Skip to main content
Medical Science Monitor: International Medical Journal of Experimental and Clinical Research logoLink to Medical Science Monitor: International Medical Journal of Experimental and Clinical Research
. 2018 Jul 20;24:5035–5040. doi: 10.12659/MSM.907809

The Impact of EGFR Gene Polymorphisms on the Risk of Alzheimer’s Disease in a Chinese Han Population: A Case-Controlled Study

Xiuhong Chen 1,2,A,C,D,E,F,G, Changhai Wang 2,A,B,C,D,E,F,G, Shuangbao Zhou 3,A,B,C,D,E,F, Xueyong Li 4,A,B,C,D,E,F, Lan Wu 4,C,D,E,F,G,
PMCID: PMC6067016  PMID: 30026459

Abstract

Background

The aim of this study was to investigate the association between polymorphisms of the epidermal growth factor receptor (EGFR) gene with the risk of Alzheimer’s disease (AD) in a Chinese Han population.

Material/Methods

A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay was used to genotype 139 patients with AD and 152 healthy control individuals. The Hardy-Weinberg equilibrium (HWE) was analyzed using the chi-squared (χ2) test, and genotype and allele frequencies were compared between the two population groups, using the χ2 test. The odds ratios (ORs) and corresponding 95% confidence intervals (CI) were calculated to express the degree of risk of AD resulting from polymorphisms in the EGFR gene. Linkage disequilibrium among EGFR polymorphisms was analyzed using the Haploview bioinformatics software.

Results

The CC genotype and C allele frequencies of rs730437 were significantly lower in patients with AD compared with the controls (P=0.037), indicating that rs730437 was associated with a reduced risk of AD (CC vs. AA: OR=0.446, 95% CI=0.207–0.960) (C vs. A: OR=0.702, 95% CI=0.502–0.980). The presence of the TT genotype of rs1468727 significantly reduced the risk of AD (P=0.003; OR=0.333, 95% CI=0.160–0.691), and T allele carriers of rs1468727 had a 0.605-fold increased risk of AD. Haplotype A-C-C was significantly correlated with an increased risk of AD (OR=1.922, 95% CI=1.130–3.269).

Conclusions

In a Han Chinese population, EGFR gene polymorphisms, rs730437 and rs1468727 and haplotype A-C-C were shown to be possible protective factors for the development of AD.

MeSH Keywords: Alzheimer Disease; Haplotypes; Polymorphism, Genetic; Receptor, Epidermal Growth Factor

Background

Alzheimer’s disease (AD) is one of the most common causes of dementia in the elderly, accounting for between 60–80% of all cases of dementia [13]. The prevalence of AD increases with age, and increases from 3% in people aged between 65–74 years, to almost 50% in people who are more than 80 years of age [4]. The incidence of AD in women is slightly greater than that in men. Worldwide, with the increasingly aging population, AD has resulted in an increasing burden on families and society [5]. According to previous studies, AD is a multiple-factor disease influenced by genetic and environmental factors [6]. The known environmental factors associated with AD also include a history of infection, brain trauma, drug and other toxicities, and poor nutrition [7,8]. Heredity has an important role in the pathogenesis of AD, and recent studies have identified several genes in the etiology of AD, including APOE, PICALM, BIN1, and TREM2 [9]. However, the genetic mechanisms that are involved in the pathogenesis of AD remain poorly understood.

Epidermal growth factor receptor (EGFR), also known as ErbB-1 or HER1 in humans, is an important transmembrane receptor with tyrosine kinases activity belonging to ErbB family [10]. The EGFR gene has been shown to regulate signaling pathways that include the PI3K-PKC-κB and RAS-RAF-MEK-MAPK pathways, and activate the factors involved in the processes of transcription and translation [11]. Expression of the EGFR gene may participate in several cellular processes, including cell proliferation, survival, differentiation, invasion, adhesion, apoptosis, and repair of cell damage [12,13]. The key ligands of the EGFR protein, epidermal growth factors (EGFs) can control brain development, and neuronal survival and function [14]. Therefore, EGFR and the expression of the EGFR gene and EGFR gene polymorphisms may have a role in neurometabolic disorders, including AD [12,15].

It has previously been confirmed that the encoding gene for EGFR is located on chromosome 7p12.1-12.3 and consists of 30 exons and 29 introns, and several single nucleotide polymorphisms (SNPs) [16]. However, few recently previously published studies have been undertaken on the role of EGFR SNPs and the risk of the development of AD.

The aim of this study was to investigate the association between polymorphisms of the EGFR gene with the risk of AD in a Chinese Han population, and three common EGFR gene SNPs were selected, rs730437, rs3752651, and rs1468727.

Material and Methods

Patients with Alzheimer’s disease (AD) and controls

This study was designed as a case-controlled study and included 139 patients with Alzheimer’s disease (AD) and 152 healthy individuals in the control group. All patients with AD were diagnosed by clinical symptoms and by neuroimaging, in the Department of Neurology of the Inner Mongolia International Mongolian Hospital, according to the diagnostic criteria of the National Institute of Neurological and Communicative Disorders and Stroke (NINCDS) and the Alzheimer’s Disease and Related Disorders Association (ADRDA). The 139 patients with AD included 62 men and 77 women, with an age range of between 59–87 years. The 152 healthy controls were selected by physical examination at the same department and hospital, and included 63 men and 89 women, with an age range of between 56–84 years. The controls were frequency-matched with the patients with AD in age and gender. All the subjects in the study were from the Chinese Han population and were unrelated, non-family members.

This study was supported by the Research Ethics Committee of the Inner Mongolia International Mongolian Hospital. All subjects and their families were informed of the objectives and design of the study. Before blood samples were collected, written informed consent was signed by each subject, or on their behalf by a family member.

DNA extraction

Each subject in the study provided 2 ml of peripheral venous blood, in the early morning, using vacuum tubes that contained the preservative and anticoagulant, ethylenediaminetetraacetic acid (EDTA). The genomic DNA was extracted from whole blood specimens using TIANamp Genomic DNA Kit (Tiangen Biotech, Bejing, China), according to the manufacturer’s instructions. The quality and concentration of genomic DNA were determined using 1.0% agarose gel electrophoresis (AGE) and the NanoVue NanoDrop Plus 2000c (Thermo Scientific). Extracted DNA was stored at –20°C for further studies.

Genotyping

Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was used to genotype each polymorphism in the EGFR gene. PCR primers were designed by Primer Premier 5.0 software and synthesized by the Shanghai Sangon Biotech Co., Ltd. The detailed information of PCR primer sequences is shown in Table 1.

Table 1.

The detailed information of PCR primers sequences.

Position Primer sequence Annealing temperature Restriction enzyme
rs730437 Intron4 For. 5′GTCCCTGTCCCATTCC3′ 55°C AcoI
Rev. 5′ATCCAAAGCCCTGTAGTT3′
rs3752651 Intron13 For. 5′TTATTCTTTGCCCTTGGCTTTTG3′ 56°C HinfI
Rev. 5′TGGCTAGATGAACCATTGATGAC3′
rs1468727 Intron13 For. 5′GATCCAGAAATATTTAGGAGC3′ 56°C MacI
Rev. 5′TTTCATCACCTTGCCTCT3′

The PCR system included a volume of 25.0 μl of the mixture, including a DNA template, forward and reverse primers, PCR Master Mix and ddH2O (sterile, ultra-pure water). The PCR procedure included an initial denaturation at 95°C for 5min, followed by 35 cycles of 94°C denaturation for 30s, annealing for 30s at 55°C or 56°C (Table 1) and extension at 72°C for 30s, and a final extension at 72°C for 7min. PCR products were checked by 1.0% AGE.

The PCR products were digested by restriction enzymes, AcoI, HinfI and MacI, which were used for rs730437, rs3752651, and rs1468727 respectively. Enzyme-digested products were separated by 2.0% AGE to determine the genotype of each polymorphism in the EGFR gene.

Statistical analysis

The genotype frequencies were obtained by direct counting. The genotype distribution of each polymorphism in the patients with AD and the control group were analyzed according to the Hardy-Weinberg equilibrium (HWE) and analyzed using the chi-squared (χ2) test. The differences in genotype and allele frequencies in polymorphism were compared between the Patients with AD and the controls by the chi-squared (χ2) test, as well as haplotype and basic indices. In this study, the risk intensity of developing AD was expressed by the odds ratio (OR) with a corresponding 95% confidence interval (CI). The above data processing was conducted by SPSS version18.0 software. Linkage disequilibrium among EGFR polymorphisms was analyzed using the Haploview bioinformatics software. P<0.05 represented a statistically significant difference.

Results

Clinical information and clinical risk factors for patients with Alzheimer’s disease (AD) compared with the normal case-controlled subjects in the study

The basic characteristics of subjects in the two study groups are summarized in Table 2. The mean ages of the patients with Alzheimer’s disease (AD) and the controls were 74.6±6.8 years and 75.2±6.3 years, respectively. There was no significant difference between the two groups in age or gender (P>0.05). The body mass index (BMI) between the two groups was not significantly different (P=0.283), and smoking history was not a risk factor for AD. Alcohol consumption was significantly associated with the occurrence of AD (P=0.029). In patients with AD, 25.5% of patients suffered from diabetes mellitus, while the prevalence of diabetes mellitus was 13.8% in healthy controls (P=0.014). Hypertension in patients in AD was also significantly increased compared with the controls (33.1% vs. 20.1%) (P=0.021), and hypercholesterolemia was also significantly associated with AD (P=0.037).

Table 2.

The basic characteristics of subjects in the case and control groups.

Index Case, n=139 Control, n=152 P
Gender Male/Female 62/77 63/89 0.587
Age/years The range 59–87 56–84
Mean age 74.6±6.8 75.2±6.3 0.436
Body mass index (kg/m2) 23.1±3.4 23.6±3.7 0.283
Smoking status/% 57/41.0 48/31.6 0.212
Alcohol consumption/% 46/33.1 33/21.7 0.029
Diabetes/% 35/25.2 21/13.8 0.014
Hypertension/% 46/33.1 32/20.1 0.021
Hypercholesterolemia/% 29/20.9 18/11.8 0.037

The Hardy-Weinberg equilibrium (HWE) in the control population

The status of the Hardy-Weinberg equilibrium (HWE) was tested in the control group and the results showed that the genotype distribution of each polymorphism of the EGFR gene, rs730437, rs3752651, and rs1468727, in the control group all conformed to HWE (P=0.135, 0.209, and 0.719, respectively) in the present study, indicating that this population was a representative group.

The genotype and allele distributions of EGFR gene polymorphisms in the patients with AD and the control group

The genotype and allele frequencies of EGFR gene polymorphisms in the patients with AD compared with the control groups are shown in Table 3. The CC genotype and C allele frequencies of rs730437 were significantly lower in patients with AD compared with the controls (P=0.037), and compared with AA genotype and A allele, respectively, indicating that rs730437 was significantly associated with a reduced risk of AD (CC vs. AA: OR=0.446, 95% CI=0.207–0.960) (C vs. A: OR=0.702, 95% CI=0.502–0.980). The TT genotype and T allele frequencies of rs1468727 were also significantly different between the two groups (P=0.003), indicating that rs1468727 significantly reduced the susceptibility of AD in the studied population (TT vs. CC: OR=0.333, 95% CI=0.160–0.691) (T vs. C: OR=0.605, 95% CI=0.433–0.844). However, there was no significant association between the rs3752651 polymorphism and risk of AD (P>0.05).

Table 3.

The genotype and allele distribution difference of EGFR polymorphisms between the case and control groups.

Case, n=139/% Control, n=152/% OR (95%CI) P PHWE
rs730437 0.135
 AA 54/38.85 43/28.29 Ref.
 AC 71/51.08 84/55.26 0.673 (0.404, 1.121) 0.128
 CC 14/10.07 25/16.45 0.446 (0.207, 0.960) 0.037
 A 179/64.39 170/55.92 Ref.
 C 99/35.61 134/44.08 0.702 (0.502, 0.980) 0.037
rs3752651 0.209
 TT 102/73.38 124/81.58 Ref.
 CT 32/23.02 25/16.45 1.556 (0.867, 2.793) 0.137
 CC 5/3.60 3/1.97 2.026 (0.473, 8.682) 0.333
 T 236/84.89 273/89.80 Ref.
 C 42/15.11 31/10.20 1.567 (0.955, 2.573) 0.074
rs1468727 0.719
 CC 56/40.29 41/26.97 Ref.
 CT 68/48.92 78/51.32 0.638 (0.380, 1.071) 0.088
 TT 15/10.79 33/21.71 0.333 (0.160, 0.691) 0.003
 C 180/64.75 160/52.63 Ref.
 T 98/35.25 144/47.37 0.605 (0.433, 0.844) 0.003

HWE – Hardy-Weinberg equilibrium; Ref. – Reference; ‘–’ – indicated no available data.

The haplotype analysis of EGFR gene polymorphisms and the occurrence of AD

In the current study, the linkage disequilibrium of EGFR polymorphisms was also analyzed, and strong linkage disequilibrium was found. A total of three haplotypes were identified and analyzed for their effect on the risk of AD; other haplotypes were excluded due to their low frequency. The three haplotypes were A-T-T, A-C-C, and C-T-C, and their frequencies are shown in Table 4. The A-C-C haplotype had a significantly increased frequency in the group of patients with AD compared with the control group (15.11% vs. 10.20%) (P=0.015), compared with haplotype A-T-T (35.25% vs. 45.72%), indicating that the A-C-C haplotype was a risk factor for the development of AD (OR=1.922, 95% CI=1.130–3.269).

Table 4.

The haplotype analysis of EGFR polymorphisms in the occurrence of AD.

Haplotype Site1-site2-site3 Case, 2n=278/% Control, 2n=304/% OR (95%CI) P
A-T-T 98/35.25 139/45.72 Ref.
A-C-C 42/15.11 31/10.20 1.922 (1.130, 3.269) 0.015
C-T-C 99/35.61 129/42.43 1.089 (0.753, 1.573) 0.651

Site1 – rs730437; site2 – rs3752651; site3 – rs1468727.

Discussion

Alzheimer’s disease (AD) is a common and irreversible neurodegenerative disease that is characterized by progressive cognitive impairment, resulting in an increasing degree of stress and economic burden to patients and their families. The pathogenesis of AD is likely to involve the interaction between genetic and environmental factors, and these factors are recently becoming recognized. In 2016, Killin and colleagues undertook a systematic review of published studies on environmental factors and the risk of developing dementia, including AD, and found six environmental factors associated with the development of AD, including air quality, toxicity from heavy metals and other metals, lack of trace elements, occupational-related exposure to neurotoxins, and miscellaneous environmental factors [17]. Also, lifestyle and poor diet were identified as risk factors for AD [18]. Baumgaertel and colleagues showed that levels of education and the development of the hippocampus reduced the risk of developing AD [19]. Recently, genetic factors have also been discovered to be associated with AD, including expression of the APOE, PSEN1, PSEN2, and APP genes [20]. However, the identification of the specific environmental and genetic factors associated with the development of AD remains unclear. Therefore, the aim of this study was to investigate the association between polymorphisms of the epidermal growth factor receptor (EGFR) gene with the risk of AD in a Chinese Han population.

The EGFR gene encodes a transmembrane glycoprotein that is one of four members in HER/ErbB family which belongs to tyrosine kinases receptors and activates multiple signaling molecules and pathways that participate in a range of cellular processes, including cell proliferation, differentiation, survival, adhesion, and apoptosis [21]. Activated EGFR combines with ligands to initiate intracellular signal transduction, and mitogen-activated protein kinase (MAPK), an important downstream pathway that has been shown to be involved in the pathogenesis of AD [22]. In 2016, Lee and colleagues showed that the activation or downregulation of EGFR signaling pathways was associated with several human diseases, including AD [23]. The expression of presenilin 1 (PS-1) has been shown to be related with early-onset AD, and has an influence on the expression and function of EGFR, which can regulate the development, survival and function of neurons in the brain, as PS-1-null mice have been shown to die of neuronal abnormalities at birth, indicating that PS1 and EGFR may have roles in the development and function of the brain [14].

Recently, studies on the role of single nucleotide polymorphisms (SNPs) have become an important means of exploring individual susceptibility to disease. Several SNPs have been previously reported to be associated with an increased risk AD, but few reports have focused on the effects of EGFR SNPs in AD. Also, several SNPs have been identified in the EGFR gene, including rs1050171, rs730437 and rs11506105, but they have not previously been studied in AD [24,25]. Rs730437 is a mutation in intron 4 of the EGFR gene with the alteration of A/C, which has been shown to be involved in the occurrence of glioma in several studies that have included different populations [24,25]. Rs3752651 is located in intron 13 of the EGFR gene and affects the development of multiple diseases, including glioma, colon cancer, and rectal cancer [25,26]. Rs1468727 occurs as a mutation in intron 13 of the EGFR gene as well, but is not likely to influence the function of EGFR, but takes part in disease initiation through its close linkage with other functional polymorphisms [16].

In the present study, the genetic association of EGFR rs730437, rs3752651, and rs1468727 polymorphisms were studied in association with the risk of AD in a Chinese Han population. Alcohol consumption was a risk factor for developing AD in this population, but a history of smoking and body mass index (BMI) were not. Diabetes, hypertension, and hypercholesterolemia were risk factors for AD when patients with AD were compared with healthy people. For polymorphisms in the EGFR gene, rs730437 was significantly associated with a decreased risk of developing AD in both the mutant genotype and allele. Similarly, the mutant genotype or allele of rs1468727 carriers had a significantly lower risk of AD compared with individuals with the homozygous wild-type genotype and allele. However, the rs3752651 EGFR polymorphism was not a factor in the susceptibility to AD in the population in this study. Also, carriers of the A-C-C haplotype had an increased risk of AD when compared with carriers of haplotype A-T-T. This study is the first to show the genetic effects of EGFR gene polymorphisms on the development of AD development in a Chinese Han population.

In spite of the encouraging results, this study had several limitations. Firstly, the sample size was relatively small. Second, the single study population of Han Chinese could not show the reasons for any regional diversity of the occurrence of AD occurrence and the diversity of occurrence of the EGFR gene polymorphisms associated with AD. Third, an interaction analysis was not included in the present study, and the molecular mechanisms for the functional roles of the EGFR gene in the etiology of AD was not explored in this study. Of note, it has previously been reported that the regulatory sequences of the EGFR gene were located within the 5-flanking region and intron regions [27]. In this study, all of the selected SNPs were located in intron regions of the EGFR gene. However, whether these further gene polymorphisms could influence transcriptional activity of the EGFR gene or relevant signaling pathways on the etiology of AD remain poorly understood. Therefore, further controlled studies are required that have a more detailed molecular approach in their design, are on a larger scale, involve multiple centers and populations to verify the results of this study and to explore further the molecular mechanisms involved in AD.

Conclusions

In this study, in a population of Han Chinese, the rs730437 and rs1468727 polymorphisms of the EGFR gene were shown to be protective factors for Alzheimer’s disease (AD). Carriers of the A-C-C haplotype had an increased risk of AD. Further large-scale, multicenter, controlled clinical studies are required to explore these preliminary findings.

Footnotes

Conflict of interest

None.

Source of support: Departmental sources

References

  • 1.Mayeux R, Stern Y. Epidemiology of Alzheimer’s disease. Cold Spring Harb Perspect Med. 2012;2(8) doi: 10.1101/cshperspect.a006239. pii: a006239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Nowrangi MA, Rao V, Lyketsos CG. Epidemiology, assessment, and treatment of dementia. Psychiatr Clin North Am. 2011;34(2):275–94. doi: 10.1016/j.psc.2011.02.004. [DOI] [PubMed] [Google Scholar]
  • 3.Reitz C, Brayne C, Mayeux R. Epidemiology of Alzheimer disease. Nat Rev Neurol. 2011;7(3):137–52. doi: 10.1038/nrneurol.2011.2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Castellani RJ, Rolston RK, Smith MA. Alzheimer disease. Dis Mon. 2010;56(9):484–546. doi: 10.1016/j.disamonth.2010.06.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Sosa-Ortiz AL, Acosta-Castillo I, Prince MJ. Epidemiology of dementias and Alzheimer’s disease. Arch Med Res. 2012;43(8):600–8. doi: 10.1016/j.arcmed.2012.11.003. [DOI] [PubMed] [Google Scholar]
  • 6.Panpalli AM, Karaman Y, Guntekin S, Ergun MA. Analysis of genetics and risk factors of Alzheimer’s Disease. Neuroscience. 2016;325:124–31. doi: 10.1016/j.neuroscience.2016.03.051. [DOI] [PubMed] [Google Scholar]
  • 7.Ting SK, Hao Y, Chia PS, et al. Clinicopathological correlation of psychosis and brain vascular changes in Alzheimer’s disease. Sci Rep. 2016;6:20858. doi: 10.1038/srep20858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Athanasopoulos D, Karagiannis G, Tsolaki M. Recent findings in Alzheimer disease and nutrition focusing on epigenetics. Adv Nutr. 2016;7(5):917–27. doi: 10.3945/an.116.012229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kanatsu K, Tomita T. Molecular mechanisms of the genetic risk factors in pathogenesis of Alzheimer disease. Front Biosci (Landmark Ed) 2017;22:180–92. doi: 10.2741/4480. [DOI] [PubMed] [Google Scholar]
  • 10.Nie W, Tang L, Zhang H, et al. Structural analysis of the EGFR TK domain and potential implications for EGFR targeted therapy. Int J Oncol. 2012;40(6):1763–69. doi: 10.3892/ijo.2012.1356. [DOI] [PubMed] [Google Scholar]
  • 11.Guo H, Xing Y, Mu A, et al. Correlations between EGFR gene polymorphisms and pleural metastasis of lung adenocarcinoma. Onco Targets Ther. 2016;9:5257–70. doi: 10.2147/OTT.S97907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Avraham R, Yarden Y. Feedback regulation of EGFR signalling: Decision making by early and delayed loops. Nat Rev Mol Cell Biol. 2011;12(2):104–17. doi: 10.1038/nrm3048. [DOI] [PubMed] [Google Scholar]
  • 13.Murillo-Carretero M, Torroglosa A, Castro C, et al. S-Nitrosylation of the epidermal growth factor receptor: A regulatory mechanism of receptor tyrosine kinase activity. Free Radic Biol Med. 2009;46(4):471–79. doi: 10.1016/j.freeradbiomed.2008.10.048. [DOI] [PubMed] [Google Scholar]
  • 14.Bruban J, Voloudakis G, Huang Q, et al. Presenilin 1 is necessary for neuronal, but not glial, EGFR expression and neuroprotection via gamma-secretase-independent transcriptional mechanisms. FASEB J. 2015;29(9):3702–12. doi: 10.1096/fj.15-270645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Siddiqui S, Fang M, Ni B, et al. Central role of the EGF receptor in neurometabolic aging. Int J Endocrinol. 2012;2012:739428. doi: 10.1155/2012/739428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Li B, Zhao W, Li J, et al. Effect of epidermal growth factor receptor gene polymorphisms on prognosis in glioma patients. Oncotarget. 2016;7(39):63054–64. doi: 10.18632/oncotarget.10666. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Killin LO, Starr JM, Shiue IJ, Russ TC. Environmental risk factors for dementia: A systematic review. BMC Geriatr. 2016;16(1):175. doi: 10.1186/s12877-016-0342-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Borras Blasco C, Vina Ribes J. [Neurophysiology and ageing. Definition and pathophysiological foundations of cognitive impairment]. Rev Esp Geriatr Gerontol. 2016;51(S1):3–6. doi: 10.1016/S0211-139X(16)30136-6. [in Spanish] [DOI] [PubMed] [Google Scholar]
  • 19.Baumgaertel J, Haussmann R, Gruschwitz A, et al. Education and genetic risk modulate hippocampal structure in Alzheimer’s disease. Aging Dis. 2016;7(5):553–60. doi: 10.14336/AD.2016.0305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Jamal S, Goyal S, Shanker A, Grover A. Computational screening and exploration of disease-associated genes in Alzheimer’s disease. J Cell Biochem. 2017;118(6):1471–79. doi: 10.1002/jcb.25806. [DOI] [PubMed] [Google Scholar]
  • 21.Liu C, Xu X, Zhou Y. Association between EGFR polymorphisms and the risk of lung cancer. Int J Clin Exp Pathol. 2015;8(11):15245–49. [PMC free article] [PubMed] [Google Scholar]
  • 22.Liu QF, Jeong H, Lee JH, et al. Coriandrum sativum suppresses Abeta42-induced ROS increases, glial cell proliferation, and ERK activation. Am J Chin Med. 2016;44(7):1325–47. doi: 10.1142/S0192415X16500749. [DOI] [PubMed] [Google Scholar]
  • 23.Lee MY, Nam KH, Choi KC. iRhoms; Its functions and essential roles. Biomol Ther (Seoul) 2016;24(2):109–14. doi: 10.4062/biomolther.2015.149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Wang X, Zhang H, Wang D, Li X. Association of genetic polymorphisms of EGFR with glioma in a Chinese population. Genet Test Mol Biomarkers. 2015;19(1):59–62. doi: 10.1089/gtmb.2014.0228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Andersson U, Schwartzbaum J, Wiklund F, et al. A comprehensive study of the association between the EGFR and ERBB2 genes and glioma risk. Acta Oncol. 2010;49(6):767–75. doi: 10.3109/0284186X.2010.480980. [DOI] [PubMed] [Google Scholar]
  • 26.Poole EM, Curtin K, Hsu L, et al. Genetic variability in EGFR, Src and HER2 and risk of colorectal adenoma and cancer. Int J Mol Epidemiol Genet. 2011;2(4):300–15. [PMC free article] [PubMed] [Google Scholar]
  • 27.Araújo A, Ribeiro R, Azevedo I, et al. Genetic polymorphisms of the epidermal growth factor and related receptor in non-small cell lung cancer – a review of the literature. Oncologist. 2007;12(2):201–10. doi: 10.1634/theoncologist.12-2-201. [DOI] [PubMed] [Google Scholar]

Articles from Medical Science Monitor : International Medical Journal of Experimental and Clinical Research are provided here courtesy of International Scientific Information, Inc.

RESOURCES