Skip to main content
NCBI home page
Toxicological Sciences logoLink to Toxicological Sciences
. 2017 Feb 10;157(1):222–234. doi: 10.1093/toxsci/kfx032

Regulation of Nitrogen Mustard-Induced Lung Macrophage Activation by Valproic Acid, a Histone Deacetylase Inhibitor

Alessandro Venosa *, James G Gow *, LeRoy Hall †, Rama Malaviya *, Andrew J Gow *, Jeffrey D Laskin ‡, Debra L Laskin *,1
PMCID: PMC6075217  PMID: 28184907

Abstract

Nitrogen mustard (NM)-induced lung injury is associated with an accumulation of proinflammatory/cytotoxic M1 and antiinflammatory/wound repair M2 macrophages, which have been implicated in tissue injury and repair. Herein, we analyzed the effects of valproic acid (VPA), a histone deacetylase (HDAC) inhibitor with antiinflammatory and antioxidant activity, on lung macrophages responding to NM. Treatment of rats with NM (0.125 mg/kg, i.t.) resulted in structural alterations in the lung and a macrophage-rich inflammatory cell infiltrate, at 3 d and 7 d. This was accompanied by expression of PCNA, a marker of proliferation, and CYPb5, HO-1, and MnSOD, markers of oxidative stress. Administration of VPA (300 mg/kg/day; i.p.), beginning 30 min after NM, reduced increases in PCNA, CYPb5, HO-1, and MnSOD. This was associated with increases in immature CD11b+CD43+ M1 macrophages in the lung, and decreases in mature CD11b+CD43− M2 macrophages 3 d post NM, suggesting delayed maturation and phenotypic switching. VPA also attenuated NM-induced increases in lung iNOS+ and CCR2+ M1 macrophages, a response correlated with downregulation of NOS2, IL12B, PTGS2, MMP-9, and CCR2 expression. Conversely, numbers of CD68+, CD163+ , and ATR-1α+ M2 macrophages increased after VPA, along with the expression of IL10, ApoE, and ATR-1A. NM exposure resulted in increased HDAC activity and upregulation of HDAC2 and acetylated H3K9 in the lung. Whereas VPA blunted the effects of NM on HDAC2 expression, histone H3K9 acetylation increased. These data suggest that alterations in the balance between histone acetylases and deacetylases contribute to lung macrophage maturation and activation following NM exposure.

Keywords: nitrogen mustard, macrophages, inflammation, lung, valproic acid.

Nitrogen mustard (NM) is a bifunctional alkylating agent known to cause acute lung injury characterized by hemorrhage, edema, and inflammation. This progresses to bronchiolitis, emphysema and fibrosis (Malaviya et al., 2012, 2016; Sunil et al., 2011). These pathologic responses are a consequence of oxidative and nitrosative damage, epithelial necrosis, and vascular disruption (Weinberger et al., 2016). In earlier studies, we showed that NM-induced injury and fibrosis are associated with a persistent increase in macrophages in the lung (Malaviya et al., 2012; Venosa et al., 2016). These cells were found to consist of two distinct subpopulations that sequentially accumulate in the lung: proinflammatory/cytotoxic M1 macrophages and antiinflammatory/wound repair M2 macrophages. Whereas overactive M1 macrophages promote redox stress and aggravate lung injury, hyper-responsive M2 macrophages contribute to the development of fibrosis (Laskin et al., 2011; Martinez and Gordon, 2014).

Macrophage activity is controlled, in part, by epigenetic alterations in the DNA including post-translational modifications of histone proteins, which lead to changes in gene expression and phenotype (Jaenisch and Bird, 2003; Shanmugam and Sethi, 2013). Of particular interest is the acetylated state of histones, which has emerged as an important regulator of macrophage activation (Ivashkiv, 2013). Whereas acetylation of lysine (K) residues 9, 14, or 27 on histone 3 (H3K9, H3K14, or H3K27) by histone acetylases (HAT)s is associated with transcriptional activation of inflammatory genes and the development of an M1 macrophage phenotype, deacetylation of these lysine residues by histone deacetylases (HDAC)s correlates with transcriptional repression, downregulation of inflammatory genes, and M2 macrophage activation (Chandran et al., 2015; Mullican et al., 2011). Evidence suggests that macrophage gene expression during acute and chronic inflammatory responses resulting in M1 or M2 phenotypic activation is controlled by the relative activity of HATs and HDACs (Ishii et al., 2009; Ivashkiv, 2013; Kittan et al., 2013).

Valproic acid (VPA) is a short-chain aliphatic organic acid used clinically as a mood stabilizer and antidepressant, and for treatment of migraine headaches (Ueda and Willmore, 2000). Recent studies have shown that VPA also exerts antiinflammatory and antioxidant activity, which is thought to be due to its ability to inhibit HDACs, preventing deacetylation of non-histone proteins important in macrophage activation (Cavasin et al., 2012; Rahman et al., 2004; Wu et al., 2015). Thus, in models of acute lung injury, pulmonary hypertension, allergic airway disease and sepsis, VPA is effective in blunting production of proinflammatory cytokines, oxidative stress, and tissue injury (Cetinkaya et al., 2015; Fukudome et al., 2012; Ji et al., 2013; Lan et al., 2015; Royce et al., 2011; Shang et al., 2010; Wu et al., 2012, 2015). The fact that inflammation and oxidative stress are important contributors to NM-induced lung disease pathogenesis prompted us to assess the ability of VPA to mitigate these responses. Our findings that VPA suppressed NM-induced oxidative stress, lung cell proliferation, and proinflammatory/cytotoxic M1 macrophage maturation and activation, while promoting antiinflammatory/wound repair M2 macrophage activation, suggest that histone acetylase/deacetylase balance is important in regulating inflammatory responses in the lung during the pathogenic response to NM.

MATERIALS AND METHODS

Animals and treatments

Male Wistar rats (8 week, 225–250 g) were purchased from Harlan Laboratories (Indianapolis, Indiana) and maintained in an American Association for Laboratory Animal Care approved animal care facility. Animals were housed in filter top microisolation cages and provided food and water ad libitum. Animals received humane care in compliance with the guidelines outlined in the Guide for the Care and Use of Laboratory Animals, published by the National Institutes of Health. Animals were anesthetized with 2.5% isofluorane, and then administered PBS or NM (0.125 mg/kg, mechlorethamine hydrochloride, Sigma-Aldrich, St. Louis, Missouri) intratracheally as previously described (Sunil et al., 2011). All instillations were performed by David Reimer, D.V.M., Comparative Medicine Resources, Rutgers University. NM was prepared immediately before administration in a designated room under a chemical hood following Rutgers University Environmental Health and Safety guidelines. Animals were treated (i.p.) with VPA (300 mg/kg, Sigma-Aldrich, St. Louis, MO) or vehicle control (PBS) once a day beginning 30 min after PBS or NM.

Bronchoalveolar (BAL) and lung cell collection

Animals were euthanized by i.p. injection of Sleepaway (50 mg/kg, Fort Dodge Animal Health, Fort Dodge, Iowa) 3 d or 7 d after administration of PBS or NM. BAL was collected by slowly instilling and withdrawing 10 ml of ice cold (4 °C) PBS into the lung through a cannula inserted into the trachea. BAL was centrifuged (300×g, 8 min) and cell pellets resuspended in 1 ml of PBS for differential analysis and viable cell counting using a hemocytometer with trypan blue dye exclusion. Cell-free supernatants were assayed for protein content using a BCA protein assay kit (Pierce Biotechnologies Inc., Rockford, IL) with bovine serum albumin as the standard. In some experiments, following BAL collection, the lung was removed and 10 ml of ice cold PBS slowly instilled and withdrawn through the cannula, while gently massaging the tissue; this procedure was repeated four times. The lavage fluid was combined with the initial BAL cell suspension, centrifuged (300×g, 8 min), resuspended in 10 ml PBS and the cells enumerated. Differential staining demonstrated that 86%–94% of BAL cells were macrophages.

Histology and immunohistochemistry

Following BAL collection, the lung was removed, fixed with 2% paraformaldehyde and paraffin-embedded. For histological analysis, sections (5 μm) were stained with hematoxylin and eosin. Histopathological changes were assessed blindly by a veterinary pathologist (LeRoy Hall, DVM, PhD) as previously described (Malaviya et al., 2010). Semiquantitative grades (0–4) were assigned to histological sections, with grade 0 indicating no changes; grade 1, minimal or small changes; grade 2, medium changes, grade 3, moderate changes, and grade 4, extensive changes, relative to PBS controls. For immunostaining, sections were deparaffinized with xylene followed by decreasing concentrations of ethanol (100%–50%) and then water. After antigen retrieval using citrate buffer (10.2 mM sodium citrate, 0.05% Tween 20, pH 6.0, 10 min) and quenching of endogenous peroxidase with 3% hydrogen peroxide in methanol (30 min), sections were incubated for 2 h at room temperature with 10% serum to block nonspecific binding. This was followed by overnight incubation at 4 °C in a humidified chamber with rabbit monoclonal anti-CD11b (1:500, Abcam, Cambridge, MA), anti-inducible nitric oxide synthase (iNOS, 1:800, Abcam, Cambridge, Massachusetts), mouse monoclonal anti-CD68 (1:400, AbD Serotec., Raleigh, NC), mouse monoclonal anti-CD163 (1:400, AbD Serotec), rabbit polyclonal anti-histone deacetylase 2 (HDAC2, 1:150, Santa Cruz Biotechnologies, Dallas, Texas), rabbit monoclonal anti-acetylated H3K9 (H3K9Ac, 1:350, Cell Signaling Technology, Danvers, Massachusetts), rabbit monoclonal anti-CCR2 (1:400, Abcam), rabbit polyclonal anti-angiotensin-2 receptor 1α (ATR-1α, 1:500, Abcam), rabbit monoclonal anti-cytochrome b5 (CYPb5, 1:1500, Abcam), rabbit polyclonal anti-heme oxygenase-1 (HO-1, 1:250, Enzo Life Sciences, Farmingdale, NY), rabbit polyclonal anti-manganese superoxide dismutase (MnSOD, 1:150, Enzo Life Sciences), or rabbit polyclonal anti-proliferating cell nuclear antigen (PCNA, 1:800, Abcam) antibody, or the appropriate serum/IgG controls diluted in blocking buffer. Sections were then washed and incubated at room temperature for 30 min with biotinylated secondary antibody (Vectastain Elite ABC kit, Vector Labs, Burlingame, CA). Binding was visualized using a Peroxidase Substrate Kit DAB (Vectastain). In previous studies, we demonstrated that lavaging the lung prior to histologic sectioning had no significant effect on the architecture of the lung or on macrophages present in the tissue (Venosa et al., 2016).

Flow cytometry

Lung cells, collected by BAL and tissue massage, were incubated with anti-rat-FcRII/III antibody (Fc block, BD Biosciences) for 10 min at 4 °C to block nonspecific binding. This was followed by 30 min incubation with AlexaFluor (AF) 488-conjugated anti-CD11b and AF647-conjugated anti-CD43 antibodies or appropriate isotype controls (0.25 µg/106 cells, R&D Systems, Minneapolis, MN), and then with eFluor780-conjugated viability dye (eBiosciences, San Diego, CA) for 30 min. Cells were fixed in 2% paraformaldehyde and analyzed using a Beckman Coulter Gallios flow cytometer (Brea, CA). Cell populations were identified based on forward and side scatter followed by doublet discrimination of live cells. The percentage of CD11b−CD43−, CD11b + CD43+, and CD11b + CD43− cells was calculated from forward and side scatter gating of live singlets. Data were analyzed using Beckman Coulter Kaluza flow cytometry software.

mRNA isolation and PCR analysis

Total mRNA was extracted from lung cells collected by BAL and tissue massage using an RNeasy Mini kit (Qiagen, Valencia, CA). RNA was reverse transcribed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA). Standard curves were generated using serial dilutions from pooled cDNA samples. Real time PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems) on an Applied Biosystems 7300HT thermal cycler. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used to normalize the data. Full-length coding sequences were obtained from the NCBI Gene Bank. Primers were designed using Primer Express 3.0 software (Applied Biosystems). The following forward and reverse primers were used: GAPDH, CCTGGAGAAACCTGCCAAGTAT and CTCGGCCGCCTGCTT; nitric oxide synthase (NOS)2, TGGTGAAAGCGGTGTTCTTTG and ACGCGGGAAGCCATGA; prostaglandin-endoperoxide synthase (PTGS2), TGCTCACTTTGTTGAGTAGTCATTCAC and CATTCCTTCCCCCAGCAA; interleukin (IL)12B, GCACACTGGAGGCCTGCTT and TTAGTAGCCAGGCAACTCTCATTCT; matrix metalloproteinase-9 (MMP-9), ATTCTCGGTGGACCAATGACGTG and AATGTCCATGTTAACGGG; IL10, CCCAGAAATCAAGGAGCATTTG and CAGCTGTATCCAGAGGGTCTTCA; apolipoproteinE (ApoE), TCCATTGCCTCCACCACAGT and GGCGTAGGTGAGGGATGATC; angiotensin receptor (ATR)-1Α, CCATTGTCCACCCGATGAA and TGACTTTGGCCACCAGCAT; CCR2, TGACAGAGACTCTTGGAATGACACA and CTCACCAACAAAGGCATAAATGAT; CCL2, CCACTCACCTGCTGCTACTCAT and TCTCCAGCCGACTCATTGG; CX3CR1, GGAGCAGGCAGGACAGCAT and CCCTCTCCCTCGCTTGTGTA.

Measurement of HDAC activity

HDAC activity was analyzed in nuclear extracts (4 μg), prepared from lung macrophages collected by BAL and massage, using a colorimentric EpiQuick HDAC assay kit according to the manufacturer’s protocol (Epigentek Group Inc., Farmingdale, New York). The assay was performed three times in triplicate.

Statistical analysis

Flow cytometry, BAL cell, BAL protein, and PCR data were analyzed using Kruskal–Wallis non-parametric one-way ANOVA followed by the Mann–Whitney post-hoc test. Histological scoring data were analyzed using Kruskal–Wallis non-parametric one-way ANOVA followed by Mann–Whitney Rank Sum post-hoc test. HDAC activity data were analyzed by one-way ANOVA followed by unpaired t-test. All experiments were repeated at least three times. A P value of ≤ .05 was considered statistically significant.

RESULTS

VPA reduces NM-induced cellular proliferation, inflammation, and oxidative stress

Consistent with previous reports (Malaviya et al., 2012; Sunil et al., 2014; Venosa, et al., 2016), NM was found to induce significant histopathological changes in the lung. Thus, within 3 d of exposure, perivascular edema and hemorrhage were noted, along with an accumulation of cellular debris (Figure 1 and Table 1). This was associated with a marked infiltration of inflammatory cells, which were comprised predominantly of macrophages (Malaviya et al., 2012; Venosa et al., 2016); these persisted in the tissue for at least 7 d. At 7 d post-NM, bronchial epithelial cell and goblet cell hyperplasia, alveolar septal thickening, bronchiolization of the alveolar epithelium, and loss of alveolar architecture were also observed. These structural alterations were associated with proliferation of macrophages, as well as epithelial cells, as measured by PCNA staining, which was evident at 3 d and 7 d post-NM (Figure 2 and Table 2). NM exposure also resulted in increases in BAL protein and cell content, indicative of alveolar epithelial barrier disruption and lung inflammation (Bhalla, 1999) (Figure 3). Expression of CYPb5, HO-1, and MnSOD, markers of oxidative stress (Kinnula et al., 2005; Menoret et al., 2012), was also increased after NM exposure, most notably at 3 d (Figure 4, Table 2 and Supplementary Figure 1). Treatment of rats with VPA beginning 30 min after NM was found to dampen the effects of NM on PCNA expression, most prominently at 7 d (Figure 2 and Table 2). NM-induced increases in BAL cell content and expression of HO-1, MnSOD and CYPb5 expression were also reduced by VPA at 3 d post-NM (Figs. 3 and 4, Table 2, and Supplementary Figure 1). In contrast, VPA had no effect on NM-induced increases in BAL protein levels or on structural alterations in the lung.

FIG. 1.

FIG. 1

Open in a new tab

Effects of VPA on NM-induced structural alterations in the lung. Sections, prepared 3 d and 7 d after exposure of rats to PBS (CTL) or NM, followed by vehicle (Veh) or VPA, were stained with H & E. Original magnification, ×200 (upper panels) and ×600 (lower panels). Representative sections from the following numbers of rats/treatment group are shown: CTL/Veh, n = 3; NM 3 d/Veh, n= 4, NM 7 d/Veh, n= 4, CTL/VPA, n= 3, NM 3 d/VPA, n = 5, NM 7 d/VPA, n = 5.

TABLE 1.

Effects of VPA on NM-Induced Lung Pathology

Histopathological Scores CTL
 NM (3 d)
 NM (7 d)
Veh VPA Veh VPA Veh VPA
Mixed cell infiltration 0 0 3* 4*,# 2 3*
Edema 0 0 2 2 2 2
Bronchio-alveolar hyperplasia 0 0 2 3* 3* 3*
Mesothelial proliferation 0 0 2 1 1 1
Bronchioectasis 0 0 1 1 3* 2*
Emphysema 0 0 1 1 2* 2*
Alveolar epithelial metaplasia 0 0 1 1 1 1
Fibroplasia 0 0 2* 2* 2* 2*
Open in a new tab

Lung sections, prepared 3 d and 7 d after exposure of rats to PBS (CTL) or NM followed by vehicle (Veh) or VPA, were stained with H&E and scored for histopathologic changes. GRADE 0 = no injury; GRADE 1 = minimal /very small; GRADE 2 = slight/small; GRADE 3 = moderate; GRADE 4 = extensive. Values represent the median histopathology scores. Data were analyzed using Kruskal-Wallis non-parametric one-way ANOVA followed by Mann-Whitney Rank Sum post-hoc analysis. Representative sections from the following numbers of rats/treatment group were analyzed: CTL/Veh, n=3; NM 3 d/Veh, n= 4, NM 7 d/Veh, n= 4, CTL/VPA, n= 3, NM 3 d/VPA, n=5, NM 7 d/VPA, n=5. For each rat, all five lobes of the lung were analyzed.

*Significantly different (P ≤ .05) from CTL.

#Significantly different (P ≤ .05) from vehicle rats.

FIG. 2.

FIG. 2

Open in a new tab

Effects of VPA on NM-induced lung cell proliferation. Sections, prepared 3 d and 7 d after exposure of rats to PBS (CTL) or NM, followed by vehicle (Veh) or VPA, were immunostained with antibody to PCNA. Binding was visualized using a Vectastain kit. Original magnification, ×200 (upper panels) and ×600 (lower panels). Representative sections from 3 to 4 rats/treatment group are shown.

TABLE 2.

Semi-Quantitative IHC Scoring

Positive Cells (%)
 Staining Intensity
Protein Time Veh VPA Veh VPA
PCNA CTL 0 ± 0 0 ± 0 0 0
NM 3d 29 ± 11* 37 ± 9* 1 2*
NM 7d 44 ± 6* 5 ± 2# 1 0
CD11b CTL 0 ± 0 0 ± 0 0 0
NM 3d 72 ± 9* 67 ± 6* 2* 2*
NM 7d 88 ± 14* 68 ± 11* 3* 2*
iNOS CTL 0 ± 0 0 ± 0 0 0
NM 3d 59 ± 16* 28 ± 12*.# 2* 1
NM 7d 65 ± 12* 23 ± 8*,# 2 1
CCR2 CTL 5 ± 5 2 ± 1 0 0
NM 3d 78 ± 12* 69 ± 14* 2* 2*
NM 7d 46 ± 9* 40 ± 13* 1 1
CD68 CTL 84 ± 6 88 ± 5 2 2
NM 3d 55 ± 10* 79 ± 11# 2 2
NM 7d 85 ± 5 92 ± 6 3 3
CD163 CTL 0 ± 0 0 ± 0 0 0
NM 3d 21 ± 13 61 ± 15*,# 2 2
NM 7d 82 ± 6* 85 ± 12* 2* 2*
ATR-1α CTL 0 ± 0 0 ± 0 0 0
NM 3d 69 ± 11* 87 ± 9*,# 1* 3*,#
NM 7d 34 ± 13* 8 ± 2# 1 0
CYPb5 CTL 0 ± 0 0 ± 0 0 0
NM 3d 95 ± 5* 5 ± 5# 2* 0
NM 7d 28 ± 7* 5 ± 5# 1 0
HO-1 CTL 8 ± 3 4 ± 4 0 0
NM 3d 37 ± 15* 21 ± 13 2* 1
NM 7d 42 ± 16* 33 ± 9* 3* 1
MnSOD CTL 4 ± 3 1 ± 1 0 0
NM 3d 29 ± 12* 12 ± 6 2* 1
NM 7d 16 ± 7 7 ± 5 2* 0#
H3K9Ac CTL 5 ± 2 0 ± 0 0 0
NM 3d 25 ± 13 61 ± 13*,# 1 2*
NM 7d 10 ± 5 52 ± 16*,# 0 1
HDAC2 CTL 3 ± 3 2 ± 1 0 0
NM 3d 54 ± 12* 10 ± 5# 2* 0#
NM 7d 65 ± 14* 5 ± 5# 3* 0#
Open in a new tab

Lung sections, prepared 3 d and 7 d after exposure of rats to PBS (CTL) or NM, followed by vehicle (Veh) or VPA were immunostained as described in the Materials and Methods. The percentage of macrophages positively staining for each of the markers was calculated relative to the total number of macrophages present in five random fields of injury from at least three sections/rat; magnification 400×. Data were analyzed using a one-way ANOVA followed by unpaired t-test. Values are mean ± SE. Positively stained cells were assigned a staining intensity score on a scale of 0 = no staining, 1 = light staining, 2 = medium staining, 3 = dark staining. Staining Intensity data were analyzed using Kruskal-Wallis non-parametric one-way ANOVA followed by Mann-Whitney Rank Sum post-hoc test. Values represent the median staining score. Representative sections from 3-4 rats/treatment group were analyzed.

aSignificantly different (P ≤ .05) from CTL.

bSignificantly different (P ≤ .05) from vehicle.

FIG. 3.

FIG. 3

Open in a new tab

Effects of VPA on NM-induced alterations in BAL cell and protein content. BAL, collected 3 d and 7 d after exposure of rats to PBS (CTL) or NM, followed by vehicle (Veh) or VPA, were analyzed for cell and protein content. Bars, mean ± SE (n = 5–9 rats/treatment group). *Significantly different (P ≤ .05) from CTL. #Significantly different (P ≤ .05) from Veh.

FIG. 4.

FIG. 4

Open in a new tab

Effects of VPA on NM-induced oxidative stress. Sections, prepared 3 d and 7 d after exposure of rats to PBS (CTL) or NM, followed by vehicle (Veh) or VPA, were immunostained with antibodies to CYPb5, HO-1, or MnSOD. Binding was visualized using a Vectastain kit. Original magnification, ×600. Representative sections from 3 to 4 rats/treatment group are shown.

VPA promotes a persistent increase in immature macrophages in the lung

The effects of VPA on the phenotype of macrophages accumulating in the lung in response to NM were next analyzed using techniques in flow cytometry. In accord with our previous findings (Venosa et al., 2015), NM exposure resulted in an increase in CD11b+ migrating inflammatory macrophages in the lung (Figure 5). These consisted of two subpopulations: immature CD43+ and mature CD43− cells. Whereas the immature CD11b + CD43+ subpopulation accumulated rapidly, peaking 3 d post-NM, the mature CD11b + CD43− subpopulation increased more gradually for at least 7 d (Figure 5). VPA administration caused a significant increase in immature CD11b + CD43+ macrophages in the lung at both 3 d and 7 d post-NM. In contrast, the response of mature CD11b + CD43− macrophages to NM was blunted at 3 d post-exposure; by 7 d, however, equivalent numbers of CD43− macrophages were noted in lungs of vehicle- and VPA-treated rats. Resident CD11b−CD43− macrophages were also identified in the lung; these cells decreased after NM; however, they were largely unaffected by VPA (Figure 5).

FIG. 5.

FIG. 5

Open in a new tab

Flow cytometric analysis of lung macrophages. Upper panels: cells, collected by BAL and massage 3 d and 7 d after exposure of rats to PBS (CTL) or NM, followed by vehicle (Veh) or VPA, were immunostained with antibodies to CD11b and CD43 or the appropriate isotype controls and analyzed by flow cytometry. Upper panel: One representative contour plot is shown. Lower panel: resident alveolar macrophages (A, CD11b−CD43−), migrating immature macrophages (B, CD11b + CD43+), and migrating mature macrophages (C, CD11b + CD43−) were identified based on forward and side scatter followed by doublet discrimination of live cells. The percentage positive CD11b−CD43−, CD11b + CD43+, and CD11b + CD43− cells were calculated from the total number of viable cells. Bars, mean ± SE (CTL/Veh, n = 3; NM 3 d/Veh, n= 3, NM 7 d/Veh, n= 3, CTL/VPA, n= 3, NM 3 d/VPA, n = 5, NM 7 d/VPA, n = 4). Data were analyzed using Kruskal–Wallis non-parametric one-way ANOVA followed by the Mann–Whitney post-hoc test. *Significantly different (P ≤ .05) from CTL. #Significantly different (P ≤ .05) from Veh. †Significantly different (P ≤ .05) from NM 3 d.

VPA dampens NM-induced proinflammatory macrophage activation

In further studies, we assessed the effects of VPA on expression of markers of inflammatory macrophage phenotype and activation in histologic sections. Consistent with our flow cytometric findings, following NM administration, a persistent increase in CD11b+ migrating inflammatory macrophages was observed in the lung; VPA had no effect on these cells (Figure 6 and Table 2). Conversely, VPA caused a reduction in lung macrophages expressing the proinflammatory M1 marker, iNOS at both 3 d and 7 d (Figure 6, Table 2, and Supplementary Figure 2). A decrease in CCR2+ M1 macrophages was also observed 3 d post-NM exposure in VPA-treated rats. Decreases in iNOS+ and CCR2+ macrophages responding to NM were correlated with reduced expression of macrophage proinflammatory genes including NOS2, PTGS2, IL12B, MMP-9, CCR2, and CCL2 (Figure 7). Following NM administration, we also noted increased numbers of CD68+, CD163+ , and ATR-1α+ anti-inflammatory/wound repair M2 macrophages in the lung at 7 d post-exposure (Figure 8); increases in CD68+ and ATR-1α+ macrophages were also observed at 3 d post-NM. This was associated with upregulation of M2 macrophage genes including IL10, ApoE, ATR-1Α, and CX3CR1 (Baitsch et al., 2011) (Figure 7). Treatment of rats with VPA resulted in increased numbers of CD68+, CD163+ , and ATR-1α+ M2 macrophages in the lung at 3 d post-NM (Figure 8); at 7 d post-NM, CD163+ and ATR-1α+ were also increased in VPA-treated rats relative to vehicle-treated rats (Figure 8, Table 2, and Supplementary Figure 3). This was accompanied by increases in expression of IL10, ApoE, and ATR-1Α (Figure 7). Conversely, after VPA administration, NM-induced increases in CX3CR1 expression were reduced at 7 d post-exposure.

FIG. 6.

FIG. 6

Open in a new tab

Effects of VPA on NM-induced increases in inflammatory macrophages in the lung. Sections, prepared 3 d and 7 d after exposure of rats to PBS (CTL) or NM, followed by vehicle (Veh) or VPA, were immunostained with antibodies to CD11b, iNOS or CCR2. Binding was visualized using a Vectastain kit. Original magnification, ×600. Representative sections from 3 to 4 rats/treatment group are shown.

FIG. 7.

FIG. 7

Open in a new tab

Effects of VPA on NM-induced pro- and anti-inflammatory gene expression in lung macrophages. Cells, collected by BAL and massage 3 d and 7 d after exposure of rats to PBS (CTL) or NM, followed by vehicle (Veh) or VPA, were analyzed by RT-PCR. Data were normalized relative to GAPDH and analyzed using Kruskal–Wallis non-parametric one-way ANOVA followed by the Mann–Whitney post-hoc test. Bars, mean ± SE (CTL/Veh, n = 3; NM 3 d/Veh, n= 5, NM 7 d/Veh, n= 5, CTL/VPA, n= 6, NM 3 d/VPA, n = 5, NM 7 d/VPA, n = 5). *Significantly different (P ≤ .05) from CTL. #Significantly different (P ≤ .05) from Veh.

FIG. 8.

FIG. 8

Open in a new tab

Effects of VPA on NM-induced increases in anti-inflammatory macrophages accumulating in the lung. Sections, prepared 3 d and 7 d after exposure of rats to PBS (CTL) or NM, followed by vehicle (Veh) or VPA, were immunostained with antibodies to CD68, CD163, or ATR-1α. Binding was visualized using a Vectastain kit. Original magnification, ×600. Representative sections from 3 to 4 rats/treatment group are shown.

VPA inhibits NM-induced upregulation of HDAC2

Treatment of rats with NM resulted in an increase in macrophage HDAC activity at 3 d post-exposure; by 7 d, levels, HDAC activity was at control levels (Table 3). Expression of HDAC2 and acetylated histone H3K9 was also upregulated in macrophages, as well as epithelial cells, following NM exposure, a response most prominent at 3 d (Figure 9 and Supplementary Figure 3). Whereas VPA blunted the effects of NM on expression of HDAC2, the expression of acetylated H3K9 increased (Figure 9 and Table 2).

TABLE 3.

Effects of NM on Macrophage HDAC Activity

HDAC Activity (ng/min/μg)
CTL 0.13 ± 0.07
3 d 0.56 ± 0.11*
7 d 0.11 ± 0.03#
Open in a new tab

Nuclear extracts were prepared from cells collected by BAL and massage, 3 d and 7 d after exposure of rats to NM or PBS (CTL) control. Total HDAC activity was determined colorimetrically as described in the Materials and Methods section and is expressed as nanograms of deacetylated substrate per minute per microgram of nuclear extract. Data were analyzed using a one-way ANOVA followed by an unpaired t-test. Values are mean ± SE (n = 9–12 rats/treatment group).

*

Significantly different (P ≤ 0.05) from CTL.

#

Significantly different (P ≤ 0.05) from 3 d NM.

FIG. 9.

FIG. 9

Open in a new tab

Effects of VPA on NM-induced HDAC2 and H3K9Ac expression. Sections, prepared 3 d and 7 d after exposure of rats to PBS (CTL) or NM, followed by vehicle (Veh) or VPA, were immunostained with antibodies to HDAC2 or H3K9Ac. Binding was visualized using a Vectastain kit. Original magnification, ×600. Representative sections from 3 to 4 rats/treatment group are shown.

DISCUSSION

Macrophages are sentinels of the innate immune system in the lung; they have also emerged as key inflammatory cells contributing to both protective and pathologic responses to pulmonary injury. To execute these divergent activities, they develop into distinct subpopulations broadly classified as proinflammatory/cytotoxic M1 and anti-inflammatory/wound repair M2 macrophages. The present studies demonstrate that macrophage activation in the lung in response to NM-induced injury is regulated, at least in part, by HDACs. This is based on our findings that after administration of the HDAC inhibitor VPA, activated iNOS+ and CCR2+ proinflammatory M1 macrophages, were decreased in the lungs of NM-treated rats, along with macrophage proinflammatory gene expression, while anti-inflammatory/wound repair CD68+, CD163+,  and ATR-1α+ M2 macrophages and macrophage anti-inflammatory gene expression were increased. The fact that this was correlated with a reduction in NM-induced oxidative stress, inflammation and cellular proliferation provide support for a role of inflammatory macrophages in the pathogenic response to NM, and offer novel insights into mechanisms regulating lung macrophage activation.

A characteristic response to acute tissue injury is cellular proliferation and upregulation of PCNA (Bardales et al., 1996). This reparative hyperplasia, which is observed in epithelial cells, fibroblasts and other mesenchymal cells, typically develops 3–7 days after injury. In line with these reports and our previous studies (Malaviya et al., 2012; Sunil et al., 2014), we found that acute lung injury and hyperplasia induced by NM were associated with increased PCNA expression in epithelial cells, as well as macrophages. This most likely reflects an early attempt to replace cells damaged by NM. We also found that markers of oxidative stress including CYPb5, HO-1, and MnSOD were upregulated after NM. These findings are in accord with reports that NM-induced tissue injury involves oxidative stress (Kinnula et al., 2005). VPA was found to attenuate the effects of NM on cellular proliferation and oxidative stress. This is consistent with the observation that VPA exerts antioxidant and antiproliferative activity in experimental models of lung injury induced by hyperoxia and ischemia–reperfusion (Cetinkaya, et al., 2015; Costalonga et al., 2016; Wu et al., 2015). VPA has been reported to modulate the expression of genes associated with cell cycle arrest, apoptosis, and DNA repair, as well as oxidative stress (Rucker et al., 2016; Strzalka and Ziemienowicz, 2011); this may contribute to its suppressive effects on NM-induced PCNA and antioxidant expression in the lung. By comparison, VPA had no effect on NM-induced alveolar epithelial barrier dysfunction, as measured by BAL protein levels, or on structural alterations in the respiratory tract. These findings suggest that there are multiple mechanisms underlying the pathologic and cytotoxic effects of NM in the lung (Weinberger et al., 2016). Previous studies demonstrated that VPA was effective in reducing acute lung injury induced by LPS, ischemia–perfusion and sepsis (Ji et al., 2013; Kim et al., 2012; Shang, et al., 2010; Wu et al., 2015). It may be that lung injury induced by NM is more severe and that longer treatment times or additional therapeutics with antioxidant and/or anti-inflammatory activity are required to mitigate its toxicity.

In earlier studies, we demonstrated that immature CD11b+CD43+ macrophages responding to NM exhibit an M1-like phenotype, while mature CD11b+CD43− macrophages exhibit an M2-like phenotype; moreover, increases in M2 macrophages in the lung following NM exposure are due, in part, to phenotypic switching of M1 macrophages (Venosa et al., 2015, 2016). The present studies show that after VPA administration, there is a change in these macrophage subpopulations in the lungs of NM treated rats; thus, at 3 d post-NM, immature CD11b+CD43+ macrophages were increased relative to vehicle treated rats, while mature CD11b+CD43− macrophages were decreased. Additionally, immature cells remained elevated in the lung for at least 7 d; at this time, comparable numbers of mature cells were observed in the lungs of vehicle and VPA-treated rats. HDAC inhibitors have been shown to suppress macrophage maturation from monocytic precursors (Nencioni et al., 2007; Rosborough et al., 2012; Sebastian et al., 2008). Increases in immature CD11b+CD43+ M1 macrophages in the lung after VPA may reflect impaired maturation of these cells, and as a consequence, a delay in their phenotypic switching to mature CD11b+CD43− M2 macrophages. This would account for reduced numbers of CD11b+CD43−M2 repair macrophages in the lung 3 d post-NM and potentially, for the inability of VPA to mitigate NM-induced structural alterations in the lung.

In contrast to our findings with CD11b+CD43+ M1 macrophages isolated from the lung, NM-induced increases in iNOS+ and CCR2+ M1 macrophages in histologic sections were blunted following VPA administration. These data suggest that there are multiple subtypes of M1 macrophages responding to NM induced lung injury, which is in accord with previous findings in other models of inflammatory disease (Lech and Anders, 2013; Martinez et al., 2008). It is possible that iNOS+ and CCR2+ M1 macrophages are more mature and functionally activated, when compared with CD11b+CD43+ M1 macrophages and thus, more sensitive to VPA, however, this remains to be evaluated. VPA-induced decreases in iNOS+ and CCR2+ lung macrophages were correlated with reduced expression of NOS2, PTGS2, IL12B, MMP-9, CCR2, and CCL2, proinflammatory genes known to be expressed by activated M1 macrophages (Mantovani et al., 2004). These findings are consistent with reports that HDACs positively regulate expression of proinflammatory genes and M1 macrophage activation (Aung et al., 2006; Brogdon, et al., 2007; Leoni et al., 2002; Shakespear et al., 2013). Similar decreases in proinflammatory gene expression and M1 macrophages have been described in experimental models of acute lung injury, sepsis, ischemia–reperfusion injury, and rheumatoid arthritis after administration of HDAC inhibitors, including VPA (Brogdon et al., 2007; Cetinkaya et al., 2015; Fukudome et al., 2012; Grabiec et al., 2010; Kim et al., 2012; Ni et al., 2010; Shang et al., 2010). M1 activation of macrophages and proinflammatory gene expression are regulated, in part, by the transcription factor NF-κB. In macrophages, upregulation of HDAC1 and HDAC3 results in NF-κB activation (Park et al., 2007; Rahman et al., 2004). HDAC inhibitors are thought to suppress inflammation by targeting transcription of inflammatory genes or processes upstream of their transcription (Bode et al., 2007; Ichiyama et al., 2000; Schwertheim et al., 2014). This is supported by findings that VPA blocks the NFκB inhibitory protein, IκK, by preventing its deacetylation resulting in decreased NFκB translocation to the nucleus and its ability to upregulate inflammatory gene expression (Wu et al., 2015). Suppression of NFκB activation has also been described after VPA treatment as a consequence of inhibition of glycogen synthase kinase-3 (Kostrouchova et al., 2007). Further studies are required to determine if VPA similarly blocks NFκB activation following NM administration, and if this contributes to decreases in M1 macrophages in the lung.

Compared with its suppressive effects on M1 macrophages, VPA caused an expansion of CD68+, CD163+,  and ATR-1α+ M2 macrophages in the lung, most notably at 3 d post-NM exposure; mRNA expression of the M2 markers, IL10, ApoE, and ATR-1Α (Baitsch et al., 2011; Landsman et al., 2009) was also upregulated. These findings are in accord with reports that HDAC3 negatively regulates M2 macrophage activation (Mullican et al., 2011) and that HDAC inhibition results in M1 to M2 phenotypic switching (Kapellos and Iqbal, 2016; Leoni et al., 2002; Park et al., 2007; Wang et al., 2015; Wu et al., 2012). Our observation that there are increases in CD163+, CD68+ , and ATR-1α+ antiinflammatory/wound repair M2 macrophages in the lung 3 d post-NM exposure suggest that inflammatory resolution is initiated more rapidly following VPA treatment. This is supported by our findings that VPA blunted the effects of NM on BAL cell number. Our results also suggest that M2 macrophage subpopulations identified in histologic sections are distinct from CD11b + CD43− M2 macrophages, which is in accord with reports that there are multiple subpopulations of M2 macrophages that vary in phenotype and function (Mantovani et al., 2004; Mosser and Edwards, 2008). This may also reflect differences in the response of alveolar macrophages recovered by lavage and massage, when compared with tissue-associated macrophage identified in histologic sections.

Acetylation of H3K9 is considered a marker of increased proinflammatory gene expression and macrophage activation (Grabiec et al., 2010; Ivashkiv, 2013). Consistent with this notion, we found that NM-induced upregulation of proinflammatory gene expression in the lung was associated with increased expression of acetylated H3K9. Expression of HDAC2 and the activity of HDAC, which exerts strong catalytic actions on acetylated histone H3 (Rafehi et al., 2014), were also increased in lung macrophages after NM. This may reflect a compensatory response aimed at limiting inflammatory gene expression. The fact that HDAC2 and H3K9Ac expression were upregulated in epithelial cells after NM exposure suggests that histone remodeling also occurs in these cells in response to tissue injury. This may be important in their release of chemokines and other proinflammatory mediators that contribute to the recruitment and activation of macrophages in the lung. VPA administration resulted in reduced HDAC2 expression, a response correlated with increased histone H3K9 acetylation at 3 d. These findings provide support for the idea that VPA alters chromatin remodeling in macrophages (Wu et al., 2012) and confirm that HDAC2 is a target for VPA (Hezroni et al., 2011; Ropero et al., 2006).

VPA and other short-chain branched fatty acids have emerged as potent anti-inflammatories and antioxidants (Ximenes et al., 2013). Although the precise mechanisms underlying these actions have not been clearly established, inhibition of HDACs appears to be involved. The relative activity of HATs and HDACs has been shown to play a key role in macrophage phenotypic activation in response to inflammatory signals (Ivashkiv, 2013). The present studies demonstrate that VPA-induced inhibition of HDAC results in a change in the balance between pro- and anti-inflammatory macrophages in the lung after NM exposure. Previous studies have demonstrated that HDAC inhibition using trichostatin-A reduces the acute pulmonary toxicity of NM (Korkmaz et al., 2008). Together, these findings support the idea that decreases in NM-induced oxidative stress and cellular proliferation following VPA administration are due to alterations in acetylation of proteins that regulate macrophage inflammatory activity. Elucidation of epigenetic mechanisms mediating macrophage phenotypic activation represents an important step in understanding the role of these cells in NM-induced lung injury and may lead to the development of therapeutic interventions targeting these pathways.

SUPPLEMENTARY DATA

Supplementary data are available at Toxicological Sciences online.

Supplementary Material

Supplementary Data
Click here for additional data file. (24.1MB, docx)

ACKNOWLEDGMENTS

The authors thank Dr David Reimer, DVM, for performing all PBS and NM instillations.

FUNDING

National Institutes of Health (Grant nos. AR055073, ES004738, ES005022, and HL086621).

REFERENCES

  1. Aung H. T., Schroder K., Himes S. R., Brion K., van Zuylen W., Trieu A., Suzuki H., Hayashizaki Y., Hume D. A., Sweet M. J., et al. (2006). LPS regulates proinflammatory gene expression in macrophages by altering histone deacetylase expression. FASEB J. 20, 1315–1327. [DOI] [PubMed] [Google Scholar]
  2. Baitsch D., Bock H. H., Engel T., Telgmann R., Muller-Tidow C., Varga G., Bot M., Herz J., Robenek H., von Eckardstein A., et al. (2011). Apolipoprotein E induces antiinflammatory phenotype in macrophages. Arterioscler. Thromb. Vasc. Biol. 31, 1160–1168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bardales R. H., Xie S. S., Schaefer R. F., Hsu S. M. (1996). Apoptosis is a major pathway responsible for the resolution of type II pneumocytes in acute lung injury. Am. J. Pathol. 149, 845–852. [PMC free article] [PubMed] [Google Scholar]
  4. Bhalla D. K. (1999). Ozone-induced lung inflammation and mucosal barrier disruption: Toxicology, mechanisms, and implications. J. Toxicol. Environ. Health B Crit. Rev. 2, 31–86. [DOI] [PubMed] [Google Scholar]
  5. Bode K. A., Schroder K., Hume D. A., Ravasi T., Heeg K., Sweet M. J., Dalpke A. H. (2007). Histone deacetylase inhibitors decrease Toll-like receptor-mediated activation of proinflammatory gene expression by impairing transcription factor recruitment. Immunology 122, 596–606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Brogdon J. L., Xu Y., Szabo S. J., An S., Buxton F., Cohen D., Huang Q. (2007). Histone deacetylase activities are required for innate immune cell control of Th1 but not Th2 effector cell function. Blood 109, 1123–1130. [DOI] [PubMed] [Google Scholar]
  7. Cavasin M. A., Demos-Davies K., Horn T. R., Walker L. A., Lemon D. D., Birdsey N., Weiser-Evans M. C., Harral J., Irwin D. C., Anwar A., et al. (2012). Selective class I histone deacetylase inhibition suppresses hypoxia-induced cardiopulmonary remodeling through an antiproliferative mechanism. Circ. Res. 110, 739–748. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cetinkaya M., Cansev M., Cekmez F., Tayman C., Canpolat F. E., Kafa I. M., Yaylagul E. O., Kramer B. W., Sarici S. U. (2015). Protective effects of valproic acid, a histone deacetylase inhibitor, against hyperoxic lung injury in a neonatal rat model. PLoS One 10, e0126028.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chandran A., Antony C., Jose L., Mundayoor S., Natarajan K., Kumar R. A. (2015). Mycobacterium tuberculosis infection induces HDAC1-mediated suppression of IL-12B gene expression in macrophages. Front. Cell. Infect. Microbiol. 5, 90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Costalonga E. C., Silva F. M. O., Noronha I. L. (2016). Valproic acid prevents renal dysfunction and inflammation in the ischemia–reperfusion injury model. BioMed. Res. Int. 2016, 10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fukudome E. Y., Li Y., Kochanek A. R., Lu J., Smith E. J., Liu B., Kim K., Velmahos G. C., deMoya M. A., Alam H. B. (2012). Pharmacologic resuscitation decreases circulating cytokine-induced neutrophil chemoattractant-1 levels and attenuates hemorrhage-induced acute lung injury. Surgery 152, 254–261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Grabiec A. M., Krausz S., de Jager W., Burakowski T., Groot D., Sanders M. E., Prakken B. J., Maslinski W., Eldering E., Tak P. P., et al. (2010). Histone deacetylase inhibitors suppress inflammatory activation of rheumatoid arthritis patient synovial macrophages and tissue. J. Immunol. 184, 2718–2728. [DOI] [PubMed] [Google Scholar]
  13. Hezroni H., Sailaja B. S., Meshorer E. (2011). Pluripotency-related, valproic acid (VPA)-induced genome-wide histone H3 lysine 9 (H3K9) acetylation patterns in embryonic stem cells. J. Biol. Chem. 286, 35977–35988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ichiyama T., Okada K., Lipton J. M., Matsubara T., Hayashi T., Furukawa S. (2000). Sodium valproate inhibits production of TNF-alpha and IL-6 and activation of NF-kappaB. Brain Res. 857, 246–251. [DOI] [PubMed] [Google Scholar]
  15. Ishii M., Wen H., Corsa C. A., Liu T., Coelho A. L., Allen R. M., Carson W. F. T., Cavassani K. A., Li X., Lukacs N. W., et al. (2009). Epigenetic regulation of the alternatively activated macrophage phenotype. Blood 114, 3244–3254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ivashkiv L. B. (2013). Epigenetic regulation of macrophage polarization and function. Trends Immunol. 34, 216–223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Jaenisch R., Bird A. (2003). Epigenetic regulation of gene expression: How the genome integrates intrinsic and environmental signals. Nat. Genet. 33, 245–254. [DOI] [PubMed] [Google Scholar]
  18. Ji M. H., Li G. M., Jia M., Zhu S. H., Gao D. P., Fan Y. X., Wu J., Yang J. J. (2013). Valproic acid attenuates lipopolysaccharide-induced acute lung injury in mice. Inflammation 36, 1453–1459. [DOI] [PubMed] [Google Scholar]
  19. Kapellos T. S., Iqbal A. J. (2016). Epigenetic control of macrophage polarisation and soluble mediator gene expression during inflammation. Mediators Inflamm. 2016, 6591703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kim K., Li Y., Jin G., Chong W., Liu B., Lu J., Lee K., Demoya M., Velmahos G. C., Alam H. B. (2012). Effect of valproic acid on acute lung injury in a rodent model of intestinal ischemia reperfusion. Resuscitation 83, 243–248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kinnula V. L., Fattman C. L., Tan R. J., Oury T. D. (2005). Oxidative stress in pulmonary fibrosis: a possible role for redox modulatory therapy. Am. J. Respir. Crit. Care Med. 172, 417–422. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kittan N. A., Allen R. M., Dhaliwal A., Cavassani K. A., Schaller M., Gallagher K. A., Carson W. F. T., Mukherjee S., Grembecka J., Cierpicki T., et al. (2013). Cytokine induced phenotypic and epigenetic signatures are key to establishing specific macrophage phenotypes. PLoS One 8, e78045.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Korkmaz A., Yaren H., Kunak Z. I., Uysal B., Kurt B., Topal T., Kenar L., Ucar E., Oter S. (2008). Epigenetic perturbations in the pathogenesis of mustard toxicity; hypothesis and preliminary results. Interdiscip. Toxicol. 1, 236–241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kostrouchova M., Kostrouch Z., Kostrouchova M. (2007). Valproic acid, a molecular lead to multiple regulatory pathways. Folia Biol. (Praha). 53, 37–49. [PubMed] [Google Scholar]
  25. Lan B., Hayama E., Kawaguchi N., Furutani Y., Nakanishi T. (2015). Therapeutic efficacy of valproic acid in a combined monocrotaline and chronic hypoxia rat model of severe pulmonary hypertension. PLoS One 10, e0117211.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Landsman L., Bar-On L., Zernecke A., Kim K. W., Krauthgamer R., Shagdarsuren E., Lira S. A., Weissman I. L., Weber C., Jung S. (2009). CX3CR1 is required for monocyte homeostasis and atherogenesis by promoting cell survival. Blood 113, 963–972. [DOI] [PubMed] [Google Scholar]
  27. Laskin D. L., Sunil V. R., Gardner C. R., Laskin J. D. (2011). Macrophages and tissue injury: agents of defense or destruction? Annu. Rev. Pharmacol. Toxicol. 51, 267–288. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lech M., Anders H. J. (2013). Macrophages and fibrosis: How resident and infiltrating mononuclear phagocytes orchestrate all phases of tissue injury and repair. Biochim. Biophys. Acta 1832, 989–997. [DOI] [PubMed] [Google Scholar]
  29. Leoni F., Zaliani A., Bertolini G., Porro G., Pagani P., Pozzi P., Dona G., Fossati G., Sozzani S., Azam T., et al. (2002). The antitumor histone deacetylase inhibitor suberoylanilide hydroxamic acid exhibits antiinflammatory properties via suppression of cytokines. Proc. Natl. Acad. Sci. U. S. A. 99, 2995–3000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Malaviya R., Sunil V. R., Cervelli J., Anderson D. R., Holmes W. W., Conti M. L., Gordon R. E., Laskin J. D., Laskin D. L. (2010). Inflammatory effects of inhaled sulfur mustard in rat lung. Toxicol. Appl. Pharmacol. 248, 89–99. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Malaviya R., Sunil V. R., Venosa A., Vayas K. N., Heck D. E., Laskin J. D., Laskin D. L. (2016). Inflammatory mechanisms of pulmonary injury induced by mustards. Toxicol. Lett. 244, 2–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Malaviya R., Venosa A., Hall L., Gow A. J., Sinko P. J., Laskin J. D., Laskin D. L. (2012). Attenuation of acute nitrogen mustard-induced lung injury, inflammation and fibrogenesis by a nitric oxide synthase inhibitor. Toxicol. Appl. Pharmacol. 265, 279–291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Mantovani A., Sica A., Sozzani S., Allavena P., Vecchi A., Locati M. (2004). The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol. 25, 677–686. [DOI] [PubMed] [Google Scholar]
  34. Martinez F. O., Gordon S. (2014). The M1 and M2 paradigm of macrophage activation: time for reassessment. F1000Prime Rep. 6, 13.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Martinez F. O., Sica A., Mantovani A., Locati M. (2008). Macrophage activation and polarization. Front. Biosci. 13, 453–461. [DOI] [PubMed] [Google Scholar]
  36. Menoret A., Kumar S., Vella A. T. (2012). Cytochrome b5 and cytokeratin 17 are biomarkers in bronchoalveolar fluid signifying onset of acute lung injury. PLoS One 7, e40184.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Mosser D. M., Edwards J. P. (2008). Exploring the full spectrum of macrophage activation. Nat. Rev. Immunol. 8, 958–969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Mullican S. E., Gaddis C. A., Alenghat T., Nair M. G., Giacomin P. R., Everett L. J., Feng D., Steger D. J., Schug J., Artis D., et al. (2011). Histone deacetylase 3 is an epigenomic brake in macrophage alternative activation. Genes Dev. 25, 2480–2488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Nencioni A., Beck J., Werth D., Grunebach F., Patrone F., Ballestrero A., Brossart P. (2007). Histone deacetylase inhibitors affect dendritic cell differentiation and immunogenicity. Clin. Cancer Res. 13, 3933–3941. [DOI] [PubMed] [Google Scholar]
  40. Ni Y. F., Wang J., Yan X. L., Tian F., Zhao J. B., Wang Y. J., Jiang T. (2010). Histone deacetylase inhibitor, butyrate, attenuates lipopolysaccharide-induced acute lung injury in mice. Respir. Res. 11, 33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Park J. S., Lee E. J., Lee J. C., Kim W. K., Kim H. S. (2007). Anti-inflammatory effects of short chain fatty acids in IFN-gamma-stimulated RAW 264.7 murine macrophage cells: Involvement of NF-kappaB and ERK signaling pathways. Int. Immunopharmacol. 7, 70–77. [DOI] [PubMed] [Google Scholar]
  42. Rafehi H., Balcerczyk A., Lunke S., Kaspi A., Ziemann M., Kn H., Okabe J., Khurana I., Ooi J., Khan A. W., et al. (2014). Vascular histone deacetylation by pharmacological HDAC inhibition. Genome Res. 24, 1271–1284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Rahman I., Marwick J., Kirkham P. (2004). Redox modulation of chromatin remodeling: Impact on histone acetylation and deacetylation, NF-kappaB and pro-inflammatory gene expression. Biochem. Pharmacol. 68, 1255–1267. [DOI] [PubMed] [Google Scholar]
  44. Ropero S., Fraga M. F., Ballestar E., Hamelin R., Yamamoto H., Boix-Chornet M., Caballero R., Alaminos M., Setien F., Paz M. F., et al. (2006). A truncating mutation of HDAC2 in human cancers confers resistance to histone deacetylase inhibition. Nat. Genet. 38, 566–569. [DOI] [PubMed] [Google Scholar]
  45. Rosborough B. R., Castellaneta A., Natarajan S., Thomson A. W., Turnquist H. R. (2012). Histone deacetylase inhibition facilitates GM-CSF-mediated expansion of myeloid-derived suppressor cells in vitro and in vivo. J. Leukoc. Biol. 91, 701–709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Royce S. G., Dang W., Ververis K., De Sampayo N., El-Osta A., Tang M. L., Karagiannis T. C. (2011). Protective effects of valproic acid against airway hyperresponsiveness and airway remodeling in a mouse model of allergic airways disease. Epigenetics 6, 1463–1470. [DOI] [PubMed] [Google Scholar]
  47. Rucker F. G., Lang K. M., Futterer M., Komarica V., Schmid M., Dohner H., Schlenk R. F., Dohner K., Knudsen S., Bullinger L. (2016). Molecular dissection of valproic acid effects in acute myeloid leukemia identifies predictive networks. Epigenetics 11, 517–525. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Schwertheim S., Worm K., Schmid K. W., Sheu-Grabellus S. Y. (2014). Valproic acid downregulates NF-kappaB p50 activity and IRAK-1 in a progressive thyroid carcinoma cell line. Horm. Metab. Res. 46, 181–186. [DOI] [PubMed] [Google Scholar]
  49. Sebastian C., Serra M., Yeramian A., Serrat N., Lloberas J., Celada A. (2008). Deacetylase activity is required for STAT5-dependent GM-CSF functional activity in macrophages and differentiation to dendritic cells. J. Immunol. 180, 5898–5906. [DOI] [PubMed] [Google Scholar]
  50. Shakespear M. R., Hohenhaus D. M., Kelly G. M., Kamal N. A., Gupta P., Labzin L. I., Schroder K., Garceau V., Barbero S., Iyer A., et al. (2013). Histone deacetylase 7 promotes Toll-like receptor 4-dependent proinflammatory gene expression in macrophages. J. Biol. Chem. 288, 25362–25374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Shang Y., Jiang Y. X., Ding Z. J., Shen A. L., Xu S. P., Yuan S. Y., Yao S. L. (2010). Valproic acid attenuates the multiple-organ dysfunction in a rat model of septic shock. Chin. Med. J. (Engl). 123, 2682–2687. [PubMed] [Google Scholar]
  52. Shanmugam M. K., Sethi G. (2013). Role of epigenetics in inflammation-associated diseases. Subcell. Biochem. 61, 627–657. [DOI] [PubMed] [Google Scholar]
  53. Strzalka W., Ziemienowicz A. (2011). Proliferating cell nuclear antigen (PCNA): a key factor in DNA replication and cell cycle regulation. Ann. Bot. 107, 1127–1140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Sunil V. R., Patel K. J., Shen J., Reimer D., Gow A. J., Laskin J. D., Laskin D. L. (2011). Functional and inflammatory alterations in the lung following exposure of rats to nitrogen mustard. Toxicol. Appl. Pharmacol. 250, 10–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Sunil V. R., Vayas K. N., Cervelli J. A., Malaviya R., Hall L., Massa C. B., Gow A. J., Laskin J. D., Laskin D. L. (2014). Pentoxifylline attenuates nitrogen mustard-induced acute lung injury, oxidative stress and inflammation. Exp. Mol. Pathol. 97, 89–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Ueda Y., Willmore L. J. (2000). Molecular regulation of glutamate and GABA transporter proteins by valproic acid in rat hippocampus during epileptogenesis. Exp. Brain Res. 133, 334–339. [DOI] [PubMed] [Google Scholar]
  57. Venosa A., Malaviya R., Gow A. J., Hall L., Laskin J. D., Laskin D. L. (2015). Protective role of spleen-derived macrophages in lung inflammation, injury, and fibrosis induced by nitrogen mustard. Am. J. Physiol. Lung Cell. Mol. Physiol. 309, L1487–L1498. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Venosa A., Malaviya R., Choi H., Gow A. J., Laskin J. D., Laskin D. L. (2016). Characterization of distinct macrophage subpopulations during nitrogen mustard-induced lung injury and fibrosis. Am. J. Respir. Cell. Mol. Biol. 54, 436–446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Wang G., Shi Y., Jiang X., Leak R. K., Hu X., Wu Y., Pu H., Li W. W., Tang B., Wang Y., et al. (2015). HDAC inhibition prevents white matter injury by modulating microglia/macrophage polarization through the GSK3beta/PTEN/Akt axis. Proc. Natl. Acad. Sci. U. S. A. 112, 2853–2858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Weinberger B., Malaviya R., Sunil V. R., Venosa A., Heck D. E., Laskin J. D., Laskin D. L. (2016). Mustard vesicant-induced lung injury: Advances in therapy. Toxicol. Appl. Pharmacol. 305, 1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Wu C., Li A., Leng Y., Li Y., Kang J. (2012). Histone deacetylase inhibition by sodium valproate regulates polarization of macrophage subsets. DNA Cell. Biol. 31, 592–599. [DOI] [PubMed] [Google Scholar]
  62. Wu S. Y., Tang S. E., Ko F. C., Wu G. C., Huang K. L., Chu S. J. (2015). Valproic acid attenuates acute lung injury induced by ischemia-reperfusion in rats. Anesthesiology 122, 1327–1337. [DOI] [PubMed] [Google Scholar]
  63. Ximenes J. C., de Oliveira Goncalves D., Siqueira R. M., Neves K. R., Santos Cerqueira G., Correia A. O., Felix F. H., Leal L. K., de Castro Brito G. A., da Graca Naffah-Mazzacorati M., et al. (2013). Valproic acid: An anticonvulsant drug with potent antinociceptive and anti-inflammatory properties. Naunyn Schmiedebergs Arch. Pharmacol. 386, 575–587. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Data
Click here for additional data file. (24.1MB, docx)

Articles from Toxicological Sciences are provided here courtesy of Oxford University Press

RESOURCES