6mers with higher maximal RBNS enrichment amongst the 78 RBPs tended to be less structured than 6mers with lower maximal enrichment (overall Spearman ρ = −0.18, P < 10−22). Given that most RBPs prefer to bind unpaired motifs (e.g., Fig. 4A and many previous studies), this observation suggests that many RBPs have evolved specificity for motifs that are intrinsically less structured and therefore have more accessible occurrences in the transcriptome.

Many RBPs favor pairs of short, spaced motifs

It is generally thought that most single RBDs make contacts with 3–5 contiguous RNA bases (Auweter et al., 2006). More than half of the factors in this study contain multiple RBDs (Fig. 1B), either of the same or of different types, that may interact with pairs of short motifs spaced one or more bases apart, hereafter referred to as “bipartite motifs”. Structural evidence supporting binding to bi- and tripartite motifs has been shown for a number of RBPs (reviewed by (Afroz et al., 2015)), raising the question of how widespread this pattern is.

The scale of RBNS sequence data provided statistical power for the unbiased identification of bipartite motifs. We computed enrichments for motifs composed of two 3mer “cores” separated by spacers of 0–10 nt, with spacing 0 representing a contiguous 6mer motif (Fig. 1A, Methods). We found that DAZAP1, which contains two RRMs, preferred AUA followed by a second AUA-containing core spaced by 1–3 nucleotides, with little preference for specific bases in the intervening spacer (Fig. S5A). RBM45, which contains three RRMs, bound two AC-containing cores separated by a spacer of 1–3 nucleotides, with a slight bias against Gs in the spacer (Fig. 5A). The preference for bipartite motifs over the best contiguous 6mers for both DAZAP1 and RBM45 was confirmed by filter assay (Fig. S5A). Analysis of all 78 factors revealed that about one-third of RBPs bound bipartite motifs with similar or greater affinity than linear 6mers, with 18 RBPs showing a significant preference for a bipartite motif over a linear motif at a 5% FDR (Fig. 5C, Table S5, Methods) and an additional 13 RBPs showing more modest preferences for spaced cores (Fig. S5B). Several of the bipartite motif binders identified by these analyses are consistent with previous reports (PCBP2, ELAVL4, CELF1, UNK and NOVA1 (Teplova et al., 2011; 2010; Thisted et al., 2001; X. Wang and Tanaka Hall, 2001)). In addition, we found that MSI1 bound the split motif UAGNNUAG, which combined with structural evidence of its individual RRMs binding to UAG, strongly support MSI1 binding to UAGNNUAG (Iwaoka et al., 2017).

Figure 5. Many RBPs bind bipartite motifs or prefer specific flanking nucleotide compositions.

Figure 5

A, B. Top: Sequence logos of bipartite motifs for DAZAP1 (A) and RBM45 (B). Bottom: Nucleotide composition of the spacer between both motif cores (left) and enrichment as a function of the spacing between cores (right).

C. Core spacing preferences of all RBPs. Each row indicates enrichment as a function of the spacing between cores. Enrichments normalized to maximum value in each row (outlined in black). * Indicates non-zero spacing is significantly preferred over the best linear 6mer. RBPs are grouped by motif clusters in Fig. 2.

D. Pearson correlation between RBD identity within an RBP and the similarity between the core motifs (only RBDs of the same type were compared).

E, F. Flanking nucleotide compositional preferences surrounding the top five 5mers for NOVA1 (E) and FUBP3 (F). Inset: mean enrichments across all positions flanking the motif.

G. Flanking compositional preferences of all RBPs. Enrichment or depletion for each nucleotide surrounding the RBP’s top five 5mers. Boxes indicate significant enrichment (log2(enrichment) > 0.1, P < 0.001).

H. Enrichment of HNRNPK’s top 10 linear 6mers (right) and top 10 degenerate sequences of length 12 with 6 Cs and 6 Ns (left).

I. Filter assay validation of HNRNPK binding to the oligo UUU(CCUCUCUUUUCC)UUU (blue) and the oligo U12 (black) as a negative control. Dot blot of filter assay shown above with fraction of RNA bound quantified below.

As expected, preference for a bipartite motif was associated with the presence of more than one RBD (Fig. S5C, P = 0.023, t-test), although a few exceptions were observed. For example, KHDRBS2 contains a single KH domain but favored a bipartite motif (Fig. S5C). However, this factor also has a QUA1 (Quaking-1) domain, a domain type which can promote homodimerization (Meyer et al., 2010), potentially enabling binding of a bipartite motif as a homodimer.

Certain proteins displayed patterns of enrichment that increased continuously with longer spacing between cores (Fig. 5C). It is possible that these patterns are driven by multimerization and/or aggregation of these proteins. One such factor, FUS, has a C-terminal RG-rich domain that has been shown to promote cooperative binding to RNA via multimerization (Schwartz et al., 2013). Notably, EWSR1, a FUS paralog that has a similar domain composition, displayed a similar preference for increased spacing, suggesting it may also multimerize through low-complexity domains (Schwartz et al., 2015).

Many bipartite cores were highly similar to one another, providing support for the recent finding that multiple RRMs within the same protein (known as sibling RRMs) are often the result of recent tandem RRM duplications (Tsai et al., 2014). For example, we noted that the two RNA cores bound by MSI1 were nearly identical and that MSI1’s two RRMs had a high amino acid identity of ~47%. In contrast, SFPQ favored a bipartite motif consisting of two very different RNA cores, and its RBDs were much less similar (~22% identical). Considering all RBPs, we observed that the percent identity of sibling RBDs within a protein was positively correlated with the similarity of the bipartite motif RNA cores (Fig. 5D, Pearson r = 0.64, P < 0.01, Methods). These observations support a model in which the distinct cores in bipartite motifs are bound by distinct RBDs within the same protein (with dimerization playing a role in some cases).

RNA sequence context commonly influences RBP binding

Binding of certain transcription factors may be enhanced by a particular nucleotide composition adjacent to a high-affinity motif (Jolma et al., 2013), and similar flanking nucleotide biases are also seen around motifs within ChIP-seq peaks (Wei et al., 2010). We hypothesized that adjacent nucleotide context could play a similar role in modulating RBP specificity by altering local RNA secondary structure or creating additional interactions with the RBP.

We identified 28 proteins with a significant preference for a particular base composition flanking single high-affinity motifs (considering only reads with exactly one motif, Table S5, Methods). For example, NOVA1 preferred a C-rich context flanking its motif (Fig. 5E) while FUBP3 preferred to bind its motif in a U-rich context (Fig. 5F). We noted an enrichment for RBPs with KH domains within this set (P < 10−3, Fisher’s exact test), a group that also favored binding to hairpin loops (Fig. 4G). While particular flanking nucleotide compositions may be correlated with presence of large hairpin loops, we observed a majority of these flanking base compositional preferences even after controlling for the secondary structure context of the motif, suggesting that nucleotide context effects and secondary structure can contribute independently to binding (Fig. S5D). In most cases, this nucleotide preference was dependent on the presence of a motif in the read, suggesting that flanking sequence promotes or stabilizes RBP binding to a primary motif. However, some RBPs showed similar nucleotide preferences in the absence of a high-affinity motif (e.g., FUS and IGF2BP1, Fig. S5E), suggesting that these factors have affinity for degenerate sequences with biased nucleotide content.

To explore cases in which biased sequence composition may better describe an RBP’s specificity than a linear motif, we calculated enrichments for patterns with interspersed specific and degenerate positions with biased nucleotide composition. For example, HNRNPK, which showed a preference for C bases in the absence of a high-affinity kmer, had greater enrichment for the interspersed pattern CNCNCNCNNNCC (enriched 2.9-fold) than the corresponding contiguous 6mer CCCCCC (1.11-fold). In fact, many C-rich interspersed patterns had higher enrichments than the top linear 6mers of equal information content for HNRNPK (Fig. 5H, S5F, Methods), a trend that was not observed for most other RBPs (Fig. S5F).

Because such interspersed patterns have not been extensively studied, we confirmed binding of HNRNPK to a representative of the interspersed pattern CCNCNCNNNNCC using a filter binding assay (Fig. 5I). These interspersed patterns were also enriched more than two-fold relative to linear 6mers in HNRNPK eCLIP peaks, supporting in vivo binding of such sequences (Fig. S5G). In all, we identified 17 RBPs whose binding was well described by interspersed patterns. Of these, 14 bound bipartite motifs (Fig. 5C), and showed enrichment for patterns similar to their previously identified bipartite motifs (e.g., CELF1, Fig. S5H). However, three RBPs showed enrichment for patterns with no more than 2 contiguous specified bases (FUBP1, HNRNPK, and PUF60; FUBP1 is shown in Fig. S5I). These patterns may therefore represent degenerate bi- or tripartite motifs, perhaps involving multiple RBDs each contacting just one or two bases.

Towards a more complete characterization of RBP specificities

We have emphasized that, in addition to primary motifs, human RBPs often favor specific secondary structural features, bipartite motifs, and/or flanking nucleotide composition. To visualize preferences for each of these features among RBPs that bind the same linear 6mer, we represented each RBP by a pair of colored semicircles in a two-dimensional coordinate system. The semicircle markers were separated if a bipartite motif was favored, colored based on flanking nucleotide preferences, and placed on the grid according to their structural preferences on the motif itself (x-axis “Ppaired”) and in the flanking region (y-axis “Pflank”). Visualization of RBPs within the AU-rich cluster 1 revealed that no two RBPs are superimposed in this multidimensional space (Fig. 6A), and similar dispersal was observed for most other clusters (Fig. S6A). Overall, we observed that 9/15 clusters diverged significantly in at least one feature, and 5/15 diverged in more than one feature, with bipartite motif spacing being the most common significant feature (Table S6).

Figure 6. RBPs that bind similar motifs often diverge in sequence context preferences.

Figure 6

A. Dispersal of specificities between cluster 1 RBPs. X- and y- axes represent preference for secondary structure over the motif (x) or flanking regions (y). Circle color denotes preference for flanking nucleotide composition. Split semicircles indicate preference for a bipartite motif over a linear motif with the distance between semicircles reflecting preferred spacing of cores.

B. Pairwise distances (1 – Pearson r) of feature-specific R values for pairs of RBPs within a motif cluster (“intra-cluster”) compared to distances between controls (“reps”). *P < 0.05, **P < 0.005, ***P < 0.0005, Wilcoxon rank-sum test.

C. Log2 ratio of Ppaired over U5 occurrences and nucleotides directly upstream and downstream in: RBNS motifs relative to input (top), intronic motifs found eCLIP peaks relative to motifs in control peaks (middle), intronic motifs near exons with increased inclusion upon RBP KD relative to control introns (bottom). *P < 0.05, **P < 0.005, ***P < 0.0005, Wilcoxon rank-sum test.

To quantify the extent to which proteins that bind similar primary motifs differ in contextual features, we computed “feature-specific” R values for the top 6mer in each cluster. These feature-specific R values measure the change in 6mer enrichment as a function of contextual features, capturing the RBP’s bias for or against each feature. This simple approach enables measurement of distances varying from 0 (very similar) to 2 (very different) (Methods) in specificities within a cluster where every protein binds the same motif. For example, while PCBP2 and RBM23 (cluster 12) both bind C-rich sequences, PCBP2 avoids structure within its motif (large feature-specific R) while RBM23 has essentially no structural preference over its motif, yielding a distance of 1.71 for this pair (Fig. S6B). Overall, intra-cluster pairwise distances were significantly higher than distances calculated between replicate RBNS experiments at different RBP concentrations for structure, nucleotide context and bipartite motifs (Fig. 6B).

It is important to understand how RNA binding relates to regulation. We investigated whether contextual features observed in vitro contribute to regulation of targets in vivo. We focused on comparison of HNRNPC and TIA1, which share the same top 5mer U5 but have distinct context preferences in vitro. Both also have well-established roles in regulating splicing which was confirmed by RNA splicing maps (Fig. S3A), and have eCLIP-derived motifs that are identical to their RBNS-derived motifs (Fig. S3C). HNRNPC and TIA1 differ in structure preference over the motif (Ppaired) and flanking regions (Pflank), with HNRNPC showing a stronger bias against structure in both locations by RBNS (Fig. 6C, top). Examining eCLIP peaks for each factor, we observed a stronger bias against structure for HNRNPC than for TIA1 on and flanking U5 motifs in eCLIP peaks (Fig. 6C, middle). Furthermore, we also observed a stronger bias against structure on and flanking U5 motifs located downstream of HNRNPC-regulated exons than for TIA1-regulated exons (Fig 6C, bottom). Thus, the contextual features identified by our in vitro assay appear to help distinguish which U5 motifs are bound in vivo by HNRNPC and which by TIA1, and which motifs are involved in regulation by each factor.

DISCUSSION

A substantial body of work has aimed to catalog functional RNA elements and their interacting proteins to gain a more complete and mechanistic understanding of RNA processing in cells. Here, using a one-step in vitro binding assay that assesses affinity across the spectrum of oligonucleotides, including contextual features that influence binding, we characterized over 70 human RBPs, focusing primarily on RRM, KH, and ZF domain-containing proteins.

We find that many RBPs bind a relatively small, defined subset of primary RNA sequence space that is rich in low-complexity motifs composed primarily of just one or two base types. These findings are consistent with previous studies identifying AU-, U-, and G-rich sequences as functional elements that regulate stability and splicing (Fu and Ares, 2014; Wu and Brewer, 2012). Certain mono- and di-nucleotide-rich sequences occur in clusters in the transcriptome (Barreau et al., 2005; Cereda et al., 2014), an arrangement that may facilitate cooperative binding of these RBPs or facilitate sliding of RBPs along RNA, as has been shown for HNRNPC binding to long uridine tracts (Cienikova et al., 2014). The set of motifs bound by RBPs have lower propensity to form secondary structures that might block RBP binding, both in random sequences (Fig. 4H) and in sequences from the human transcriptome (Fig. S6C). Thus, a reasonable working hypothesis is that accessibility differences may have guided the long-term evolution of RBP specificity towards a particular subset of more accessible motifs. The set of RNA motifs identified here, combined with those compiled in other large-scale studies (Giudice et al., 2016; Ray et al., 2013), can be used to identify candidate factors that recognize sequence elements in transcripts, and to identify genetic variants that may disrupt function at the RNA level (Soemedi et al., 2017).

Our results indicate that linear sequence motifs are often insufficient to fully capture RBP binding specificities and that contextual features such as RNA secondary structure and base compositional context often contribute to binding specificity. Proteins with different classes of RBDs exhibited different tendencies. For example, ZF RBPs favored binding to structured motifs (Fig. S6D,E), consistent with a recent study finding that more than twenty ZF-containing proteins selectively bound highly-structured pre-microRNAs (Treiber et al., 2017). Proteins with KH domains tended to favor large hairpin loops, flanking base compositional preferences, and common preference for bipartite motifs, suggesting that recognition of longer stretches of RNA by multiple KH domains may be common. A substantial subset of RBPs preferred bipartite motifs, which previous structural studies have shown often reflect binding by distinct RBDs (reviewed by Afroz et al., (2015)). Whether specific RNA structural features and/or flanking nucleotide context commonly mediate physical interactions with RBPs or merely present motifs in a favorable context remains to be determined. Either way, the contextual features identified here may be useful in discriminating between binding sites of distinct RBPs that recognize similar primary motifs.

STAR Methods

Cloning of RNA binding protein domains

In most cases, RBPs were selected from a curated set of high-confidence annotations consisting of factors with well-defined RNA binding domains or with previous experimental evidence of RNA binding (Van Nostrand et al., 2017). Regions of each protein containing all RBDs plus ~50 amino acids flanking the RBD were cloned into the pGEX6 bacterial expression construct (GE Healthcare). A list of all constructs generated and primer sequences used is given in Table S1.

Bacterial expression and protein purification

Transformed Rosetta Cells (Novagen) were cultured in SuperBroth until optical density reached 0.6, cultures were transferred to 4° C and allowed to cool. Protein expression was induced for 14–20 hrs with IPTG at 15° C. Cells were pelleted, lysed (Qproteome Bacterial Protein Prep Kit, Qiagen) for 30 min in the presence of protease inhibitor cocktail (Roche), sonicated and clarified by centrifuging at >8,000 rpm, passed through a .45 μM filter (GE) and purified using GST-sepharose in either column format (GST-trap FF, GE) or 96-well format (GSTrap 96-well Protein Purification Kit, GE). Generally, 250mL bacterial cultures used for column purifications and 50mL for 96-well plate purifications (note: 8 wells of a 96-well plate were used per protein so that up to 12 proteins were purified per plate at a time). Eluted proteins were concentrated by centrifugation (Amicon Ultra-4 Centrifugal Filter Units) and subjected to buffer exchange (Zeba Spin Desalting Columns, 7K MWCO, Life Technologies) into Final Buffer (20mM Tris pH 7, 300mM KCl, 1M DTT, 5mM EDTA, 10% glycerol). Proteins were quantified using Bradford Reagent (Life Technologies) and purity and quality of protein was assessed by PAGE followed by Coomassie staining (with few exceptions protein gels are sown on the https://www.encodeproject.org/search/?type=Experiment&assay_title=RNA+Bind-N-Seq&assay_title=RNA+Bind-n-Seq).

Contact and Reagent Resource Sharing

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Christopher Burge (cburge@mit.edu).

Production of random RNAs by in vitro transcription

Single-stranded DNA oligonucleotide and random template were synthesized (Integrated DNA Technologies) and gel-purified as previously described (Lambert et al., 2014). Synthesis of random region of the template DNA oligo was hand-mixed to achieve balanced base composition. An oligo matching T7 promoter sequence was annealed to the random template oligo by mixing in equal parts bringing to 70° C fo r 2 min and allowing to cool by placing at room temperature.

  • T7 Template: 5′ CCTTGACACCCGAGAATTCCA(N)20GATCGTCGGACTGTAGAACTCCCTATAGTGAGTCGTA

  • T7 oligo: 5′ TAATACGACTCACTATAGGG

RNA was synthesized by transcribing 6uL of 25uM annealed template and T7 oligo in a 100 μL reaction (Hi-Scribe T7 transcription kit (NEB) according to manufacturer’s protocol) or with a custom protocol using T7 polymerase (NEB) for larger-scale preps. RNAs were then DNase-treated with RQ1 (Promega) and subjected to phenol-chloroform extraction. RNA was suspended in nuclease free water and resolved on a 6% TBE-Urea gel (Life Technologies). RNA was excised and gel-extracted as previously reported (Lambert et al., 2014). RNA was aliquoted and stored at -80° C.

  • Final transcribed RNA with sequencing adapters: GGGGAGUUCUACAGUCCGACGAUC(N)20UGGAAUUCUCGGGUGUCAAGG

RNA Bind-n-Seq Assay

All steps of the following binding assay were carried out at 4° C. Dynabeads MyOne Streptavidin T1 (Thermo) were washed 3X in binding buffer (25mM tris pH 7.5, 150 mM KCl, 3mM MgCl2, 0.01% tween, 500 ug/mL BSA, 1 mM DTT). 60 uL of beads per individual protein reaction were used. 60 uL RBP diluted (see below for protein concentrations used) in binding buffer were allowed to equilibrate for 30 minutes at 4°C in the presence of 60 uL of washed Dynabeads MyOne Streptavidin T1. After 30 min of incubation, 60 uL of random RNA diluted in binding buffer was added bringing the total reaction volume to 180 uL. The final concentration per reaction of each of the components was 1uM RNA; 5, 20, 80, 320 or 1300 nM of RBP; and 60uL of Dynabeads MyOne Streptavidin T1 stock slurry washed and prepared in binding buffer. Each reaction was carried out in a single well of a 96-well plate. After 1 hr, RBP-RNA complexes were isolated by placing 96-well plate on a magnetic stand for 2 min. Unbound RNA was removed from each well and the bound RNA complexes were washed with 100 uL of wash buffer (25mM tris pH 7.5, 150 mM KCl, 0.5 mM EDTA, 0.01% tween). Immediately after adding wash buffer the plate was placed on the magnet and wash was removed after ~1min. This procedure was repeated 3 times. RBP-RNA complexes were eluted from Dynabeads MyOne Streptavidin T1 by incubating reaction at room temperature for 15 minutes in 25 uL of elution buffer (4mM biotin, 1x PBS), the eluate was collected, the elution step was repeated, and eluates were pooled. RNA was purified from elution mixture by adding 40 uL AMPure Beads RNAClean XP (Agencourt) beads and 90 uL of isopropanol and incubating for 5 minutes. 96-well plate was placed on a magnetic stand and supernatant was discarded. Beads were washed 2X with 80% ethanol, dried, and RNA was eluted in 15 uL of nuclease-free water. The extracted RNA was reverse transcribed into cDNA with Superscript III (Invitrogen) according to manufacturer’s instructions using the RBNS RT primer. To prepare the input random library for sequencing, 0.5 pmol of the RBNS input RNA pool was also reverse transcribed. To make Illumina sequencing libraries, primers with Illumina adapters and sequencing barcodes were used to amplify the cDNA by PCR using Phusion DNA Polymerase (NEB) with 10–14 PCR cycles. PCR primers always included RNA PCR 1 (RP1) and one of the indexed primers as previously reported (Lambert et al., 2014). PCR products were then gel-purified from 3% agarose gels and quantified and assessed for quality on the Bioanalyzer (Agilent). Sequencing libraries for all concentrations of the RBP as well as the input library were pooled in a single lane and sequenced on an Illumina HiSeq 2000 instrument.

Data Access

The 78 RBNS data sets described here can be obtained from the ENCODE project website at https://www.encodeproject.org/search/?type=Experiment&assay_title=RNA+Bind-N-Seq&assay_title=RNA+Bind-n-Seq and via the Accession Numbers in Table S3.

RNA Bind-n-Seq data processing and motif logo generation

RBNS kmer enrichments (R values) were calculated as the frequency of each kmer in the pulldown library reads divided by its frequency in the input library; enrichments from the pulldown library with the greatest enrichment were used for all analyses of each respective RBP. Mean and standard deviation of R values were calculated across all 4k kmers for a given k to calculate the RBNS Z-score for each kmer. RBNS motif logos were made from following iterative procedure on the most enriched pulldown library for k=5: the most enriched kmer was given a weight equal to its enrichment over the input library (=R–1), and all occurrences of that kmer were masked in both the pulldown and input libraries so that stepwise enrichments of subsequent kmers could be used to eliminate subsequent double counting of lower-affinity ‘shadow’ kmers (e.g., only GGGGA occurrences not overlapping a higher-affinity GGGGG would count towards its stepwise enrichment). All enrichments were then recalculated on the masked read sets to obtain the resulting most enriched kmer and its corresponding weight (=stepwise R-1), with this process continuing until the enrichment Z-score (calculated from the original R values) was less than 3. All kmers determined from this procedure were aligned to minimize mismatches to the most enriched kmer, with a new motif started if the kmer could not be aligned to the most enriched kmer in one of the following 4 ways: one offset w/ 0 mismatches (among the 4 overlapping positions); 1 offset w/ 1 mismatch; no offset w/ 1 mismatch; 2 offsets w/ 0 mismatches. The frequencies of each nucleotide in the position weight matrix, as well as the overall percentage of each motif, were determined from the weights of the individual aligned kmers that went into that motif; empty unaligned positions before or after each aligned kmer were given pseudocounts of 25% each nucleotide, and outermost positions of the motif logo were trimmed if they had had unaligned total weight >75%. To improve the robustness of the motif logos, the pulldown and input reads were each divided in half and the above procedure was performed independently on each half; only kmers identified in corresponding motif logos from both halves were included in the alignments to make the final motif logo (weight of each kmer averaged between the two halves). In Fig. 2A, only the top RBNS motif logo is shown if there were multiple (all motifs displayed on the ENCODE portal within the “Documents” box of each experiment, with the proportion of each motif logo determined by computing the relative proportion of each motif’s composite kmer weights). Motif logos were made from the resulting PWMs with Weblogo 2.0 (Crooks et al., 2004). In addition to those displayed for 5mers with a Z-score=3 cutoff, for comparison motif logos were also made using: 5mers with Z-score=2 cutoff, 6mers with Z-score=2 cutoff, and 6mers with Z-score=3 cutoff; additionally, different rules of when to start a new logo vs. add to an existing one were tried. Logos for 5mers with Z-score=3 cutoff and the rules for starting a new motif described above appeared to strike the best balance of capturing a sufficient number of kmers to accurately represent the full spectrum of the RBP’s binding specificity but did not create a number of secondary, largely similar motifs, and thus these parameters were used across all 78 RBPs. The RBNS pipeline is available at: https://bitbucket.org/pfreese/rbnspipeline. More specialized software is being prepared for release to coincide with publication.

Clustering of RBNS motifs

A Jensen-Shannon divergence (JSD)-based similarity score between each pair of top RBNS motif logos was computed by summing the score of the j overlapping positions between RBP A and RBP B:

alignedpos.i=1,,jinfoA,iparameters×infoB,iwere×(1-JSD[ACGUA,iACGUB,i]usedacroosall78RBPs.)

where infoA,i is the information content in bits of motif A at position i and ACGUA,i is the vector of motif A frequencies at position i (vectors sum to 1.)

This score rewards positions with higher information content (scaled from positions positions with 100% one nucleotide given maximum weight to degenerate positions with 25% each nucleotide given zero weight) and more aligned positions (more positions j contributing to the summed score).

This similarity score was computed for each possible overlap of the two logos (subject to at least four positions overlapping, i.e., j≥4), and the top score with its corresponding alignment offset was used. The matrix of these scores were normalized to the maximum score over all RBP pairs and clustered using the linkage function with centroid method in scipy.cluster.hierarchy to obtain the dendrogram shown in Fig. 2A, with the 15 RBP groupings derived from a manually-set branch length cutoff. This branch length cutoff was chosen to balance the competing interests of maximizing the number of paralogous proteins within the same cluster (more stringent cutoffs eliminated PCBP4 from the cluster containing PCBP1 and PCBP2; it also did not include RBM4 and RBM4B to be in a cluster) and minimizing differences between primary motifs within the same cluster (less stringent cutoffs included the distinct UAG-containing MSI1/UNK/HNRNPA0 motifs within the same cluster as the AU-rich RBPs, for example).

Comparison with RNAcompete

5mer scores were derived from publicly available 7mer Z-scores by computing the mean across all 7mers containing a given 5mer (http://hugheslab.ccbr.utoronto.ca/supplementary-data/RNAcompete_eukarya/). Correlations between RBNS and RNA-compete experiments were computed by taking the Pearson correlation of Z-scores for all 5mers which had a Z-score ≥ 3 for at least one of the 31 RBPs in common between both assays.

Overlap of RBNS 6mers with splicing and stability regulatory elements

Splicing regulatory elements were taken from: ESS and ESE: (Ke et al., 2011) and (Rosenberg et al., 2015); ISE: (Y. Wang et al., 2012); ISS: (Y. Wang et al., 2013).

3′UTR regulatory 6mers were derived from (Oikonomou et al., 2014). Only 6mers with ≥100 occurrences across all designed sequences were used (totaling 1303 6mers) in order to derive a mean 6mer score with sufficient coverage in different contexts. 6mer repressor and activator scores were obtained by averaging scores (log2 frequency as described in the original manuscript) across all oligos containing that 6mer in the low (L10) and high (H10) Dual-reporter Intensity Ratio bins, respectively. Activator and repressor scores were averaged across both replicates (Libraries A and B). 6mers with an overall score ≥ 0.25 were used, where regulatory score=|log2(repressor score)-log2(activator score)|.

Analysis of eCLIP for motif discovery, regulation and overlapping targets

eCLIP datasets were produced by the Yeo Lab through the ENCODE RBP Project and are available at https://www.encodeproject.org/search/?type=Experiment&assay_title=eCLIP and via GEO.

For all analyses, only eCLIP peaks with an enrichment over input ≥ 2 were used. Peaks were also extended 50 nucleotides in the 5′ direction as the 5′ start of the peak is predicted to correspond to the site of crosslink between the RBP and the RNA.

To produce eCLIP logos in a similar manner for comparison with RBNS logos, an analogous procedure to creating the RBNS motif logos was carried out on the eCLIP peak sequences: the two halves of the RBNS pulldown reads were replaced with the two eCLIP replicate peak sequences, and the input RBNS sequences were replaced by random regions within the same gene for each peak that preserved peak length and transcript region (5′ and 3′ UTR peaks were chosen randomly within that region; intronic and CDS peaks were shuffled to a position within the same gene that preserved the peak start’s distance to the closest intron/exon boundary to match sequence biases resulting from CDS and splice site constraints). The enrichment Z-score threshold for 5mers included in eCLIP logos was 2.8, as this threshold produced eCLIP logos containing the most similar number of 5mers to that of the Z=3 5mer RBNS logos. Each eCLIP motif logo was filtered to include only 5mers that occurred in both corresponding eCLIP replicate logos. eCLIP motif logos were made separately for all eCLIP peaks, only 3′UTR peaks, only CDS peaks, and only intronic peaks, with the eCLIP logo of those 4 (or 8 if CLIP was performed in both cell types) with highest similarity score to the RBNS logo shown in Fig. S3C, where the similarity score was the same as previously described to cluster RBNS logos. To determine overlap significance of RBNS and eCLIP, a hypergeometric test was performed with the 5mers in all (not just the top) logos for: RBNS logo 5mers, eCLIP logo 5mers (for peaks in the region with highest similiarity score to the RBNS logo), and 5mers in their intersection among the background of all 1,024 5mers; overlap was deemed significant if P<0.05.

All eCLIP/RBNS comparisons were for the same RBP with the following exceptions in which the eCLIP RBP was compared to its paralogous RBNS protein: KHDRBS2 (KHDRBS1 RBNS); PABPN1 (PABPN1L RBNS); PTBP1 (PTBP3 RBNS); PUM2 (PUM1 RBNS); and RBM15 (RBM15B RBNS).

For Fig. 3G, the Pearson correlation between eCLIP experiments was assessed by computing the mean eCLIP coverage across 3′UTRs of all genes. 3′ UTRs were split into windows of ~100 nucleotides and the mean base-wise coverage (eCLIP coverage divided by input coverage) was calculated in each window. Pairs of RBPs were assigned as paralogs according to their classification in Ensembl. Pairs of RBPs were assigned as having overlapping motifs if at least 2 of their 5 top 5mers overlapped; RBPs with specificities determined from RBNS and RNAcompete (Ray et al., 2013) were pooled.

Analysis of RNA-seq datasets for regulation and RBNS Expression & Splicing Maps

RNA-seq after shRNA knockdowns of individual RBPs in HepG2 and K562 cells (two KD and two control RNA-seq samples per RBP) were produced by the Graveley Lab as part of the ENCODE RBP Project and are available at: https://www.encodeproject.org/search/?type=Experiment&assay_title=shRNA+RNA-seq.

Splicing changes upon KD were quantified with MATS (Shen et al., 2012), considering only skipped exons (SEs) with at least 10 inclusion + exclusion junction-spanning reads and a between 0.05 and 0.95 in the averaged control and/or KD samples. SEs that shared a 5′ or 3′ splice site with another SE (i.e., those that are part of an annotated A3’SS, A5’SS, or Retained Intron) were eliminated. If multiple pairs of upstream & downstream flanking exons were quantified for an SE, only the event with the greatest number of junction-spanning reads was used. SEs significantly excluded or included upon KD were defined as those with a P-value < 0.05 and |ΔΨ| ≥ 0.05. Control SEs upon KD were those with a P-value=1 and |ΔΨ| ≤ 0.02.

Differentially expressed genes upon KD were called from DEseq2 (Love et al., 2014), considering genes that had a ‘baseMean’ coverage of at least 1.0 and an adjusted P-value < 0.05 and |log2(FC)| ≥ 0.58 (1.5-fold up or down upon KD). Candidate control genes upon KD were taken from those with a P-value > 0.5 and |log2(FC)| ≤ 0.15; from this set of genes, a subset matched to the deciles of native (i.e., before KD) gene expression levels of the differentially expressed genes was used. The last 50nt of each gene’s ORF and 3′UTR sequence were taken from the Gencode version 19 transcript with the highest expression in the relevant cell type (HepG2 or K562).

‘RBNS splicing maps’ were made by taking the three sets of SEs included, excluded, or control upon KD and extracting their exonic and upstream/downstream flanking 250nt sequences. At each position of each event, it was determined whether the position overlapped with one of the top 10 RBNS 5mers for that RBP in any of the five registers overlapping the position. Then to determine if the RBNS density was significantly higher or lower for included/excluded SEs at a position relative to control SEs at that position, the number of positions in a 20bp window on each side (total 41 positions) covered by RBNS motifs was determined for each of the events, with significance determined by P-value<0.05 in a Wilcoxon rank-sum test on the control vs. changed events in the desired direction upon KD. Exonic regions were deemed to have ESE or ESS RBNS regulatory activity if 20 of the 100 exonic positions among SEs excluded or included upon KD, respectively, had significantly higher RBNS motif coverage than control SEs. The upstream and downstream intronic regions were each individually deemed as ISE or ISS regions if 50 of the 250 intronic positions had significantly higher RBNS motif coverage. For each significant region for each RBP, the ratios of log2(RBNS density over changing SEs/RBNS density over control SEs) of all significant positions in that region were summed, and the maximum value was normalized to 1 over all RBPs.

‘RBNS stability maps’ were made in an analogous manner, but for genes up- or down-regulated compared to control genes upon KD. The 3′ UTR sequence was divided into 100 segments of roughly equal length and the proportion of positions covered by RBNS motifs in each segment were used for each bin of the meta-3′ UTR. An RBP was deemed to have significant RBNS regulatory activity if 10 of the 100 positions of the meta-3′ UTR for up- or down-regulated genes had increased RBNS density relative to control genes.

Generation of random sets of ranked 6mer lists with edit distances to top 6mer matching RBNS

Because the ranked lists of top enriched kmers (e.g., the top 15 6mers) are highly constrained depending on what the most enriched kmer is (e.g., 6mers 2–15 are typically Hamming distance of 1 and/or shifted by 1 from the top 6mer), as background sets for comparison to actual RBNS 6mer lists we sought to create groups of 6mers that matched the observed RBNS patterns of Hamming distances and shifts from the top 6mer for any given randomly selected kmer. To do this, for each of the 78 RBNS experiments we first calculated the edit distance from 6meri to 6mer1, where 6mer1 is the most enriched 6mer and i=2, …, 15 is the ith enriched 6mer (e.g., 6mer8 might have a mismatch at position two compared to 6mer1 and then be shifted to the right by 1 position). Then, for all 4,096 starting 6mers, we created 78 ranked lists of 15 6mers, each of which matched the observed edit distances to the top 15 list of an actual RBNS experiment. The expected number of network edges in Fig. 2B, and the ‘random’ number of edges in Fig. 2D were performed by selecting random lists from these 4,096*78 possibilities.

RBNS RBP groups without paralogs or RBPs with any RBD pair sharing 40% identity

No Paralogs (n=52)

A1CF, BOLL, CELF1, CNOT4, CPEB1, DAZ3, EIF4G2, ELAVL4, ESRP1, EWSR1, FUBP1, HNRNPA2B1, HNRNPC, HNRNPK, HNRNPL, IGF2BP1, ILF2, MBNL1, NUPL2, PABPN1L, PRR3, PTBP3, PUM1, RBFOX2, RBM15B, RBM22, RBM23, RBM24, RBM25, RBM4, RBM41, RBM45, RBM47, RBM6, RBMS2, RC3H1, SF1, SFPQ, SNRPA, SRSF10, SRSF11, SRSF2, SRSF4, SRSF8, TARDBP, TIA1, TRA2A, TRNAU1AP, UNK, ZCRB1, ZFP36, ZNF326

No RBPs sharing >40% identity among any RBDs (n=47)

A1CF, BOLL, CELF1, CNOT4, CPEB1, EIF4G2, ELAVL4, EWSR1, FUBP3, HNRNPA0, HNRNPCL1, HNRNPDL, HNRNPH2, HNRNPL, IGF2BP1, ILF2, KHDRBS3, MBNL1, NOVA1, NUPL2, PABPN1L, PCBP2, PRR3, PTBP3, PUF60, PUM1, RBFOX3, RBM15B, RBM22, RBM24, RBM25, RBM41, RBM45, RBM4B, RBM6, RBMS2, SFPQ, SNRPA, SRSF11, SRSF8, SRSF9, TARDBP, TIA1, TRA2A, TRNAU1AP, ZFP36, ZNF326

Pairwise RBD alignments were performed using ClustalW2 (Larkin et al., 2007) and percent identities (as shown in Fig. 1C and 5D) were calculated as the percentage of identical positions relative to the number of ungapped positions in the alignments.

Network map of overlapping affinities

The lists of top 15 6mers for each RBP were intersected to get the number in common - those with 2 or more were deemed significant and connected by an edge (P<0.05 by Hypergeometric test, as well as by simulations based on the empirical distribution from random sets of ranked 6mer lists with edit distances to top 6mer matching RBNS as described above). The resulting network was visualized with Cytoscape (Shannon et al., 2003).

Motif entropy analysis

To construct a set of ‘simulated’ motifs that matches the overall nucleotide composition of the 78 RBNS motifs but removes any positional correlations within a motif, individual columns of each RBNS motif (including all motifs for an RBP if there was more than one) were pooled to be sampled from. A ‘simulated’ motif was constructed by randomly sampling 5 or 6 columns (with probability 2/3 and 1/3, respectively, to roughly match the lengths of RBNS motifs) from this pool and concatenating them, repeated to construct 100,000 shuffled motifs.

The frequency of the four bases in each logo was calculated by averaging over all positions in the motif. This frequency vector (=[fA, fC, fG, fU], fA+fC+fG+fU=1) was mapped onto a square containing corners at [+/-1, +/-1] using two different orderings of the 4 corners, which together contain all 6 dinucleotide combinations (AC, AG, AU, CG, CU, GU) as edges:

  1. Purine/Pyrimidine diagonals:
    AUCGA=[-11]C=[-1-1]G=[1-1]U=[11]
  2. Purine/Pyrimidine edges:
    CUAGA=[-1-1]C=[-11]G=[1-1]
    To map the frequency vector to its coordinates (u, v) within the unit circle, the frequency vector was normalized to the largest component:
    U=[11]F=[FA,FC,FG,FU]=[fA/fmax,fC/fmax,fG/fmax,fU/fmax],wherefmax=max(fA,fC,fG,fU)F=FA2+FC2+FG2+FU2
    and (u, v) was computed as:
    [uv]=FAA+FCC+FGG+FUU2×F

The elliptical grid mapping was used to convert the (u, v) coordinates within the unit circle to the corresponding position (x, y) within a square containing corners at [+/-1, +/-1]:

[xy]=[12(2+u2-v2+22u-2+u2-v2-22u)12(2-u2+v2+22v-2-u2+v2-22v)]

The simplex grid shown was divided into 11 equal parts along both dimensions, and the density in each of the 121 squares was computed for the 78 RBNS motifs and 100,000 shuffled motifs to get enrichments.

To determine significance via bootstrapping, 1,000 different shuffled motif distributions over the grid were computed. In each of the 1,000 bootstraps, the 100,000 shuffled motifs were drawn from a different starting pool of motif columns: rather than all 78 RBPs’ motifs contributing once to the pool, a random sampling (with replacement) of the 78 RBPs was performed, and those motifs’ columns served as the starting pool for the 100,000 shuffled motifs. The mean and standard deviation of these 1,000 bootstraps were computed for each margin, and margins for which the density of the 78 RBNS motif logos had a Z-score greater than 2 were marked significant (number of asterisks = Z-score, rounded down).

RNA secondary structure analysis

The RNA base-pairing probability was extracted from the partition function of RNAfold: “RNAfold -p --temp=X”, where X was 4° or 21°C depending on w hat temperature the binding reaction was conducted at (See Table S3) (Lorenz et al., 2011). For each pulldown library, reads were randomly selected to match the distribution of C+G content among input reads; all enrichments were recalculated for these C+G-matched pulldown reads for Fig. 4 and Fig. 6. Reads were folded with the 5’ and 3’ adapters (24 and 21 nt, respectively), resulting in folded sequences of length 65 and 85 for 20mer and 40mer RBNS experiments, respectively.

Secondary structural element analyses were performed by using the forgi software package (Kerpedjiev et al., 2015). For each read, to mirror the partition function rather than relying solely on the Minimum Free Energy structure, 20 random suboptimal structures with probabilities equal to their Boltzmann weights were sampled and averaged over (“RNAsubopt --temp=X —stochBT=20”). In Fig. 4D, 6mers counting toward: ‘loop’ were: H6, M6, I6; ‘stem’ was S6; ‘bulged stem’ were 6mers matching the pattern SXXXXS, where XXXX contained 1–3 S.

For Fig. 6A, 6B, S6A, S6B, bin limits for the motif structure analyses (Ppaired) were: 0–0.2 (bin 1); 0.2–0.4 (bin 2); 0.4–0.6 (bin 3); 0.6–0.8 (bin 4); and 0.8–1.0 (bin 5). Bin limits for flanking structure analyses (Pflank) were: 0–0.3 (bin 1); 0.3–0.45 (bin 2); 0.45–0.6 (bin 3); 0.6–0.75 (bin 4); 0.75–1.0 (bin 5). Ppaired was calculated as the average over the six positions of the 6mer; Pflank was calculated as the average over all other positions in the read. The continuous measures of preference for motif and flanking preference for the x- and y-axes in Fig. 6A and S6A were computed as:

-2log2(Rbin1/Roriginal)-1log2(Rbin2/Roriginal)+0log2(Rbin3/Roriginal)+1log2(Rbin4/Roriginal)+2log2(Rbin5/Roriginal).

RBNS structure profiles were compared to eCLIP structure profiles in the region with the greatest number of eCLIP peaks. Bound RBNS motifs were selected from the transcriptome region that showed the highest enrichment for the number of peaks (5′ UTR/3′ UTR/introns/CDS). Motifs that were not bound were selected from the same gene regions as bound motifs and matched for the same genes. Motifs were folded with 50 nucleotides of flanking sequence on both sides using RNAfold (Lorenz et al., 2011). Motifs (both bound and not bound) were then binned by their mean base-pairing probability (same bins as RBNS), and the fraction of bound motifs in each bin was computed. The monotonicity of R over Ppaired bins for RBNS and eCLIP was computed by taking all 10 comparisons over the 5 bins, adding 1 if R was greater in the higher Ppaired bin or subtracting 1 if it was lower in the higher Ppaired bin.

The structure of 6mers in random sequences (Fig. 4H) was calculated by creating random 65mers, folding them at 4C, and computing the mean Ppaired over each of the 15 6mers within the region corresponding to the random RBNS 20mer positions (i.e., positions 25–44 of the 65mer, inclusive). The structure of 6mers in human Gencode version 19 transcript regions (Fig. S6E) was calculated by taking all consecutive 65 nt sequences (the length of the RBNS 20mer + adapter sequences) fully within one of the four respective transcript regions. Each 65 nt sequence was folded at 37C, and the mean Ppaired over each of the 15 6mers within the region corresponding to the random RBNS 20mer positions was calculated. The mean Ppaired for each 6mer was then computed over all occurrences of that 6mer within the given transcript region, and the 6mer was classified as being composed of “1 base” (e.g., GGGGGG), “2 bases” (e.g., GAGGAA), or “Complex” (3+ unique bases, e.g., “UGGAGU”).

Determination of bipartite motifs

Enrichments were computed for all pairs of the top 10 enriched 3mers, with a spacer of length i=0–10 (in total: 10*10*(i+1) combinations), where the enrichment was defined as the fraction of pulldown reads with a motif relative to the fraction of input reads with a motif. The enrichment for each spacing was computed as the mean enrichment of the 10 most enriched combinations of that particular spacing (Fig. 5A–B). Nucleotide composition of the spacer (as shown in Fig. 5A–B) was the mean nucleotide frequency across positions between both motif cores, relative to the corresponding nucleotide frequency between the same motif cores the input libraries. Preference for spacing (Fig. S5B) was computed as the change in the mean enrichment for the top 10 spaced combinations (i > 0) relative to the mean enrichment of the top 10 non-spaced combinations (i = 0, i.e., top 10 6mers): log2(enrichmentspaced/enrichmentlinear). Significance was determined by setting a False Discovery Rate (FDR) using 0 nM control libraries as follows: samples of 10 3mer cores were repeatedly drawn and the observed relative enrichments were used to set an FDR at each spacing s. Motif cores were sampled such that the relationships between sampled 3mers were the same as the relationship observed for that particular protein’s enriched cores.

Assessment of flanking nucleotide compositional preferences

For a given RBP, we only considered (protein-bound and input) reads that: a) contained one of the top 5 enriched 5mers; b) contained no additional secondary motifs, where secondary motifs were the top 50 enriched 5mers or all 5mers with an R-value >= 2, whichever set was larger. The remaining protein-bound and input reads were then subsampled to match the distribution of motifs and the positions of those motifs along a read. These reads were further subsampled to match the distribution of mean base-pairing probabilities over the motif (bins used were [0–0.1),[0.1–0.2),…,[0.9,1.0]). For the analysis in Fig. S5C, protein-bound and input reads were instead subsetted only to reads where the motif was in a hairpin configuration (H5 in the MFE). The flanking nucleotide enrichment was then determined by centering these reads on the motif and computing the relative enrichment (log2(fpulldownNT/finputNT)) for each nucleotide at each position relative to the motif. We excluded the two nucleotides immediately adjacent to the motif on either side (to avoid capturing the extension of a core motif) as well as the first and last position of the random region in order to avoid certain nucleotide biases that can occur due to the presence of adaptor sequences. The overall enrichment (Fig. 5G) is the mean enrichment across all assessed positions, with significance assessed by a Wilcoxon rank-sum test.

Binding to mono- or dinucleotide rich sequence (e.g., Fig. S5E) in absence of a motif was done analogously, except only using reads that did not contain any of the top 50 5mers or any 5mer with R ≥ 2. Enrichments for degenerate patterns were calculated as the mean of the 10 best degenerate kmers matching that pattern (e.g., mean of top 10/4096 12mers matching CCNNNCCNNNCC in the example in Fig. 5H, S5H). We first calculated enrichments for patterns where the fixed positions (e.g., CCCCCC in the previous example) contained only one or two nucleotides to assess which RBPs were biased towards binding to degenerate nucleotide-rich sequences, but later performed exhaustive searches where the fixed kmer was allowed to cover the entire sequence space (i.e., 4096 possible sequences in fixed positions × 210=(10 choose 4) patterns with 6 fixed positions and 6 internal Ns).

Filter binding assay

Custom RNA oligonucleotides were synthesized by IDT (Integrated DNA Technologies) and RBPs were purified as described earlier (see Cloning of RNA binding protein domains). RNA was end-labeled with 32P by incubating with Polynucleotide Kinase (NEB) according to manufacturer protocol. The assay was done following the protocol described in (Rio, 2012) for use with a 96-well dot-blot apparatus (Biorad). RBP and radio-labelled RNA were incubated in 50 uL binding buffer (100 mM KCl, 1M DTT, 10% glycerol, 20 mM Tris) for 1 hour at room temperature. Final concentration of RNA was 1nM and protein concentration ranged from 100pM-10uM depending on the protein.

Calculation of feature-specific R values and relative entropy of context features

Feature-specific R values were calculated by assigning all 6mers into their respective bin for the feature under consideration for both the pulldown and input libraries, converting the counts into frequencies within each bin for both libraries, and computing the R value for the 6mer under consideration using the pulldown and input bin frequencies.

For Fig. 6B, bins used to compute feature-specific R values for each feature were the following:

  • Ppaired: bin 1=0–0.2; bin 2=0.2–0.4; bin 3=0.4–0.6; bin 4=0.6–0.8; bin 5=0.8–1.0

  • Pflank: bin 1=0–0.3; bin 2=0.3–0.45; bin 3=0.45–0.6; bin 4=0.6–0.75; bin 5=0.75–1.0

  • Core spacing: bin 1 = 0 nt spacing; bin 2 = 1 nt spacing; … ; bin 11 = 10 nt spacing, where the spacing corresponds to the spacing between the two cores of a bipartite motif.

  • Nucleotide context: 16 bins, where the first four bins are quartiles of the percentage of A content flanking a 6mer based on the composition of input reads (bins 5–8, 9–12, and 13–16 are analogous for C, G, and U content, respectively). Each 6mer occurrence was therefore counted 4 times, into the corresponding bin for each of the four nucleotides.

Feature-specific R values within each bin were compared to the overall R value of the 6mer without binning (i.e., log2(Rbin/Roriginal)) to create the feature-specific enrichment profile for a particular context feature (example for Ppaired for two RBPs in Fig. S6B).

For Fig. 6C, RNA folding was done as described above. To determine the log2 ratio of base-pairing probabilities, control U5 occurrences were determined as previously described for each datatype (RBNS reads, eCLIP peaks, control exons in knockdown data). Log2 Ppaired ratios were then bootstrapped from the Ppaired distributions in pulldown relative to input for each datatype, with significance assessed by a Wilcoxon test.

Supplementary Material

1. Table S1.

List of primers and cloned regions for all assayed RBPs, related to Figure 1.

2. Table S2.

Number of reads obtained in all RBNS experiments, related to Figure 1.

3. Table S3.

Summary of RBNS experiments including experimental procedures and derived motifs, related to Figure 2.

4. Table S4.

Ppaired of each position in input and pulldown library, recalculated R by Ppaired bin, and recalculated R values by structural element for top 6mer of each RBNS, related to Figure 4.

5. Table S5.

Bipartite motifs and nucleotide context preferences for all assayed RBPs, related to Figure 5.

6. Table S6.

Motif clusters and their significantly divergent features, related to Figure 6.

7

Highlights.

  • In vitro specificity of 78 human RNA-binding proteins determined by deep sequencing

  • RBP motifs have low diversity, compositional complexity and RNA structure potential

  • RBPs that bind similar motifs often differ in their sequence context preferences

  • Many favor specific “bipartite” motifs, flanking base composition or RNA structures

Acknowledgments

This work was funded by the National Human Genome Research Institute ENCODE Project, contract U54HG007005, to B.R.G. (PI), C.B.B., and G.W.Y. (co-PIs). M.S.A. is supported by a National Defense Science and Engineering Graduate Fellowship. We thank the T. Hughes lab for kindly providing bacterial expression constructs for some RBPs and F. Allain, D. Brow, W. Gilbert and members of the Burge lab for helpful comments on the manuscript.

Footnotes

AUTHOR CONTRIBUTIONS

D.D. performed experiments, analyzed data and wrote the manuscript. P. F. analyzed data and wrote the manuscript. M.S.A. performed experiments, analyzed data and wrote the manuscript. M.H., C.B., T.P. and N.J.L. performed experiments. E.L.V. and G.A.P. performed experiments and analyzed data. G.W.Y. and B.R.G provided and analyzed datasets. C.B.B. designed the study and wrote the manuscript.

DECLARATION OF INTERESTS

The authors declare no competing interests.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Afroz T, Cienikova Z, Cléry A, Allain FH-T. One, Two, Three, Four! How Multiple RRMs Read the Genome Sequence. Meth Enzymol. 2015;558:235–278. doi: 10.1016/bs.mie.2015.01.015. [DOI] [PubMed] [Google Scholar]
  2. Auweter SD, Oberstrass FC, Allain FHT. Sequence-specific binding of single-stranded RNA: is there a code for recognition? Nucleic Acids Research. 2006;34:4943–4959. doi: 10.1093/nar/gkl620. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Barreau C, Paillard L, Osborne HB. AU-rich elements and associated factors: are there unifying principles? Nucleic Acids Research. 2005;33:7138–7150. doi: 10.1093/nar/gki1012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Botti V, McNicoll F, Steiner MC, Richter FM, Solovyeva A, Wegener M, Schwich OD, Poser I, Zarnack K, Wittig I, Neugebauer KM, Müller-McNicoll M. Cellular differentiation state modulates the mRNA export activity of SR proteins. J Cell Biol. 2017;216:1993–2009. doi: 10.1083/jcb.201610051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Carlson SM, Soulette CM, Yang Z, Elias JE, Brooks AN, Gozani O. RBM25 is a global splicing factor promoting inclusion of alternatively spliced exons and is itself regulated by lysine mono-methylation. J Biol Chem. 2017;292:13381–13390. doi: 10.1074/jbc.M117.784371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cereda M, Pozzoli U, Rot G, Juvan P, Schweitzer A, Clark T, Ule J. RNAmotifs: prediction of multivalent RNA motifs that control alternative splicing. Genome Biol. 2014;15:R20. doi: 10.1186/gb-2014-15-1-r20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Choi YD, Grabowski PJ, Sharp PA, Dreyfuss G. Heterogeneous nuclear ribonucleoproteins: role in RNA splicing. Science. 1986;231:1534–1539. doi: 10.1126/science.3952495. [DOI] [PubMed] [Google Scholar]
  8. Choudhury R, Roy SG, Tsai YS, Tripathy A, Graves LM, Wang Z. The splicing activator DAZAP1 integrates splicing control into MEK/Erk-regulated cell proliferation and migration. Nature Communications. 2014;5:3078. doi: 10.1038/ncomms4078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cienikova Z, Damberger FF, Hall J, Allain FH-T, Maris C. Structural and mechanistic insights into poly(uridine) tract recognition by the hnRNP C RNA recognition motif. J Am Chem Soc. 2014;136:14536–14544. doi: 10.1021/ja507690d. [DOI] [PubMed] [Google Scholar]
  10. Cléry A, Allain FH-T. FROM STRUCTURE TO FUNCTION OF RNA BINDING DOMAINS. Madame Curie Bioscience Database 2013 [Google Scholar]
  11. Conway AE, Van Nostrand EL, Pratt GA, Aigner S, Wilbert ML, Sundararaman B, Freese P, Lambert NJ, Sathe S, Liang TY, Essex A, Landais S, Burge CB, Jones DL, Yeo GW. Enhanced CLIP Uncovers IMP Protein-RNA Targets in Human Pluripotent Stem Cells Important for Cell Adhesion and Survival. Cell Rep. 2016;15:666–679. doi: 10.1016/j.celrep.2016.03.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Cook KB, Hughes TR, Morris QD. High-throughput characterization of protein-RNA interactions. Brief Funct Genomics. 2015;14:74–89. doi: 10.1093/bfgp/elu047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Cook KB, Vembu S, Ha KCH, Zheng H, Laverty KU, Hughes TR, Ray D, Morris QD. RNAcompete-S: Combined RNA sequence/structure preferences for RNA binding proteins derived from a single-step in vitro selection. Methods. 2017;126:18–28. doi: 10.1016/j.ymeth.2017.06.024. [DOI] [PubMed] [Google Scholar]
  14. Crooks GE, Hon G, Chandonia JM, Brenner SE. WebLogo: a sequence logo generator. Genome Research. 2004;14:1188–1190. doi: 10.1101/gr.849004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Damianov A, Ying Y, Lin CH, Lee JA, Tran D, Vashisht AA, Bahrami-Samani E, Xing Y, Martin KC, Wohlschlegel JA, Black DL. Rbfox Proteins Regulate Splicing as Part of a Large Multiprotein Complex LASR. Cell. 2016;165:606–619. doi: 10.1016/j.cell.2016.03.040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Daubner GM, Cléry A, Allain FHT. RRM-RNA recognition: NMR or crystallography…and new findings. Current Opinion in Structural Biology. 2013;23:100–108. doi: 10.1016/j.sbi.2012.11.006. [DOI] [PubMed] [Google Scholar]
  17. Friedersdorf MB, Keene JD. Advancing the functional utility of PAR-CLIP by quantifying background binding to mRNAs and lncRNAs. Genome Biol. 2014;15:R2. doi: 10.1186/gb-2014-15-1-r2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Fu X-D, Ares M. Context-dependent control of alternative splicing by RNA-binding proteins. Nature Publishing Group. 2014:1–13. doi: 10.1038/nrg3778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Gerstberger S, Hafner M, Tuschl T. A census of human RNA-binding proteins. Nature Publishing Group. 2014;15:829–845. doi: 10.1038/nrg3813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gilbert C, Svejstrup JQ. RNA immunoprecipitation for determining RNA-protein associations in vivo. Curr Protoc Mol Biol. 2006;Chapter 27(Unit 27.4–27.4.11) doi: 10.1002/0471142727.mb2704s75. [DOI] [PubMed] [Google Scholar]
  21. Giudice G, Sánchez-Cabo F, Torroja C, Lara-Pezzi E. ATtRACT-a database of RNA-binding proteins and associated motifs. Database (Oxford) 2016;2016:baw035. doi: 10.1093/database/baw035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hiller M, Zhang Z, Backofen R, Stamm S. Pre-mRNA secondary structures influence exon recognition. PLoS Genet. 2007;3:e204. doi: 10.1371/journal.pgen.0030204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Iwaoka R, Nagata T, Tsuda K, Imai T, Okano H, Kobayashi N, Katahira M. Structural Insight into the Recognition of r(UAG) by Musashi-1 RBD2, and Construction of a Model of Musashi-1 RBD1-2 Bound to the Minimum Target RNA. Molecules. 2017;22:1207. doi: 10.3390/molecules22071207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Jolma A, Yan J, Whitington T, Toivonen J, Nitta KR, Rastas P, Morgunova E, Enge M, Taipale M, Wei G, Palin K, Vaquerizas JM, Vincentelli R, Luscombe NM, Hughes TR, Lemaire P, Ukkonen E, Kivioja T, Taipale J. DNA-binding specificities of human transcription factors. Cell. 2013;152:327–339. doi: 10.1016/j.cell.2012.12.009. [DOI] [PubMed] [Google Scholar]
  25. Kapeli K, Pratt GA, Vu AQ, Hutt KR, Martinez FJ, Sundararaman B, Batra R, Freese P, Lambert NJ, Huelga SC, Chun SJ, Liang TY, Chang J, Donohue JP, Shiue L, Zhang J, Zhu H, Cambi F, Kasarskis E, Hoon S, Ares M, Burge CB, Ravits J, Rigo F, Yeo GW. Distinct and shared functions of ALS-associated proteins TDP-43, FUS and TAF15 revealed by multisystem analyses. Nature Communications. 2016;7:12143. doi: 10.1038/ncomms12143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Ke S, Shang S, Kalachikov SM, Morozova I, Yu L, Russo JJ, Ju J, Chasin LA. Quantitative evaluation of all hexamers as exonic splicing elements. Genome Research. 2011;21:1360–1374. doi: 10.1101/gr.119628.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Kerpedjiev P, Höner Zu Siederdissen C, Hofacker IL. Predicting RNA 3D structure using a coarse-grain helix-centered model. RNA. 2015;21:1110–1121. doi: 10.1261/rna.047522.114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lambert N, Robertson A, Jangi M, McGeary S, Sharp PA, Burge CB. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Molecular Cell. 2014;54:887–900. doi: 10.1016/j.molcel.2014.04.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23:2947–2948. doi: 10.1093/bioinformatics/btm404. [DOI] [PubMed] [Google Scholar]
  30. Li X, Quon G, Lipshitz HD, Morris Q. Predicting in vivo binding sites of RNA-binding proteins using mRNA secondary structure. RNA. 2010;16:1096–1107. doi: 10.1261/rna.2017210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Lorenz R, Bernhart SH, Höner Zu Siederdissen C, Tafer H, Flamm C, Stadler PF, Hofacker IL. ViennaRNA Package 2.0. Algorithms Mol Biol. 2011;6:26. doi: 10.1186/1748-7188-6-26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:550. doi: 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Lunde BM, Moore C, Varani G. RNA-binding proteins: modular design for efficient function. Nat Rev Mol Cell Biol. 2007;8:479–490. doi: 10.1038/nrm2178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Meyer NH, Tripsianes K, Vincendeau M, Madl T, Kateb F, Brack-Werner R, Sattler M. Structural basis for homodimerization of the Src-associated during mitosis, 68-kDa protein (Sam68) Qua1 domain. J Biol Chem. 2010;285:28893–28901. doi: 10.1074/jbc.M110.126185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Müller-McNicoll M, Botti V, de Jesus Domingues AM, Brandl H, Schwich OD, Steiner MC, Curk T, Poser I, Zarnack K, Neugebauer KM. SR proteins are NXF1 adaptors that link alternative RNA processing to mRNA export. Genes & Development. 2016;30:553–566. doi: 10.1101/gad.276477.115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Oikonomou P, Goodarzi H, Tavazoie S. Systematic identification of regulatory elements in conserved 3′ UTRs of human transcripts. Cell Rep. 2014;7:281–292. doi: 10.1016/j.celrep.2014.03.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Page-McCaw PS, Amonlirdviman K, Sharp PA. PUF60: a novel U2AF65-related splicing activity. RNA. 1999;5:1548–1560. doi: 10.1017/s1355838299991938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Query CC, Bentley RC, Keene JD. A common RNA recognition motif identified within a defined U1 RNA binding domain of the 70K U1 snRNP protein. Cell. 1989;57:89–101. doi: 10.1016/0092-8674(89)90175-x. [DOI] [PubMed] [Google Scholar]
  39. Rasche N, Dybkov O, Schmitzová J, Akyildiz B, Fabrizio P, LUhrmann R. Cwc2 and its human homologue RBM22 promote an active conformation of the spliceosome catalytic centre. EMBO J. 2012;31:1591–1604. doi: 10.1038/emboj.2011.502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Ray D, Kazan H, Cook KB, Weirauch MT, Najafabadi HS, Li X, Gueroussov S, Albu M, Zheng H, Yang A, Na H, Irimia M, Matzat LH, Dale RK, Smith SA, Yarosh CA, Kelly SM, Nabet B, Mecenas D, Li W, Laishram RS, Qiao M, Lipshitz HD, Piano F, Corbett AH, Carstens RP, Frey BJ, Anderson RA, Lynch KW, Penalva LOF, Lei EP, Fraser AG, Blencowe BJ, Morris QD, Hughes TR. A compendium of RNA-binding motifs for decoding gene regulation. Nature. 2013;499:172–177. doi: 10.1038/nature12311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Rio DC. Filter-binding assay for analysis of RNA-protein interactions. Cold Spring Harb Protoc. 2012;2012:1078–1081. doi: 10.1101/pdb.prot071449. [DOI] [PubMed] [Google Scholar]
  42. Rosenberg AB, Patwardhan RP, Shendure J, Seelig G. Learning the sequence determinants of alternative splicing from millions of random sequences. Cell. 2015;163:698–711. doi: 10.1016/j.cell.2015.09.054. [DOI] [PubMed] [Google Scholar]
  43. Schwartz JC, Cech TR, Parker RR. Biochemical Properties and Biological Functions of FET Proteins. Annu Rev Biochem. 2015;84:355–379. doi: 10.1146/annurev-biochem-060614-034325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Schwartz JC, Wang X, Podell ER, Cech TR. RNA seeds higher-order assembly of FUS protein. Cell Rep. 2013;5:918–925. doi: 10.1016/j.celrep.2013.11.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, Amin N, Schwikowski B, Ideker T. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Research. 2003;13:2498–2504. doi: 10.1101/gr.1239303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Shen S, Park JW, Huang J, Dittmar KA, Lu ZX, Zhou Q, Carstens RP, Xing Y. MATS: a Bayesian framework for flexible detection of differential alternative splicing from RNA-Seq data. Nucleic Acids Research. 2012;40:e61–e61. doi: 10.1093/nar/gkr1291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Singh R, Valcarcel J, Green MR. Distinct binding specificities and functions of higher eukaryotic polypyrimidine tract-binding proteins. Science. 1995;268:1173–1176. doi: 10.1126/science.7761834. [DOI] [PubMed] [Google Scholar]
  48. Siomi H, Matunis MJ, Michael WM, Dreyfuss G. The pre-mRNA binding K protein contains a novel evolutionarily conserved motif. Nucleic Acids Research. 1993;21:1193–1198. doi: 10.1093/nar/21.5.1193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Smith SA, Ray D, Cook KB, Mallory MJ, Hughes TR, Lynch KW. Paralogs hnRNP L and hnRNP LL exhibit overlapping but distinct RNA binding constraints. PLoS ONE. 2013;8:e80701. doi: 10.1371/journal.pone.0080701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Soemedi R, Cygan KJ, Rhine CL, Glidden DT, Taggart AJ, Lin CL, Fredericks AM, Fairbrother WG. The effects of structure on pre-mRNA processing and stability. Methods. 2017;125:36–44. doi: 10.1016/j.ymeth.2017.06.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Sundararaman B, Zhan L, Blue SM, Stanton R, Elkins K, Olson S, Wei X, Van Nostrand EL, Pratt GA, Huelga SC, Smalec BM, Wang X, Hong EL, Davidson JM, Lécuyer E, Graveley BR, Yeo GW. Resources for the Comprehensive Discovery of Functional RNA Elements. Molecular Cell. 2016;61:903–913. doi: 10.1016/j.molcel.2016.02.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Taliaferro JM, Lambert NJ, Sudmant PH, Dominguez D, Merkin JJ, Alexis MS, Bazile C, Burge CB. RNA Sequence Context Effects Measured In Vitro Predict In Vivo Protein Binding and Regulation. Molecular Cell. 2016;64:294–306. doi: 10.1016/j.molcel.2016.08.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Teplova M, Malinina L, Darnell JC, Song J, Lu M, Abagyan R, Musunuru K, Teplov A, Burley SK, Darnell RB, Patel DJ. Protein-RNA and protein-protein recognition by dual KH1/2 domains of the neuronal splicing factor Nova-1. Structure. 2011;19:930–944. doi: 10.1016/j.str.2011.05.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Teplova M, Song J, Gaw HY, Teplov A, Patel DJ. Structural insights into RNA recognition by the alternate-splicing regulator CUG-binding protein 1. Structure. 2010;18:1364–1377. doi: 10.1016/j.str.2010.06.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Thisted T, Lyakhov DL, Liebhaber SA. Optimized RNA targets of two closely related triple KH domain proteins, heterogeneous nuclear ribonucleoprotein K and alphaCP-2KL, suggest Distinct modes of RNA recognition. J Biol Chem. 2001;276:17484–17496. doi: 10.1074/jbc.M010594200. [DOI] [PubMed] [Google Scholar]
  56. Treiber T, Treiber N, Plessmann U, Harlander S, Daiß JL, Eichner N, Lehmann G, Schall K, Urlaub H, Meister G. A Compendium of RNA-Binding Proteins that Regulate MicroRNA Biogenesis. Molecular Cell. 2017;66:270–284 e13. doi: 10.1016/j.molcel.2017.03.014. [DOI] [PubMed] [Google Scholar]
  57. Tsai YS, Gomez SM, Wang Z. Prevalent RNA recognition motif duplication in the human genome. RNA. 2014;20:702–712. doi: 10.1261/rna.044081.113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Ule J, Jensen KB, Ruggiu M, Mele A, Ule A, Darnell RB. CLIP identifies Nova-regulated RNA networks in the brain. Science. 2003;302:1212–1215. doi: 10.1126/science.1090095. [DOI] [PubMed] [Google Scholar]
  59. Valverde R, Edwards L, Regan L. Structure and function of KH domains. FEBS J. 2008;275:2712–2726. doi: 10.1111/j.1742-4658.2008.06411.x. [DOI] [PubMed] [Google Scholar]
  60. Van Nostrand EL, Freese P, Pratt GA, Wang X, Wei X, Blue SM, Dominguez D, Cody NAL, Olson S, Sundararaman B, Xiao R, Zhan L, Bazile C, Benoit Bouvrette LP, Chen J, Duff MO, Garcia K, Gelboin-Burkhart C, Hochman A, Lambert NJ, Li H, Nguyen TB, Palden T, Rabano I, Sathe S, Stanton R, Louie AL, Aigner S, Bergalet J, Zhou B, Su A, Wang R, Yee BA, Fu X-D, Lécuyer E, Burge CB, Graveley B, Yeo GW. A Large-Scale Binding and Functional Map of Human RNA Binding Proteins. 2017 doi: 10.1101/179648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Wang X, Tanaka Hall TM. Structural basis for recognition of AU-rich element RNA by the HuD protein. Nat Struct Biol. 2001;8:141–145. doi: 10.1038/84131. [DOI] [PubMed] [Google Scholar]
  62. Wang Y, Ma M, Xiao X, Wang Z. Intronic splicing enhancers, cognate splicing factors and context-dependent regulation rules. Nat Struct Mol Biol. 2012;19:1044–1052. doi: 10.1038/nsmb.2377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Wang Y, Xiao X, Zhang J, Choudhury R, Robertson A, Li K, Ma M, Burge CB, Wang Z. A complex network of factors with overlapping affinities represses splicing through intronic elements. Nat Struct Mol Biol. 2013;20:36–45. doi: 10.1038/nsmb.2459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Warf MB, Diegel JV, von Hippel PH, Berglund JA. The protein factors MBNL1 and U2AF65 bind alternative RNA structures to regulate splicing. Proc Natl Acad Sci USA. 2009;106:9203–9208. doi: 10.1073/pnas.0900342106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Wei G-H, Badis G, Berger MF, Kivioja T, Palin K, Enge M, Bonke M, Jolma A, Varjosalo M, Gehrke AR, Yan J, Talukder S, Turunen M, Taipale M, Stunnenberg HG, Ukkonen E, Hughes TR, Bulyk ML, Taipale J. Genome-wide analysis of ETS-family DNA-binding in vitro and in vivo. EMBO J. 2010;29:2147–2160. doi: 10.1038/emboj.2010.106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Witten JT, Ule J. Understanding splicing regulation through RNA splicing maps. Trends in Genetics. 2011;27:89–97. doi: 10.1016/j.tig.2010.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Wu X, Brewer G. The regulation of mRNA stability in mammalian cells: 2.0. Gene. 2012;500:10–21. doi: 10.1016/j.gene.2012.03.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Zhang X, Yan C, Hang J, Finci LI, Lei J, Shi Y. An Atomic Structure of the Human Spliceosome. Cell. 2017;169:918–929 e14. doi: 10.1016/j.cell.2017.04.033. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1. Table S1.

List of primers and cloned regions for all assayed RBPs, related to Figure 1.

2. Table S2.

Number of reads obtained in all RBNS experiments, related to Figure 1.

3. Table S3.

Summary of RBNS experiments including experimental procedures and derived motifs, related to Figure 2.

4. Table S4.

Ppaired of each position in input and pulldown library, recalculated R by Ppaired bin, and recalculated R values by structural element for top 6mer of each RBNS, related to Figure 4.

5. Table S5.

Bipartite motifs and nucleotide context preferences for all assayed RBPs, related to Figure 5.

6. Table S6.

Motif clusters and their significantly divergent features, related to Figure 6.

7

RESOURCES