Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Sep 1.
Published in final edited form as: Biochim Biophys Acta. 2018 Jun 8;1864(9 Pt B):2938–2948. doi: 10.1016/j.bbadis.2018.06.004

Misfolded rhodopsin mutants display variable aggregation properties

Megan Gragg 1, Paul S-H Park 1,*
PMCID: PMC6066411  NIHMSID: NIHMS981148  PMID: 29890221

Abstract

The largest class of rhodopsin mutations causing autosomal dominant retinitis pigmentosa (adRP) is mutations that lead to misfolding and aggregation of the receptor. The misfolding mutants have been characterized biochemically, and categorized as either partial or complete misfolding mutants. This classification is incomplete and does not provide sufficient information to fully understand the disease pathogenesis and evaluate therapeutic strategies. A Förster resonance energy transfer (FRET) method was utilized to directly assess the aggregation properties of misfolding rhodopsin mutants within the cell. Partial (P23H and P267L) and complete (G188R, H211P, and P267R) misfolding mutants were characterized to reveal variability in aggregation properties. The complete misfolding mutants all behaved similarly, forming aggregates when expressed alone, minimally interacting with the wild-type receptor when coexpressed, and were unresponsive to treatment with the pharmacological chaperone 9-cis retinal. In contrast, variability was observed between the partial misfolding mutants. In the opsin form, the P23H mutant behaved similarly as the complete misfolding mutants. In contrast, the opsin form of the P267L mutant existed as both aggregates and oligomers when expressed alone and formed mostly oligomers with the wild-type receptor when coexpressed. The partial misfolding mutants both reacted similarly to the pharmacological chaperone 9-cis retinal, displaying improved folding and oligomerization when expressed alone but aggregating with wild-type receptor when coexpressed. The observed differences in aggregation properties and effect of 9-cis retinal predict different outcomes in disease pathophysiology and suggest that retinoid-based chaperones will be ineffective or even detrimental.

Keywords: retinitis pigmentosa, G protein-coupled receptor, retinal degeneration, protein misfolding, protein aggregation, phototransduction

1. Introduction

Over 100 mutations in the rhodopsin gene have been discovered in patients with inherited retinal disease, with a variety of adverse consequences observed in the mutant receptor. A majority of these rhodopsin mutations with known biochemical defects cause misfolding and aggregation of the apoprotein opsin [1, 2], leading to an autosomal dominant form of retinitis pigmentosa (adRP), a retinal degenerative disease currently without a cure [3, 4]. Rhodopsin is the G protein-coupled receptor (GPCR) that begins the biochemical events in phototransduction, which transforms light signals into an electrical signal in photoreceptor cells. Proper rhodopsin folding and transport is required for normal phototransduction and vision, with the fully functional form of rhodopsin consisting of the apoprotein opsin binding the chromophore 11-cis retinal [5]. In misfolded rhodopsin-mediated adRP, photoreceptor cell death occurs, at least in part, because of toxic misfolded opsin aggregates in the endoplasmic reticulum (ER) of the inner segment of rod photoreceptor cells where rhodopsin is synthesized [6–10]. Little is known about the nature of aggregates formed, and the mechanism by which aggregates cause cell toxicity is still unclear.

The misfolding rhodopsin mutants found in adRP have been classified biochemically since the discovery of rhodopsin mutations in adRP patients [1, 2, 11–13]. The biochemical classification is based on the ability of the receptor to bind its chromophore 11-cis retinal, which is measured by UV/Vis spectroscopy on purified receptor [14]. Misfolding rhodopsin mutants display a range of deficiency in the binding of 11-cis-retinal [15–18]. Mutants that bind some 11-cis retinal are classified as partial misfolding mutants and those that cannot bind any 11-cis retinal are classified as complete misfolding mutants. Partial misfolding mutants can be rescued by retinoid-based chaperones, forming properly folded receptor that can traffic properly in cells [14, 19–21]. In contrast, complete misfolding mutants do not bind retinoids and when expressed are found primarily in the ER [12, 15].

The biochemical classification of misfolding mutants of rhodopsin into partial and complete misfolding mutants is incomplete. This classification is based on observations of the mutants expressed alone and only indirectly assesses protein misfolding and aggregation. Thus, the current classification system does not provide the full scope of the misfolding/aggregation landscape of mutant rhodopsins necessary to understand the pathogenesis of the disease and formulate appropriate therapeutic strategies. The most extensively studied misfolding rhodopsin mutation is the P23H mutation, the most common rhodopsin mutation found in adRP patients in the United States [22]. The P23H mutant is classified as a partial misfolding mutant that can be rescued by retinoid-based chaperones [11, 19, 23, 24]. Observations on the P23H mutant are presumed to extend to other misfolding mutants as well; however, this may not be the case. For instance, physical interactions between mutant and wild-type (WT) receptor have been proposed to underlie the autosomal dominant phenotype in adRP based on observations on the P23H mutant [25]. However, studies on the G188R mutant, a complete misfolding mutant, demonstrate that the mutant does not physically interact with WT receptor [26], raising the possibility that different misfolding mutants have different properties that can impact disease pathogenesis. A better understanding of the differences among misfolding rhodopsin mutants may provide insight into the clinical variations observed among different rhodopsin mutations, for which the molecular mechanisms are currently unclear [17, 27].

A Förster resonance energy transfer (FRET) method was previously developed to directly detect the aggregation properties of misfolded opsin molecules within the cell [26]. This FRET-based method was used to examine the aggregation properties of misfolding rhodopsin mutants when expressed alone and in the presence of the WT receptor. Furthermore, we have tested the effect of a pharmacological chaperone on the aggregation properties of mutant receptors. A variety of misfolding mutants of rhodopsin that cause adRP were investigated to determine the range of aggregation properties present within this class of rhodopsin mutants. Partial (G188R) and complete (P23H) misfolding mutations occurring in the extracellular region of rhodopsin along with partial (P267L) and complete misfolding mutations (P267R and H211P) occurring within the transmembrane region of rhodopsin were investigated (Fig. 1) [12, 15, 16, 24, 28–31]. In the case of proline at position 267, mutation to leucine results in partial misfolding whereas mutation to arginine results in complete misfolding. The current study has uncovered further differentiations among misfolding rhodopsin mutants that must be considered to better understand the pathogenesis of adRP and evaluate therapeutic strategies.

Figure 1. Location of rhodopsin mutations studied.

Figure 1

Open in a new tab

The secondary structure of human rhodopsin is shown highlighting the position of mutated amino acid residues examined in the current study.

2. Materials and Methods

2.1 DNA Constructs

The cDNA for human rhodopsin (hRho) was contained in a vector described previously [32]. The sequence for hRho was amplified from this vector by PCR using the following forward and reverse primers: 5′ACGATGAAGCTTCGAATTCGCCACCATGAATGGCACAGAAGGCCC and 5′CATCGTGGATCCCGGGCCGGGGCCACCTGGCTCGTCT. The amplified PCR product contained EcoRI and BamHI restriction endonucleases sites at the 5′ and 3′ ends, respectively. The sequence for murine rhodopsin (mRho) in the vector pmRho-SYFP2-1D4, described previously [26, 33], was replaced by hRho at the EcoRI and BamHI restriction endonuclease sites to generate the vector phRho-SYFP2-1D4. This vector encodes for hRho tagged with a variant of yellow fluorescent protein (YFP). The cDNA for mTurquoise2 (mTq2) was contained in the vector pmTq2-C1 described previously [34]. The following forward and reverse primers were used to amplify the sequence for mTq2 by PCR using pmTq2-C1 as the template: 5′ACGATGGGATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGA and 5′CATCGTGCGGCCGCTAAGGCTGGAGCCACCTGGCTGGTCTCCGTCTTGTACAGCTCGT CCATGC. The amplified product contained a BamHI restriction endonuclease site at the 5′ end and also added the sequence for a 1D4 epitope (TETSQVAPA) followed by a NotI restriction endonuclease site at the 3′ end, generating the product mTq2-1D4. The sequence for the fluorescent protein in phRho-SYFP2-1D4 was replaced with the PCR product mTq2-1D4 at the BamHI and NotI restriction endonuclease sites to generate the vector phRho-mTq2-1D4. The vector pFLAG-m2-mTq-1D4 was generated previously [26], and the mTq-1D4 in this vector was replaced with mTq2-1D4 at the AgeI and Not1 restriction sites to produce the vector pFLAG-m2-mTq2-1D4.

The P23H, P267L, G188R, H211P, and P267R mutations were introduced into the phRho-SYFP2-1D4 vector adapting procedures in the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). The following forward and reverse primers were used: P23H, 5′GTGGTACGCAGCCACTTCGAGTACCCA and 5′TGGGTACTCGAAGTGGCTGCGTACCAC; P267L, 5′TGCTGGGTGCTCTACGCCAGC and 5′GCTGGCGTAGAGCACCCAGCA; G188R, 5′TGCTCGTGTCGAATCGACTAC and 5′GTAGTCGATTCGACACGAGCA; H211P, 5′CGTGGTCCACTTCCCCATCCCCATGAT and 5′ATCATGGGGATGGGGAAGTGGACCACG; P267R, 5′TGCTGGGTGCGCTACGCCAGC and 5′GCTGGCGTAGCGCACCCAGCA. To generate vectors coding for the mutants tagged with mTq2, the SYFP2-1D4 fluorescent protein sequence in these vectors was replaced with the sequence for mTq2-1D4 at the BamHI and NotI endonuclease restriction sites. The vectors generated were used for transient transfection of HEK293 cells.

2.2 Transient Transfection of HEK293 Cells

Transient transfection was conducted as described previously [26]. Briefly, HEK293T/17 cells (American Type Culture Collection, Manassas, VA) were grown in Dulbecco’s Modified Eagle’s Medium (DMEM) - high glucose (Thermo Fisher Scientific, Waltham, MA), supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Waltham, MA). 24 hours before transfection, HEK 293T/17 cells were seeded at a density of 1.5 × 105 cells per well in a 12-well plate, and then incubated in a 5% CO2 incubator for 24 hours, growing to about 60% confluency. Cells used for confocal imaging were seeded on poly-L-lysine treated #1.5 round coverslip glass (Thermo Fisher Scientific, Waltham, MA). The transfection of cells with DNA vectors was performed according to the manufacturer’s suggested protocol using Lipofectamine 2000 (Invitrogen, Carlsbad, CA).

For cells treated with 9-cis retinal (MilliporeSigma, St. Louis, MO), all procedures were performed in the dark under dim red-light conditions. 4–6 hours after transfection, 9-cis retinal was added to wells containing cells from a 100 mM stock solution in DMSO (Thermo Fisher Scientific, Waltham, MA). Plates containing cells were wrapped in foil and placed in the incubator overnight.

For FRET and microscopy experiments involving opsins and isorhodopsins, the total amount of DNA vector transfected was kept constant at 400 ng. For FRET experiments involving the m2 muscarinic receptor, 2500 ng of the vector pFLAG-m2-mTq2-1D4 was transfected to have similar expression levels to tagged opsins. 600 to 3600 ng of the vector phRho-SYFP2-1D4 was cotransfected with this vector to achieve different acceptor to donor ratios. 24 hours after transfection, the media was removed and each well was washed once with 1 mL PBS (4.3 mM Na2HPO4•7H2O, 1.4 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, pH 7.3). For FRET assays, cells were resuspended in 3 mL of PBS.

2.3 FRET Assay

The FRET assay and detergent treatment was conducted as described previously [26, 33]. Briefly, FRET assays were conducted on a FluoroMax-4 spectrofluorometer (Horiba Jobin Yvon, Edison, NJ). YFP fluorescence was observed by using a 485 nm excitation wavelength (5 nm slit width) and collecting the emission spectra with a 10 nm slit width. Fluorescence from mTq2 was detected using a 425 nm excitation wavelength (5 nm slit width) and collecting the emission spectra with a 10 nm slit width. The FRET efficiency (E) was computed by measuring the dequenching of the donor fluorescence signal (i.e., mTq2) after detergent treatment. The mTq2 fluorescence emission peak at 476 nm was measured in untreated cells, cells treated with n-dodecyl-β-D-maltoside (DM), and cells treated with SDS. Total E was computed as follows: Etotal = 1 – (mTq2untreated/mTq2SDS-treated). The DM-sensitive E was computed as follows: EDM-sensitive = (mTq2DM-treated – mTq2untreated)/mTq2SDS-treated. The DM-insensitive E was computed as follows: EDM-insensitive = 1 – (mTq2DM-treated/mTq2SDS-treated). The acceptor to donor (A:D) ratio was determined from cells coexpressing YFP- and mTq2-tagged receptors. The ratio was calculated by dividing YFP fluorescence emission at 527 nm in untreated cells by mTq2 fluorescence emission at 476 nm in SDS-treated cells.

FRET curves were generated by plotting the FRET efficiency versus the A:D ratio. Each FRET curve contains data from at least three separate experiments. The FRET data were fit by non-linear regression to the following rectangular hyperbolic function using Prism 7 (GraphPad Software, La Jolla, CA): E = (Emax × A:D)/(EC50 + A:D). The Emax was determined from the fit of the data to this equation and was determined for total, DM-sensitive, and DM-insensitive FRET.

2.4 Confocal Microscopy

Confocal microscopy and sample preparation was performed as described previously [26, 33]. Briefly, nuclei were labeled with DAPI (Biorad, Hercules, CA), the plasma membrane was labeled with WGA-Alexa Fluor 647 conjugate (Invitrogen, Carlsbad, CA) and the ER was labeled by cotransfecting cells with pDsRed2-ER (Clontech, Mountain Valley, CA), as described previously [33]. Confocal microscopy was performed on a SP8 confocal microscope (Leica, Buffalo Grove, IL) equipped with a 100x/1.4-NA oil objective. DAPI was detected by exciting samples with a 405 nm diode laser and collecting the emission signal at 415 – 450 nm. Fluorescence from mTq2 was detected by exciting samples at 458 nm using an Argon laser and collecting the emission signal at 465 – 500 nm. Images were collected sequentially. YFP was detected by exciting samples at 514 nm using a tunable white light laser and collecting the emission signal at 520 – 570 nm. DsRed2-ER was detected by exciting samples at 558 nm using a tunable white laser and collecting the emission signal at 570 – 600 nm. WGA-Alexa Fluor 647 was detected by exciting samples at 650 nm using a tunable white light laser and collecting the emission signal at 675 – 680 nm.

3. Results

3.1 Characterization of Human Opsin by FRET

A FRET method was previously established to investigate the oligomerization and aggregation of murine WT and G188R mutant opsins in the cell [26, 33, 35]. Oligomers and aggregates were differentiated based on the sensitivity of the FRET signal to the mild detergent, n-dodecyl-β-D-maltoside (DM). Oligomers of the light receptor expressed in both native photoreceptor cells and heterologous expression systems are known to monomerize in the presence of DM [36, 37]. In accord, the FRET signal originating from oligomers was disrupted by DM (i.e., DM-sensitive) whereas the FRET signal originating from aggregates could not be disrupted by DM (i.e., DM-insensitive) but could be disrupted by the harsher detergent SDS [26]. The assignment of DM-sensitive and DM-insensitive FRET signals to oligomers and aggregates, respectively, was supported by migration patterns on SDS-PAGE gels and subcellular localization in confocal microscopy images. The same FRET method was applied here to investigate the human versions of these opsins tagged with either the donor mTurquoise2 (mTq2) or acceptor yellow fluorescent protein (YFP).

Emission spectra were collected from cells coexpressing mTq2- and YFP-tagged WT or G188R opsins excited at 425 nm, near the excitation maximum for the donor molecule mTq2 (Figs. 2A and 2C, blue line). A sensitized emission peak was observed at 527 nm, the excitation maximum for YFP, which is indicative of FRET between donor and acceptor molecules. When cells were treated with DM, the sensitized emission from cells expressing WT opsin was eliminated whereas the sensitized emission from cells expressing G188R opsin could not be eliminated (Figs. 2A and 2C, red line). SDS treatment was required to eliminate the sensitized emission from cells expressing G188R opsin (Fig. 2C, green line). Elimination of the sensitized emission from YFP was accompanied by dequenching of the emission from mTq2, which was used to compute the FRET efficiency (see Materials and Methods). Three FRET efficiency values were computed. The total FRET efficiency represents the observed FRET in untreated cells. The DM-sensitive FRET efficiency represents the FRET originating from opsin oligomers that can be disrupted by DM treatment [26, 33]. The DM-insensitive FRET efficiency represents the FRET originating from opsin aggregates that are resistant to DM treatment [26].

Figure 2. FRET between tagged human WT opsins or human G188R opsins.

Figure 2

Open in a new tab

(A, C) Emission spectra from cells coexpressing equal amounts of YFP- and mTq2-tagged receptors. FRET was conducted on cells coexpressing YFP- and mTq2-tagged WT opsins (A) or YFP- and mTq2-tagged G188R opsins (C). Cell suspensions were excited at 425 nm and emission spectra were collected sequentially on untreated cells (blue), DM-treated cells (red), and SDS-treated cells (green). (B, D) FRET curves for WT (B) and G188R opsins (D). Total (blue, circles), DM-sensitive (red, squares) and DM-insensitive (green, triangles) FRET efficiencies were computed from emission spectra (i.e., A and C), as described in the Materials and Methods. FRET efficiencies were computed from cells expressing a range of acceptor (YFP) to donor (mTq2) ratios (A:D ratio). FRET curves were generated by plotting the computed FRET efficiency and the measured A:D ratio and fitting the data to a rectangular hyperbolic function to determine the maximal FRET efficiency (Emax). The Emax obtained from FRET curves for the non-specific control (i.e., cells coexpressing YFP-tagged WT opsin and mTq2-tagged m2 muscarinc receptor) is indicated by the dashed lines.

Because the observed FRET efficiency is dependent on the acceptor:donor (A:D) ratio, the maximal FRET efficiency (Emax) was determined to allow quantitative comparisons among the FRET data. Total, DM-sensitive, and DM-insensitive FRET efficiency values were computed at different A:D ratios and plotted to generate FRET curves and determine the Emax for each of the components (Figs. 2B and 2D). Non-specific FRET can arise from chance encounters occurring between fluorescent proteins attached to membrane proteins diffusing within a crowded membrane environment. This non-specific FRET must be exceeded to indicate specific physical interactions [38–42]. As defined previously [26], non-specific FRET was determined from control cells coexpressing YFP-tagged WT opsin and mTq2-tagged m2 muscarinic receptor, an unrelated GPCR (Fig. S1, Supporting Information). The Emax of the non-specific FRET curves must be exceeded to indicate specific FRET and specific interactions between opsin molecules.

The total FRET Emax for both WT and G188R opsin exceeded that of the non-specific FRET Emax. (Figs. 2B, 2D, and 3A), indicating that both opsins exhibit specific FRET and specific physical interactions. The DM-sensitive FRET Emax for WT opsin exceeded that of the control, whereas the DM-insensitive FRET Emax did not. Thus, the total specific FRET signal derives from DM-sensitive FRET, indicating that WT opsin predominantly forms oligomers rather than aggregates. In contrast, The DM-sensitive FRET Emax for G188R opsin did not exceed the control whereas the DM-insensitive FRET Emax did. Thus, the total specific FRET signal derives from DM-insensitive FRET, indicating that G188R opsin predominantly forms aggregates rather than oligomers. These FRET observations on human WT and G188R opsins are the same as those reported previously for the murine counterparts [26].

Figure 3. FRET analysis for cells singly expressing WT or mutant receptors.

Figure 3

Open in a new tab

FRET curves were generated from cells coexpressing YFP-and mTq2-tagged WT or mutant receptors to determine Emax (Supporting Information, Figs. S2 and S3 and Tables S1 and S2). Cells were untreated to examine the opsin form or treated with 15 μmM 9-cis retinal to examine the isorhodopsin form of the receptors. (A–C) Total (A), DM-sensitive (B), and DM-insensitive (C) FRET Emax values are plotted along with the error from fits of the FRET curves. The Emax obtained from FRET curves for the non-specific control (i.e., cells coexpressing YFP-tagged WT opsin and mTq2-tagged m2 muscarinic receptor) is indicated by the dashed lines. (D) The fraction of the total specific FRET signal derived from DM-sensitive and DM-insensitive FRET is plotted for WT and mutant opsins and isorhodopsins.

3.2 Characterization of Mutant Opsin Aggregation

The aggregation properties of partial misfolding opsin mutants (P23H and P267L) and complete misfolding opsin mutants (G188R, H211P, P267R) in the cell were examined by generating FRET curves and determining the Emax from total, DM-sensitive, and DM-insensitive FRET (Fig. S2, Supporting Information). All mutants exhibited total FRET Emax values that exceeded that of the non-specific control (Fig. 3A). Similar to G188R opsin, the Emax from DM-sensitive FRET did not exceed that of the non-specific control for all mutants except for P267L opsin (Fig. 3B). Likewise, all mutants exhibited Emax values from DM-insensitive FRET that exceeded the Emax of the non-specific control (Fig. 3C). Thus, the total specific FRET signal derives fully from DM-insensitive FRET for P23H, G188R, H211P, and P267R opsin (Fig. 3D), which indicates that these mutant opsins form aggregates rather than oligomers. A small fraction of the total specific FRET signal for the P267L opsin mutant derived from DM-sensitive FRET (Fig. 3D). Thus, the P267L opsin mutant forms both oligomers and aggregates in the cell.

The cellular localization of WT and mutant opsins was examined by confocal microscopy. Opsin forming oligomers is predominantly localized in the plasma membrane whereas opsin forming aggregates is localized in the ER [26, 33]. The cellular localization of opsins tagged with YFP in either the ER or plasma membrane was determined with markers for these cellular compartments (Fig. 4). WT opsin did not colocalize with the ER marker but did colocalize with the plasma membrane marker, which indicates proper transport of correctly folded opsin to the plasma membrane. This localization is consistent with the FRET observations indicating that WT opsin forms oligomers rather than aggregates. For the mutant opsins forming only aggregates (P23H, G188R, H211P, and P267R), colocalization was observed with the ER marker but not the plasma membrane marker, which indicates the retention of the misfolded protein in the ER. The P267L opsin, which forms both oligomers and aggregates, colocalized with both the ER and plasma membrane markers. Taken together, the confocal microscopy data are consistent with results from the FRET assay. Opsins that can fold properly and form oligomers are transported to the plasma membrane whereas opsins that misfold and aggregate are retained in the ER.

Figure 4. Confocal microscopy of HEK293 cells singly expressing WT or mutant opsins.

Figure 4

Open in a new tab

HEK293 cells coexpressed DsRed2-ER (red) to label the ER and YFP-tagged opsins (green), and were stained with DAPI (blue) to label nuclei and WGA to label the plasma membrane (PM) (magenta). Overlays of the signal from YFP and the ER marker (yellow) or from YFP and the PM marker (white) are shown. Opsins species are indicated. Scale bar, 10 μm.

3.3 Characterization of Mutant Isorhodopsin Aggregation

In rod photoreceptor cells, the apoprotein opsin binds the chromophore 11-cis retinal to form rhodopsin. Multiple studies have demonstrated the ability of retinoids to act as pharmacological chaperones for misfolded opsin mutants [14, 19, 21, 43, 44]. To examine the effect of a chaperone on the aggregation properties of misfolding opsin mutants, FRET curves were generated on cells treated with 9-cis retinal. This retinoid was used rather than 11-cis retinal because it is more stable and binds opsin to form isorhodopsin, which is functionally equivalent to rhodopsin [45]. The toxicity of 9-cis retinal on HEK293 cells was first determined. The expression level of P23H or G188R opsin was determined at increasing concentrations of 9-cis retinal (Fig. 5A). The expression of both opsin mutants decreased with increasing concentrations of 9-cis retinal. At 30 μM of 9-cis retinal, cells were completely detached from the plate and the expression of the opsins could not be determined. Since G188R opsin cannot bind 9-cis retinal, the reduction in protein expression appears to derive from a toxic effect of the retinoid on cells.

Figure 5. Treatment of cells with 9-cis retinal.

Figure 5

Open in a new tab

(A) Cell toxicity of 9-cis retinal. HEK293 cells expressing either mTq2-tagged P23H (blue, circles) or G188R (red, square) mutant opsins were treated with increasing concentrations of 9-cis retinal. The fluorescence from mTq2 was quantified per cell and the relative value plotted at each concentration of 9-cis retinal tested. (B–D) FRET curve analysis for cells expressing YFP- and mTq2-tagged P23H mutant opsin treated with different concentrations of 9-cis retinal. DM-sensitive (B) and DM-insensitive (C) FRET Emax values are plotted along with the error from fits of FRET curves. The Emax obtained from FRET curves for the non-specific control (i.e., cells coexpressing YFP-tagged WT opsin and mTq2-tagged m2 muscarinic receptor) is indicated by the dashed lines. The fraction of the total specific FRET signal derived from DM-sensitive and DM-insensitive FRET is plotted for the P23H mutant at different concentrations of 9-cis retinal (D).

To determine the lowest concentration of 9-cis retinal that can be used to minimize cell toxicity and still detect chaperoning effects, we examined the aggregation properties of the P23H mutant at 10, 15, and 20 μM of 9-cis retinal (Figs. 5B–5D). At 10 μM of 9-cis retinal, no specific DM-sensitive FRET was observed. At 15 μM of 9-cis retinal, specific DM-sensitive FRET began to emerge with a reduction in the fraction of DM-insensitive FRET. At 20 μM of 9-cis retinal, the fraction of DM-sensitive FRET was even greater relative to DM-insensitive FRET. Thus, the chaperoning effect of 9-cis retinal results in the formation of oligomers, an effect that was concentration-dependent. To examine the effect of 9-cis retinal on the other misfolding mutants, a concentration of 15 μM was used to minimize cell toxicity.

FRET curves were generated for WT and mutant isorhodopsins expressed in cells treated with 15 μM of 9-cis retinal (Fig. S3, Supporting Information). We refer to all opsins treated with 9-cis retinal as isorhodopsin even though some opsins examined will not bind the retinoid. All isorhodopsins exhibited total FRET Emax values that exceeded that of the non-specific control (Fig. 3A). Similar to the opsin form, the total specific FRET signal derived from DM-sensitive FRET for WT isorhodopsin. The origin of the total FRET signal for the partial misfolding mutants, P23H and P267L, was different from that of the complete misfolding mutants, G188R, H211P, and P267R (Fig. 3D). P23H and P267L isorhodopsin exhibited both DM-sensitive and DM-insensitive FRET that was above the non-specific control (Figs. 3B and 3C). Thus, the fraction of total FRET derived from DM-sensitive FRET increased relative to the fraction of DM-insensitive FRET (Fig. 3D), indicating a rescue of misfolded protein allowing the formation of oligomers. In contrast, G188R, H211P, and P267R isorhodopsin exhibited only DM-insensitive FRET above the non-specific control, indicating the complete misfolding mutants only form aggregates and remain unchanged from their opsin state. Thus, 9-cis retinal treatment only affects the partial misfolding mutants and not the complete misfolding mutants.

The cellular localization of WT and mutant isorhodopsins was examined by confocal microscopy (Fig. 6). Similar to the opsin form, WT isorhodopsin colocalized with the plasma membrane marker but not the ER marker, indicating that it is properly transported to the plasma membrane. The partial misfolding mutant isorhodopsins, P23H and P267L, exhibited some colocalization with both the plasma membrane marker and ER marker. Thus, some of the mutant proteins can exit the ER and be transported to the plasma membrane, which is consistent with the FRET data that shows both DM-sensitive and DM-insensitive species, indicating the presence of both oligomers and aggregates. The complete misfolding mutant isorhodopsins, G188R, H211P, and P267R, exhibited similar localization as their opsin forms, where the mutants colocalized with the ER marker but not the plasma membrane marker. With the FRET and confocal data taken together, 9-cis retinal treatment reduces aggregation and promotes oligomerization and transport to the plasma membrane for the partial misfolding mutants but had no effect on the complete misfolding mutants.

Figure 6. Confocal microscopy of HEK293 cells singly expressing WT or mutant isorhodopsins.

Figure 6

Open in a new tab

Cells were treated with 15 μmM 9-cis retinal to generate isorhodopsin. Cells coexpressed DsRed2-ER (red) to label the ER and YFP-tagged isorhodopsins (green), and were stained with DAPI (blue) to label nuclei and WGA to label the plasma membrane (PM) (magenta). Overlays of the signal from YFP and the ER marker (yellow) or from YFP and the PM marker (white) are shown. Isorhodopsin species are indicated. Scale bar, 10 μm.

3.4 Aggregation Properties of Mutant Opsins Coexpressed with WT Opsin

Almost all patients with rhodopsin-mediated adRP express both WT and mutant opsins, with only a few reported cases where patients were homozygous for a rhodopsin mutation [46–48]. Thus, understanding how the mutants interact with and affect the WT receptor is important to understand disease pathophysiology. Previously, we demonstrated minimal interactions between murine G188R and WT opsin [26]. The behavior of other misfolding opsin mutants is unclear and were therefore examined here. FRET curves were generated from cells coexpressing mutant opsins tagged with YFP and WT opsin tagged with mTq2 (Fig. S4, Supporting Information).

Only the total FRET Emax for P267L opsin exceeded that of the non-specific control (Fig. 7A). Thus, P267L opsin forms specific interactions with WT opsin whereas the other mutant opsins do not. The total specific FRET derived predominantly from DM-sensitive FRET, which exceeded that of the non-specific control (Fig. 7B). Thus, P267L opsin appears to form oligomers with WT opsin when the two forms are coexpressed. The Emax for DM-insensitive FRET measured in cells coexpressing P267L and WT opsin also exceeded that of the non-specific control, albeit only by a small amount (Fig. 7C). We demonstrated previously that this low level of FRET derives from interactions with a minor fraction of misfolded WT opsin that itself aggregates in cells [26]. Likewise, the small specific DM-insensitive FRET signal observed for the other mutants also likely derives from the same source.

Figure 7. FRET analysis for cells coexpressing WT and mutant receptors.

Figure 7

Open in a new tab

FRET curves were generated from cells coexpressing YFP-tagged mutant and mTq2-tagged WT receptors to determine Emax (Supporting Information, Figs. S4 and S6 and Tables S3 and S4). Cells were untreated to examine the opsin form or treated with 15 μmM 9-cis retinal to examine the isorhodopsin form of the receptors. Total (A), DM-sensitive (B), and DM-insensitive (C) FRET Emax values are plotted along with the error from fits of the FRET curves. The Emax obtained from FRET curves for the non-specific control (i.e., cells coexpressing YFP-tagged WT opsin and mTq2-tagged m2 muscarinic receptor) is indicated by the dashed lines.

Confocal microscopy of cells coexpressing WT and mutant opsins was performed to determine the localization of the coexpressed receptors (Fig. 8 and Fig. S5, Supporting Information). For mutant opsins that did not show specific total FRET (P23H, G188R, H211P, and P267R), colocalization was largely absent between the WT and mutant opsins except for minor colocalization observed intracellularly. In contrast, significant colocalization was observed between WT and P267L opsin. Taken together, only the P267L opsin mutant forms significant interactions with WT opsin in the form of oligomers. The other mutant opsins largely do not interact with WT opsin, which allows WT opsin to transport to the plasma membrane while the mutants remain in the ER presumably as aggregates.

Figure 8. Confocal microscopy of HEK293 cells coexpressing WT and mutant opsins.

Figure 8

Open in a new tab

HEK293 cells coexpressed mTq2-tagged WT opsin (green) and YFP-tagged mutant opsins (red). Each row shows images of fluorescence from mTq2 (green), YFP (red), or an overlay of fluorescence from mTq2 and YFP (yellow). Fluorescence from DAPI is shown in blue. The specific mutant opsin coexpressed with WT opsin is indicated. Scale bar, 10 μm.

3.5 Aggregation Properties of Mutant Isorhodopsins Coexpressed with WT Isorhodopsin

The interactions between WT and mutant isorhodopsins were examined in cells treated with 9-cis retinal. FRET curves were generated from cells treated with 15 μM of 9-cis retinal coexpressing WT and mutant isorhodopsins (Fig. S6, Supporting Information). The partial misfolding mutants (P23H and P267L) exhibited total FRET Emax values that exceeded that of the non-specific control whereas the complete misfolding mutants (G188R, H211P, and P267R) did not (Fig. 7A). Thus, only the partial misfolding mutants appear to form significant specific interactions with WT isorhodopsin. The partial misfolding mutants did not display specific DM-sensitive FRET but did display specific DM-insensitive FRET (Figs. 7B and 7C). Thus, the specific total FRET derives from DM-insensitive FRET, indicating that the partial misfolding isorhodopsins aggregate with WT isorhodopsin. Similar to the opsin form, the complete misfolding mutants exhibited a small specific DM-insensitive FRET signal, which likely derives from aggregation with a minor population of misfolded WT receptor present in HEK293 cells [26].

The cellular localization of WT and mutant isorhodopsins was determined by confocal microscopy (Fig. 9 and Figs. S7 and S8, Supporting Information). When WT isorhodopsin was coexpressed with the partial misfolding mutant isorhodopsins (P23H and P267L), WT isorhodopsin colocalized with the mutants intracellularly, which is consistent with FRET data indicating that the WT and mutant isorhodopsins aggregate. Some WT isorhodopsin was also present in the plasma membrane (Figs. S7 and S8, Supporting Information), indicating that some of the WT isorhodopsin can transport properly. The complete misfolding mutants (H211P, G188R, and P267R) largely did not colocalize with WT isorhodopsin except for minor colocalization intracellularly. The confocal microscopy data for the complete misfolding mutants is also consistent with the FRET data that indicates minimal interactions between the mutants and WT isorhodopsin.

Figure 9. Confocal microscopy of HEK293 cells coexpressing WT and mutant isorhodopsins.

Figure 9

Open in a new tab

HEK293 cells coexpressed mTq2-tagged WT isorhodopsin (green) and YFP-tagged mutant isorhodopsins (red). Cells were treated with 15 mM 9-cis retinal to generate isorhodopsin. Each row shows images of fluorescence from mTq2 (green), YFP (red), or an overlay of fluorescence from mTq2 and YFP (yellow). Fluorescence from DAPI is shown in blue. The specific mutant isorhodopsin coexpressed with WT isorhodopsin is indicated. Scale bar, 10 μm.

4. Discussion

4.1 WT Rhodopsin

The apoprotein opsin must bind the chromophore 11-cis retinal to generate rhodopsin, the functional form of the receptor that initiates phototransduction [5]. The exact location in rod photoreceptors where opsin binds its chromophore to form rhodopsin is unclear. Since the amount of 11-cis retinal in the retina is stoichiometric with rhodopsin [49], presumably there is not a large pool of free 11-cis retinal in rod photoreceptor cells and the light receptor is present in the opsin form upon biosynthesis in the inner segment. The FRET data for WT human opsin and isorhodopsin were similar and indicate that both forms of the receptor form predominantly oligomers rather than aggregates (Fig. 3), which suggests that the chromophore is unnecessary for the proper folding and oligomerization of the receptor. This observation is consistent with atomic force microscopy studies demonstrating that both opsin and rhodopsin form oligomers in rod outer segment disc membranes [50]. The FRET data for human opsin in the current study were similar to those obtained for murine opsin reported previously [26]. This similarity indicates that both human and murine forms of the receptor oligomerize similarly, as has been demonstrated previously by atomic force microscopy on native rod photoreceptor cell membranes [51].

4.2 Complete Misfolding Rhodopsin Mutants

The presence or absence of chromophore appears to be irrelevant when considering the interactions formed by the WT receptor; however, chromophore is important when considering the interactions formed by the misfolding mutants. Since a large pool of free 11-cis retinal is absent in photoreceptor cells, the opsin form of the mutants should be considered as the physiologically relevant form. Experiments conducted here in the presence of 9-cis retinal should be considered non-physiological, but are important for considering the effect of a pharmacological chaperone on mutant aggregation properties.

The complete misfolding mutants, G188R, H211P, and P267R, are unable to bind 11-cis retinal and therefore cannot be chaperoned by this retinoid [15, 16]. As expected, when these mutants were expressed alone in cells, they formed aggregates rather than oligomers both in the absence and presence of 9-cis retinal (Fig. 3). The aggregation properties of all complete misfolding mutants were the same and therefore mutations in either the extracellular region or transmembrane domains lead to similar aggregation profiles. The specific amino acid residue change can have an impact on aggregation properties as the P267R mutant displays a different aggregation profile compared to the P267L mutant.

Most patients harboring mutations causing rhodopsin misfolding will express both a mutant copy and WT copy of rhodopsin. When both the mutant and WT receptor were coexpressed in cells, either in the absence or presence of 9-cis retinal, the mutant and WT receptor largely did not interact and the WT receptor was able to traffic properly to the plasma membrane (Figs. 7–9). The absence of physical interactions indicates that the misfolding mutants do not promote misfolding of the WT receptor and that aggregation is mediated by specific interactions, previously suggested to involve β-sheet structures [33]. Accordingly, the pathogenesis in patients harboring complete misfolding mutations is predicted not to involve physical interactions between mutant and WT receptor and retinoid-based chaperones are predicted to be ineffective therapeutically.

4.3 Partial Misfolding Rhodopsin Mutants

In contrast to complete misfolding mutants, the partial misfolding mutants (P23H and P267L) displayed variability in their aggregation properties. In the opsin form, the P23H mutant behaved similarly to the complete misfolding mutants. P23H opsin formed aggregates rather than oligomers and largely did not form physical interactions with WT opsin when coexpressed in cells (Figs. 3 and 7). Previously, it was suggested that P23H opsin and WT opsin can form physical interactions based on the detection of FRET between the tagged form of the opsins [52]. The detected FRET signal was low, however, and likely derived from non-specific FRET. The opsin form of the P267L mutant formed both oligomers and aggregates and some of the receptors trafficked to the plasma membrane when expressed alone (Figs. 3 and 4). When P267L opsin was coexpressed with WT opsin, some mutant formed oligomers with the WT receptor and properly trafficked to the plasma membrane (Fig. 7 and 8). Thus, WT opsin appears to act as a chaperone for P267L opsin, promoting the proper folding, oligomerization, and trafficking of the mutant. The P267L mutation results in a milder misfolding phenotype compared to the P23H mutation and therefore patients expressing the P267L mutant are expected to exhibit a milder retinal degeneration phenotype.

Since the partial misfolding mutants can be chaperoned by retinoids and bind 11-cis retinal [14–16], treatment of cells with 9-cis retinal expressing P23H or P267L opsin was expected to help in the folding, oligomerization, and trafficking of these mutants. Indeed, when these mutants were expressed alone in cells, treatment with 9-cis retinal rescued a fraction of the misfolded receptor, allowing for the formation of oligomers and trafficking to the plasma membrane (Figs. 3 and 6). Full rescue of the partial misfolding mutants is expected at higher concentrations of 9-cis retinal; however, the higher concentrations will be toxic to cells (Fig. 5).

Although 9-cis retinal treatment was beneficial when the partial misfolding mutants were expressed in cells alone, surprisingly, the treatment was detrimental when the mutants were coexpressed with WT receptor. For both the P23H and P267L mutants, treatment of cells with 9-cis retinal caused some of the WT receptor to aggregate with the mutants and mislocalize intracellularly (Figs. 7 and 9). Although retinoids can promote proper folding and trafficking of partial misfolding mutants, these pharmacologically rescued mutants are unstable [44, 53]. This instability may underlie the aggregation of the mutants with the wild-type receptor. Further studies are required to better understand the mechanism by which the pharmacologically rescued mutants aggregate with WT receptor.

Retinoid-based chaperones are predicted to increase the level of aggregates in patients heterozygous for the mutants, increasing the severity of the disease. Consistent with this expectation, metformin treatment of rodents expressing both P23H and WT receptor results in a more severe retinal degeneration even though metformin treatment in a heterologous expression system expressing only P23H opsin improved the folding and trafficking of the mutant receptor [54]. These observations indicate that some approaches that appear to promote the proper folding of partial misfolding mutants when they are expressed alone may in fact cause additional aggregation when the mutants are coexpressed with WT receptor. Chaperone-based approaches may be beneficial for patients homozygous for partial misfolding mutants; however, they will be detrimental for patients heterozygous for the partial misfolding mutants.

4.4. Concluding Remarks

The current study has revealed additional subdivisions beyond the current biochemical classification of misfolding rhodopsin mutants as partial and complete misfolding mutants. While the complete misfolding mutants all displayed similar aggregation properties, partial misfolding mutants exhibited differences and therefore should be subdivided further. Retinoid-based chaperones are predicted to be either ineffective for complete misfolding mutants or detrimental for partial misfolding mutants. Whether other types of chaperones may result in similar effects as reported here for retinoid-based chaperones is unclear; therefore, the effects of other types of chaperones must be tested. The variety of aggregation properties observed among different rhodopsin misfolding mutants demonstrate that they must be evaluated individually, and the effectiveness of a therapeutic approach will depend on the specific misfolding rhodopsin mutation.

Supplementary Material

supplement

Highlights.

  • Aggregation properties of misfolding mutants of rhodopsin were characterized

  • Complete misfolding mutants exhibited similar aggregation properties

  • Partial misfolding mutants displayed variability in their aggregation properties

  • Complete misfolding mutants were unresponsive to a pharmacological chaperone

  • The pharmacological chaperone was detrimental in some instances

Acknowledgments

We would like to thank Dawn Smith for culturing HEK293 cells, Theodorus W. J. Gadella (University of Amsterdam, Amsterdam, Netherlands) for providing the mTq2-C1 vector, and Krzysztof Palczewski (Case Western Reserve University, Cleveland, OH) for providing the vector containing the human rhodopsin cDNA. This work was funded by grants from the National Institutes of Health (R01EY021731, P30EY011373, and T32EY024236) and Research to Prevent Blindness (Unrestricted Grant). We would like to acknowledge use of the Leica SP8 confocal microscope in the Genetics Department Imaging Facility at Case Western Reserve University made available through the Office of Research Infrastructure Programs (NIH-ORIP) Shared Instrumentation Grant S10 OD016164.

Abbreviations

A:D

acceptor to donor

adRP

autosomal dominant retinitis pigmentosa

DAPI

2-(4-amidinophenyl)-1H -indole-6-carboxamidine

DM

n-dodecyl-β-D-maltoside

DMSO

dimethyl sulfoxide

ER

endoplasmic reticulum

Emax

maximal FRET efficiency

FRET

Förster resonance energy transfer

GPCR

G protein-coupled receptor

hRho

human rhodopsin

mRho

murine rhodopsin

m2

human m2 muscarinic receptor

mTq2

mTurquoise2

PBS

phosphate buffered saline

PCR

polymerase chain reaction

PM

plasma membrane

RP

retinitis pigmentosa

SDS

sodium dodecyl sulfate

WGA

wheat germ agglutinin

WT

wild-type

YFP

yellow fluorescent protein

Footnotes

Conflict of interest

All authors declare no conflict of interests exist.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Mendes HF, van der Spuy J, Chapple JP, Cheetham ME. Mechanisms of cell death in rhodopsin retinitis pigmentosa: implications for therapy. Trends Mol Med. 2005;11:177–185. doi: 10.1016/j.molmed.2005.02.007. [DOI] [PubMed] [Google Scholar]
  • 2.Athanasiou D, Aguila M, Bellingham J, Li W, McCulley C, Reeves PJ, Cheetham ME. The molecular and cellular basis of rhodopsin retinitis pigmentosa reveals potential strategies for therapy. Prog Retin Eye Res. 2018;62:1–23. doi: 10.1016/j.preteyeres.2017.10.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Parmeggiani F, Sato G, De Nadai K, Romano MR, Binotto A, Costagliola C. Clinical and Rehabilitative Management of Retinitis Pigmentosa: Up-to-Date. Curr Genomics. 2011;12:250–259. doi: 10.2174/138920211795860125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Shintani K, Shechtman DL, Gurwood AS. Review and update: current treatment trends for patients with retinitis pigmentosa. Optometry. 2009;80:384–401. doi: 10.1016/j.optm.2008.01.026. [DOI] [PubMed] [Google Scholar]
  • 5.Park PS. Constitutively active rhodopsin and retinal disease. Advances in pharmacology. 2014;70:1–36. doi: 10.1016/B978-0-12-417197-8.00001-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Athanasiou D, Kosmaoglou M, Kanuga N, Novoselov SS, Paton AW, Paton JC, Chapple JP, Cheetham ME. BiP prevents rod opsin aggregation. Mol Biol Cell. 2012;23:3522–3531. doi: 10.1091/mbc.E12-02-0168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Vasireddy V, Chavali VR, Joseph VT, Kadam R, Lin JH, Jamison JA, Kompella UB, Reddy GB, Ayyagari R. Rescue of photoreceptor degeneration by curcumin in transgenic rats with P23H rhodopsin mutation. PLoS One. 2011;6:e21193. doi: 10.1371/journal.pone.0021193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Gorbatyuk MS, Knox T, LaVail MM, Gorbatyuk OS, Noorwez SM, Hauswirth WW, Lin JH, Muzyczka N, Lewin AS. Restoration of visual function in P23H rhodopsin transgenic rats by gene delivery of BiP/Grp78. Proc Natl Acad Sci U S A. 2010;107:5961–5966. doi: 10.1073/pnas.0911991107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Price BA, Sandoval IM, Chan F, Simons DL, Wu SM, Wensel TG, Wilson JH. Mislocalization and degradation of human P23H-rhodopsin-GFP in a knockin mouse model of retinitis pigmentosa. Invest Ophthalmol Vis Sci. 2011;52:9728–9736. doi: 10.1167/iovs.11-8654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Neri M, Vanni S, Tavernelli I, Rothlisberger U. Role of aggregation in rhodopsin signal transduction. Biochemistry. 2010;49:4827–4832. doi: 10.1021/bi100478j. [DOI] [PubMed] [Google Scholar]
  • 11.Sung CH, Schneider BG, Agarwal N, Papermaster DS, Nathans J. Functional heterogeneity of mutant rhodopsins responsible for autosomal dominant retinitis pigmentosa. Proc Natl Acad Sci U S A. 1991;88:8840–8844. doi: 10.1073/pnas.88.19.8840. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Sung CH, Davenport CM, Nathans J. Rhodopsin mutations responsible for autosomal dominant retinitis pigmentosa. Clustering of functional classes along the polypeptide chain. J Biol Chem. 1993;268:26645–26649. [PubMed] [Google Scholar]
  • 13.Kaushal S, Khorana HG. Structure and function in rhodopsin. 7. Point mutations associated with autosomal dominant retinitis pigmentosa. Biochemistry. 1994;33:6121–6128. doi: 10.1021/bi00186a011. [DOI] [PubMed] [Google Scholar]
  • 14.Krebs MP, Holden DC, Joshi P, Clark CL, 3rd, Lee AH, Kaushal S. Molecular mechanisms of rhodopsin retinitis pigmentosa and the efficacy of pharmacological rescue. J Mol Biol. 2010;395:1063–1078. doi: 10.1016/j.jmb.2009.11.015. [DOI] [PubMed] [Google Scholar]
  • 15.Liu X, Garriga P, Khorana HG. Structure and function in rhodopsin: correct folding and misfolding in two point mutants in the intradiscal domain of rhodopsin identified in retinitis pigmentosa. Proc Natl Acad Sci U S A. 1996;93:4554–4559. doi: 10.1073/pnas.93.10.4554. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hwa J, Garriga P, Liu X, Khorana HG. Structure and function in rhodopsin: packing of the helices in the transmembrane domain and folding to a tertiary structure in the intradiscal domain are coupled. Proc Natl Acad Sci U S A. 1997;94:10571–10576. doi: 10.1073/pnas.94.20.10571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Iannaccone A, Man D, Waseem N, Jennings BJ, Ganapathiraju M, Gallaher K, Reese E, Bhattacharya SS, Klein-Seetharaman J. Retinitis pigmentosa associated with rhodopsin mutations: Correlation between phenotypic variability and molecular effects. Vision Res. 2006;46:4556–4567. doi: 10.1016/j.visres.2006.08.018. [DOI] [PubMed] [Google Scholar]
  • 18.Garriga P, Liu X, Khorana HG. Structure and function in rhodopsin: correct folding and misfolding in point mutants at and in proximity to the site of the retinitis pigmentosa mutation Leu-125-->Arg in the transmembrane helix C. Proc Natl Acad Sci U S A. 1996;93:4560–4564. doi: 10.1073/pnas.93.10.4560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Noorwez SM, Malhotra R, McDowell JH, Smith KA, Krebs MP, Kaushal S. Retinoids assist the cellular folding of the autosomal dominant retinitis pigmentosa opsin mutant P23H. J Biol Chem. 2004;279:16278–16284. doi: 10.1074/jbc.M312101200. [DOI] [PubMed] [Google Scholar]
  • 20.Chen Y, Tang H, Seibel W, Papoian R, Li X, Lambert NA, Palczewski K. A High-Throughput Drug Screening Strategy for Detecting Rhodopsin P23H Mutant Rescue and Degradation. Invest Ophthalmol Vis Sci. 2015;56:2553–2567. doi: 10.1167/iovs.14-16298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Mendes HF, Cheetham ME. Pharmacological manipulation of gain-of-function and dominant-negative mechanisms in rhodopsin retinitis pigmentosa. Hum Mol Genet. 2008;17:3043–3054. doi: 10.1093/hmg/ddn202. [DOI] [PubMed] [Google Scholar]
  • 22.Sohocki MM, Daiger SP, Bowne SJ, Rodriquez JA, Northrup H, Heckenlively JR, Birch DG, Mintz-Hittner H, Ruiz RS, Lewis RA, Saperstein DA, Sullivan LS. Prevalence of mutations causing retinitis pigmentosa and other inherited retinopathies. Hum Mutat. 2001;17:42–51. doi: 10.1002/1098-1004(2001)17:1<42::AID-HUMU5>3.0.CO;2-K. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Saliba RS, Munro PM, Luthert PJ, Cheetham ME. The cellular fate of mutant rhodopsin: quality control, degradation and aggresome formation. J Cell Sci. 2002;115:2907–2918. doi: 10.1242/jcs.115.14.2907. [DOI] [PubMed] [Google Scholar]
  • 24.Dryja TP, McGee TL, Reichel E, Hahn LB, Cowley GS, Yandell DW, Sandberg MA, Berson EL. A point mutation of the rhodopsin gene in one form of retinitis pigmentosa. Nature. 1990;343:364–366. doi: 10.1038/343364a0. [DOI] [PubMed] [Google Scholar]
  • 25.Illing ME, Rajan RS, Bence NF, Kopito RR. A rhodopsin mutant linked to autosomal dominant retinitis pigmentosa is prone to aggregate and interacts with the ubiquitin proteasome system. J Biol Chem. 2002;277:34150–34160. doi: 10.1074/jbc.M204955200. [DOI] [PubMed] [Google Scholar]
  • 26.Gragg M, Kim TG, Howell S, Park PS. Wild-type opsin does not aggregate with a misfolded opsin mutant. Biochim Biophys Acta. 2016;1858:1850–1859. doi: 10.1016/j.bbamem.2016.04.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Jacobson SG, McGuigan DB, 3rd, Sumaroka A, Roman AJ, Gruzensky ML, Sheplock R, Palma J, Schwartz SB, Aleman TS, Cideciyan AV. Complexity of the Class B Phenotype in Autosomal Dominant Retinitis Pigmentosa Due to Rhodopsin Mutations. Invest Ophthalmol Vis Sci. 2016;57:4847–4858. doi: 10.1167/iovs.16-19890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Sheffield VC, Fishman GA, Beck JS, Kimura AE, Stone EM. Identification of novel rhodopsin mutations associated with retinitis pigmentosa by GC-clamped denaturing gradient gel electrophoresis. Am J Hum Genet. 1991;49:699–706. [PMC free article] [PubMed] [Google Scholar]
  • 29.Dryja TP, Hahn LB, Cowley GS, McGee TL, Berson EL. Mutation spectrum of the rhodopsin gene among patients with autosomal dominant retinitis pigmentosa. Proc Natl Acad Sci U S A. 1991;88:9370–9374. doi: 10.1073/pnas.88.20.9370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Souied E, Gerber S, Rozet JM, Bonneau D, Dufier JL, Ghazi I, Philip N, Soubrane G, Coscas G, Munnich A, et al. Five novel missense mutations of the rhodopsin gene in autosomal dominant retinitis pigmentosa. Hum Mol Genet. 1994;3:1433–1434. doi: 10.1093/hmg/3.8.1433. [DOI] [PubMed] [Google Scholar]
  • 31.Keen TJ, Inglehearn CF, Lester DH, Bashir R, Jay M, Bird AC, Jay B, Bhattacharya SS. Autosomal dominant retinitis pigmentosa: four new mutations in rhodopsin, one of them in the retinal attachment site. Genomics. 1991;11:199–205. doi: 10.1016/0888-7543(91)90119-y. [DOI] [PubMed] [Google Scholar]
  • 32.Pulagam LP, Palczewski K. Electrostatic compensation restores trafficking of the autosomal recessive retinitis pigmentosa E150K opsin mutant to the plasma membrane. J Biol Chem. 2010;285:29446–29456. doi: 10.1074/jbc.M110.151407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Miller LM, Gragg M, Kim TG, Park PS. Misfolded opsin mutants display elevated beta-sheet structure. FEBS Lett. 2015;589:3119–3125. doi: 10.1016/j.febslet.2015.08.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Goedhart J, von Stetten D, Noirclerc-Savoye M, Lelimousin M, Joosen L, Hink MA, van Weeren L, Gadella TW, Jr, Royant A. Structure-guided evolution of cyan fluorescent proteins towards a quantum yield of 93% Nat Commun. 2012;3:751. doi: 10.1038/ncomms1738. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Hovan SC, Howell S, Park PS. Forster resonance energy transfer as a tool to study photoreceptor biology. J Biomed Opt. 2010;15:067001. doi: 10.1117/1.3505023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Jastrzebska B, Maeda T, Zhu L, Fotiadis D, Filipek S, Engel A, Stenkamp RE, Palczewski K. Functional characterization of rhodopsin monomers and dimers in detergents. J Biol Chem. 2004;279:54663–54675. doi: 10.1074/jbc.M408691200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Ernst OP, Gramse V, Kolbe M, Hofmann KP, Heck M. Monomeric G protein-coupled receptor rhodopsin in solution activates its G protein transducin at the diffusion limit. Proc Natl Acad Sci U S A. 2007;104:10859–10864. doi: 10.1073/pnas.0701967104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Szalai B, Hoffmann P, Prokop S, Erdelyi L, Varnai P, Hunyady L. Improved methodical approach for quantitative BRET analysis of G Protein Coupled Receptor dimerization. PLoS One. 2014;9:e109503. doi: 10.1371/journal.pone.0109503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.King C, Sarabipour S, Byrne P, Leahy DJ, Hristova K. The FRET signatures of noninteracting proteins in membranes: simulations and experiments. Biophys J. 2014;106:1309–1317. doi: 10.1016/j.bpj.2014.01.039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Mansoor SE, Palczewski K, Farrens DL. Rhodopsin self-associates in asolectin liposomes. Proc Natl Acad Sci U S A. 2006;103:3060–3065. doi: 10.1073/pnas.0511010103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.James JR, Oliveira MI, Carmo AM, Iaboni A, Davis SJ. A rigorous experimental framework for detecting protein oligomerization using bioluminescence resonance energy transfer. Nat Methods. 2006;3:1001–1006. doi: 10.1038/nmeth978. [DOI] [PubMed] [Google Scholar]
  • 42.Lan TH, Wu G, Lambert NA. Lateral diffusion contributes to FRET from lanthanide-tagged membrane proteins. Biochem Biophys Res Commun. 2015;464:244–248. doi: 10.1016/j.bbrc.2015.06.127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Noorwez SM, Kuksa V, Imanishi Y, Zhu L, Filipek S, Palczewski K, Kaushal S. Pharmacological chaperone-mediated in vivo folding and stabilization of the P23H-opsin mutant associated with autosomal dominant retinitis pigmentosa. J Biol Chem. 2003;278:14442–14450. doi: 10.1074/jbc.M300087200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Chen Y, Jastrzebska B, Cao P, Zhang J, Wang B, Sun W, Yuan Y, Feng Z, Palczewski K. Inherent instability of the retinitis pigmentosa P23H mutant opsin. J Biol Chem. 2014;289:9288–9303. doi: 10.1074/jbc.M114.551713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Hubbard R, Wald G. Cis-trans isomers of vitamin A and retinene in the rhodopsin system. J Gen Physiol. 1952;36:269–315. doi: 10.1085/jgp.36.2.269. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Reig CM, Trujillo JM, Martinez-Gimeno MM, Garcia-Sandoval BM, Calvo TM, Ayuso C, Carballo M. Homozygous and heterozygous gly-188-Arg mutation of the rhodopsin gene in a family with autosomal dominant retinitis pigmentosa. Ophthalmic Genet. 2000;21:79–87. [PubMed] [Google Scholar]
  • 47.Greenberg J, Roberts L, Ramesar R. A rare homozygous rhodopsin splice-site mutation: the issue of when and whether to offer presymptomatic testing. Ophthalmic Genet. 2003;24:225–232. doi: 10.1076/opge.24.4.225.17235. [DOI] [PubMed] [Google Scholar]
  • 48.Ayuso C, Trujillo MJ, Robledo M, Ramos C, Benitez J, Martin-Oses F, del Rio T, Garcia-Sandoval B. Novel rhodopsin mutation in an autosomal dominant retinitis pigmentosa family: phenotypic variation in both heterozygote and homozygote Val137Met mutant patients. Hum Genet. 1996;98:51–54. doi: 10.1007/s004390050158. [DOI] [PubMed] [Google Scholar]
  • 49.Dowling JE. Chemistry of visual adaptation in the rat. Nature. 1960;188:114–118. doi: 10.1038/188114a0. [DOI] [PubMed] [Google Scholar]
  • 50.Liang Y, Fotiadis D, Filipek S, Saperstein DA, Palczewski K, Engel A. Organization of the G protein-coupled receptors rhodopsin and opsin in native membranes. J Biol Chem. 2003;278:21655–21662. doi: 10.1074/jbc.M302536200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Whited AM, Park PS. Nanodomain organization of rhodopsin in native human and murine rod outer segment disc membranes. Biochim Biophys Acta. 2015;1848:26–34. doi: 10.1016/j.bbamem.2014.10.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Rajan RS, Kopito RR. Suppression of wild-type rhodopsin maturation by mutants linked to autosomal dominant retinitis pigmentosa. J Biol Chem. 2005;280:1284–1291. doi: 10.1074/jbc.M406448200. [DOI] [PubMed] [Google Scholar]
  • 53.Opefi CA, South K, Reynolds CA, Smith SO, Reeves PJ. Retinitis pigmentosa mutants provide insight into the role of the N-terminal cap in rhodopsin folding, structure, and function. J Biol Chem. 2013;288:33912–33926. doi: 10.1074/jbc.M113.483032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Athanasiou D, Aguila M, Opefi CA, South K, Bellingham J, Bevilacqua D, Munro PM, Kanuga N, Mackenzie FE, Dubis AM, Georgiadis A, Graca AB, Pearson RA, Ali RR, Sakami S, Palczewski K, Sherman MY, Reeves PJ, Cheetham ME. Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration. Hum Mol Genet. 2017;26:305–319. doi: 10.1093/hmg/ddw387. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supplement
NIHMS981148-supplement.pdf (3.3MB, pdf)

RESOURCES