Skip to main content
NCBI home page
eLife logoLink to eLife
. 2018 Jul 16;7:e36828. doi: 10.7554/eLife.36828

Hypoxia-inducible factor cell non-autonomously regulates C. elegans stress responses and behavior via a nuclear receptor

Corinne L Pender 1,2,3, H Robert Horvitz 1,2,3,✉
Editors: Matt Kaeberlein4, Didier YR Stainier5
PMCID: PMC6078495  PMID: 30010540

Abstract

The HIF (hypoxia-inducible factor) transcription factor is the master regulator of the metazoan response to chronic hypoxia. In addition to promoting adaptations to low oxygen, HIF drives cytoprotective mechanisms in response to stresses and modulates neural circuit function. How most HIF targets act in the control of the diverse aspects of HIF-regulated biology remains unknown. We discovered that a HIF target, the C. elegans gene cyp-36A1, is required for numerous HIF-dependent processes, including modulation of gene expression, stress resistance, and behavior. cyp-36A1 encodes a cytochrome P450 enzyme that we show controls expression of more than a third of HIF-induced genes. CYP-36A1 acts cell non-autonomously by regulating the activity of the nuclear hormone receptor NHR-46, suggesting that CYP-36A1 functions as a biosynthetic enzyme for a hormone ligand of this receptor. We propose that regulation of HIF effectors through activation of cytochrome P450 enzyme/nuclear receptor signaling pathways could similarly occur in humans.

Research organism: C. elegans

Introduction

The capacity to sense and respond to oxygen deprivation, or hypoxia, is crucial to normal physiological function and survival of aerobic organisms, which require oxygen to perform respiration and generate energy in the form of ATP. The fundamental importance of a mechanism to detect and react to low oxygen is reflected in the presence of a conserved hypoxia-response pathway in most animal cells. This pathway consists of the transcription factor HIF, or hypoxia-inducible factor, and its negative regulator, the prolyl hydroxylase EGLN, which together mediate a diversity of metabolic and physiological adaptations to hypoxia. The three human EGLNs, which were identified as homologs of the C. elegans protein EGL-9, function as oxygen sensors. In the presence of oxygen, EGLN hydroxylates the HIF α-subunit (HIFα), allowing the von Hippel-Lindau (VHL) E3 ubiquitin ligase to promote HIFα degradation (Maxwell et al., 1999; Jaakkola et al., 2001; Epstein et al., 2001; Ivan et al., 2001). In conditions of low oxygen, HIFα is stabilized and acts with its partner HIFβ to drive adaptations to hypoxia through activation of its transcriptional targets (Kaelin and Ratcliffe, 2008; Semenza, 2011; Wang et al., 1995).

The canonical function of the EGLN/HIF pathway is to regulate genes that either increase oxygen availability, for example by promoting erythropoiesis and angiogenesis, or reduce the cellular requirement for oxygen, for example by driving a shift from oxidative phosphorylation to glycolytic metabolism. However, a growing body of work has found roles for the EGLN/HIF pathway in controlling other aspects of animal physiology and behavior. HIF promotes the response to numerous stressors, including infection, proteotoxicity, and oxidative stress (Palazon et al., 2014; Schito and Rey, 2018; Nakazawa et al., 2016; Powell-Coffman, 2010). HIF activation is associated with increased lifespan in C. elegans (Mehta et al., 2009; Zhang et al., 2009; Chen et al., 2009; Lee et al., 2010); this longevity phenotype likely stems from the improved stress resistance associated with HIF activity, as is often the case for pathways regulating longevity (Leiser et al., 2015; Shore and Ruvkun, 2013). The EGLN/HIF pathway also modulates several behaviors of C. elegans following prolonged hypoxia exposure, suggesting a role for this pathway in tuning neural circuit function (Chang and Bargmann, 2008; Pocock and Hobert, 2010; Ma et al., 2012). The mechanisms by which HIF mediates these non-canonical physiological and behavioral changes remain poorly defined.

Here we report the discovery of an endocrine signaling pathway that regulates multiple aspects of physiology and behavior downstream of HIF in C. elegans. From a genetic screen for suppressors of an egl-9(lf) mutant behavioral defect, we identified a cytochrome P450 gene, cyp-36A1, that is required for modulation of egg-laying behavior by the egl-9/hif-1 pathway. cyp-36A1 is transcriptionally upregulated in hypoxia or egl-9(lf) mutants, in which HIF-1 is constitutively active, and appears to be a direct HIF-1 target. cyp-36A1 controls expression of more than a third of HIF-1-upregulated genes, demonstrating that cyp-36A1 acts broadly downstream of hif-1. Regulation of gene expression and behavior by cyp-36A1 occurs cell non-autonomously, and the downstream effector of cyp-36A1 is the nuclear hormone receptor nhr-46, indicating that the likely function of CYP-36A1 is to generate a diffusible signal that controls NHR-46 activity. In addition to modulating behavior and gene expression, cyp-36A1 and nhr-46 mediate multiple forms of stress resistance associated with HIF activation. We conclude that CYP-36A1 and NHR-46 are important downstream effectors of the EGL-9/HIF pathway and function together to regulate a wide range of HIF-mediated physiology.

Results

A screen for suppressors of the egl-9(lf) egg-laying defect identifies the cytochrome P450 gene cyp-36A1

To identify novel, functionally important HIF effectors, we analyzed the modulation of C. elegans egg laying, the behavior that led our laboratory to discover the first EGLN gene, egl-9, and the first known functional role for any member of the EGLN/HIF pathway (Trent et al., 1983). egl-9(lf) mutants, in which HIF-1 is constitutively active, are defective in egg laying and become bloated with eggs as adults. Although the egg-laying defect of egl-9(lf) mutants is well-established, the downstream effectors of EGL-9 and HIF-1 in regulating egg-laying behavior remain unknown.

We performed a mutagenesis screen to identify genes that act in response to egl-9 to control egg laying. Specifically, we screened for second-site mutations that suppressed the egg-laying defect of egl-9(lf) animals (Figure 1A). Such suppressors could define genes that function downstream of egl-9. Two isolates from this screen were allelic to hif-1 (Figure 1—figure supplement 1A and B), consistent with a previous observation that hif-1(lf) suppresses the egl-9(lf) egg-laying defect (Bishop et al., 2004) and validating the screen as a means of identifying components of the HIF-1 pathway. A third isolate, n5666, was not allelic to hif-1 and had a G106R missense mutation in the gene cyp-36A1, which encodes a cytochrome P450 enzyme (Figure 1—figure supplement 1A and C). A transgene carrying a wild-type copy of cyp-36A1 fully rescued the suppression by n5666 of the egl-9(lf) egg-laying defect, demonstrating that the mutation in cyp-36A1 is the causative mutation and suggesting that the suppression phenotype is caused by reduction of cyp-36A1 function (Figure 1B–1E). Confirming these conclusions, a nonsense allele of cyp-36A1 also suppressed the egl-9(lf) egg-laying defect (Figure 3—figure supplement 1B and C). cyp-36A1(lf) single mutants did not exhibit hyperactive egg-laying behavior (Figure 1F and Figure 3—figure supplement 1A and D), indicating that suppression of the egl-9(lf) egg-laying defect by cyp-36A1(lf) is not a consequence of a nonspecific increase in egg-laying rate. We further showed that cyp-36A1(lf) suppressed the previously reported egg-laying defect of hypoxia-exposed worms (Miller and Roth, 2009), demonstrating a role for CYP-36A1 under physiological conditions of HIF-1 activation (Figure 1—figure supplement 2). We then analyzed the role of cyp-36A1 in regulating other behaviors. We observed that egl-9(lf) mutants have reduced locomotion and defecation rates, both of which were suppressed by hif-1(lf) (Figure 1G and H). cyp-36A1(lf) partially suppressed the slow locomotion and defecation rates of egl-9(lf) mutants, showing that CYP-36A1 modulates not only egg laying but also multiple other HIF-1-regulated behaviors.

Figure 1. The cytochrome P450 gene cyp-36A1 is an effector of the hypoxia-response pathway that regulates behavior.

(A) Schematic of the screen design. Stages of embryonic development adapted from Ringstad and Horvitz (2008) and Paquin et al. (2016). (B–F) Distribution of stages of eggs newly laid by adult hermaphrodites, used as a proxy for egg retention time in utero, of animals of the indicated genotypes. (B) Stages of eggs laid by wild-type animals. (C) egl-9 loss-of-function (lf) mutants laid later stage eggs than the wild type (p<0.001, Chi-square test with Holm-Bonferroni correction). (D) cyp-36A1(n5666) suppressed the egg-laying defect of egl-9(lf) mutants (p<0.001). (E) The cyp-36A1(+) transgene, which contains wild-type cyp-36A1, rescued the suppression of the egg-laying defect observed in cyp-36A1(n5666); egl-9(lf) mutants (p<0.001). (F) cyp-36A1(n5666) mutants displayed wild-type egg laying (p>0.05). (G) egl-9(lf) mutants were defective in locomotion rate, and this defect was suppressed by hif-1(lf) and cyp-36A1(lf) mutations. Mean ± SD of n = 3 biological replicates, *p<0.05, **p<0.01 considered significant (Student’s t-test with Holm-Bonferroni correction). (H) egl-9(lf) mutants were defective in defecation rate, and this defect was suppressed by hif-1(lf) and cyp-36A1(lf). Mean ± SD of n ≥ 6 animals, ***p<0.001 considered significant (Student’s t-test with Holm-Bonferroni correction). (I) Relative expression of cyp-36A1 mRNA in the wild type, egl-9(lf), egl-9(lf) hif-1(lf), and hif-1(lf) mutants, measured by qRT-PCR and normalized to the expression of the large ribosomal subunit rpl-32. Mean ± SD of n = 3 biological replicates, ***p<0.001 considered significant. ns, not significant (Student’s t-test with Holm-Bonferroni correction). Alleles used for (B–F) were cyp-36A1(n5666), egl-9(n586), and nIs674 (nIs [cyp-36A1(+)]), and all strains used in (B–F) contained the nIs470 (Pcysl-2::gfp) transgene. Alleles used for (G–I) were egl-9(sa307), hif-1(ia4), and cyp-36A1(gk824636).

Figure 1.

Figure 1—figure supplement 1. A screen for suppressors of the egl-9(lf) egg-laying defect.

Figure 1—figure supplement 1.

(A) Summary of three cloned alleles from a suppressor screen of the egl-9(lf) egg-defect. (B) Gene diagram of hif-1; isoform F38A6.3b is shown. The ia4 deletion allele was generated by deletion screening (Jiang et al., 2001). Scale bar, 100 bases. (C) Gene diagram of cyp-36A1. The gk824636 allele is from the Million Mutation Project (Thompson et al., 2013). Scale bar, 100 bases.
Figure 1—figure supplement 2. cyp-36A1(lf) suppresses the egg-laying defect of hypoxia-exposed animals.

Figure 1—figure supplement 2.

(A) Schematic depicting experimental design. (B–E) Distribution of stages of eggs laid by adult hermaphrodites. (B) Stages of eggs laid by wild-type animals grown in normoxia (21% O2). (C) Animals exposed to hypoxia (1% O2) for 24 hr as adults laid later stage eggs than those in normoxia (p<0.001, Chi-square test with Holm-Bonferroni correction). (D) cyp-36A1(gk824636) mutants grown in normoxia displayed wild-type egg laying (p>0.05). (E) cyp-36A1(gk824636) mutants exposed to 1% O2 laid eggs at earlier stages than wild-type animals in the same condition (p<0.001).
Open in a new tab

Next we observed that cyp-36A1 expression is increased in egl-9(lf) mutants in a hif-1-dependent manner (Figure 1I), consistent with results from an earlier genome-wide microarray study that identified cyp-36A1 as one of 63 genes regulated by hif-1 in hypoxia-exposed worms (Shen et al., 2005). ChIP-seq of HIF-1 by the modERN project showed HIF-1 binding at two sites near the cyp-36A1 coding region, one 5’ to the start of the gene and one in the first intron (Kudron et al., 2018); both of these sites contain the HIF binding motif 5’RCGTG (Kaelin and Ratcliffe, 2008). We conclude that cyp-36A1 is a downstream effector of the hypoxia-response pathway that regulates multiple behaviors and that cyp-36A1 likely is a direct transcriptional target of HIF-1.

CYP-36A1 regulates gene expression changes and stress resistance downstream of HIF-1

We sought to determine if CYP-36A1 regulates other HIF-1-dependent processes. Based on sequence identity, CYP-36A1 is most closely related to the CYP2 family of cytochrome P450 enzymes, which function in both detoxification of xenobiotics and metabolism of endogenous molecules (Nebert et al., 2013). CYP2 family members and other CYPs can act on endogenous substrates to generate diffusible signaling molecules that regulate gene expression, such as eicosanoids and steroid hormones (Rendic and Guengerich, 2015; Dennis and Norris, 2015; Evans and Mangelsdorf, 2014). We hypothesized that CYP-36A1 might function in a transcriptional cascade to mediate aspects of HIF-1-dependent gene regulation. We performed an RNA-seq experiment comparing the wild type, egl-9(lf) mutants, egl-9(lf) hif-1(lf) double mutants, and cyp-36A1(lf); egl-9(lf) double mutants. We found that hif-1(lf) suppressed egl-9-dependent gene expression for 93% of egl-9(lf)-downregulated genes and 87% of egl-9(lf)-upregulated genes, indicating that most but not all regulation of transcription by egl-9 occurs through hif-1, consistent with previous work (Angeles-Albores et al., 2018). We further found that 36% of HIF-1-upregulated genes (i.e. genes that are upregulated in egl-9(lf) mutants and suppressed by hif-1(lf)) and 10% of HIF-1-downregulated genes were also regulated by cyp-36A1 (Figure 2A and B and Supplementary files 1 and 2). We focused on the HIF-1-upregulated genes, for which CYP-36A1 function appeared to be more broadly required. Gene ontology (GO) enrichment analysis of these HIF-1/CYP-36A1-upregulated genes suggested a role for cyp-36A1 in regulating stress resistance downstream of egl-9 and hif-1 (Figure 2—source data 1). The EGL-9/HIF-1 pathway has previously been implicated in responses to numerous stressors in both nematodes and mammals, with crosstalk occurring between HIF and regulators of the immune response, unfolded protein response, and other stress-response pathways (Palazon et al., 2014; Schito and Rey, 2018; Wouters and Koritzinsky, 2008; Nakazawa et al., 2016; Powell-Coffman, 2010). We tested whether CYP-36A1 is involved in the response to three stressors for which HIF-1 is known to mediate resistance in C. elegans: infection by the pathogenic bacteria Pseudomonas aeruginosa (Darby et al., 1999; Bellier et al., 2009; Shao et al., 2010; Budde and Roth, 2011; Kirienko et al., 2013), tunicamycin-induced ER stress (Leiser et al., 2015), and oxidative stress from tert-butyl hydroperoxide (Bellier et al., 2009). Animals in which HIF-1 is constitutively active because of mutation in egl-9 or the C. elegans VHL homolog vhl-1 are resistant to these stressors relative to wild-type animals: such mutants survive longer when grown on Pseudomonas aeruginosa strain PA14 (Bellier et al., 2009), display reduced tunicamycin-induced growth inhibition (Leiser et al., 2015), and survive exposure to tert-butyl hydroperoxide at a higher rate than the wild type (Bellier et al., 2009). We found that cyp-36A1(lf); egl-9(lf) double mutants are more sensitive than egl-9(lf) mutants to all three of these stressors (Figure 2C–2E and Figure 2—figure supplement 1), suggesting that CYP-36A1 mediates responses to these stressors downstream of HIF-1. Together the CYP-36A1-dependent changes in gene expression and stress resistance indicate that CYP-36A1 plays a major role in regulating HIF-1-mediated physiology.

Figure 2. CYP-36A1 acts downstream of HIF-1 to regulate gene expression changes and stress responses.

(A) Blue circle: Genes that were at least twofold downregulated in egl-9(lf) mutants. Purple and orange circles: Subset of egl-9(lf)-downregulated genes that were significantly upregulated in egl-9(lf) hif-1(lf) double mutants (purple) or cyp-36A1(lf); egl-9(lf) double mutants (orange) vs. egl-9(lf) single mutants. (B) Blue circle: Genes that were at least twofold upregulated in egl-9(lf) mutants. Purple and orange circles: Subset of egl-9(lf)-upregulated genes that were significantly downregulated in egl-9(lf) hif-1(lf) double mutants (purple) or cyp-36A1(lf); egl-9(lf) double mutants (orange) vs. egl-9(lf) single mutants. Significance for all comparisons in (A) and (B) was based on two biological replicates and determined by the Benjamini-Hochberg procedure with a false-discovery rate of 0.05. (C) Survival of animals grown from the L4 larval stage on the pathogen Pseudomonas aeruginosa. Wild type (n = 86 animals) vs. egl-9(lf) (n = 154) p<0.001; egl-9(lf) vs. cyp-36A1(lf); egl-9(lf) (n = 83), p<0.001; cyp-36A1(lf); egl-9(lf) vs. cyp-36A1(lf); egl-9(lf); nIs [cyp-36A1(+)] (n = 97), p<0.001; wild type vs. cyp-36A1(lf) (n = 61) p<0.05, as determined by the log-rank (Mantel-Cox) test, correcting for multiple comparisons with the Holm-Bonferroni method. See figure supplement for replicate data. (D) Survival of animals to the L4 larval stage or later after growth for three days from the L1 larval stage on plates containing 5 μg/ml tunicamycin. Mean ± SD of n = 3 biological replicates. **p<0.01, ***p<0.001 considered significant. ns (p>0.05), not significant (Student’s t-test with Holm-Bonferroni correction). (E) Survival of animals exposed to 7.5 mM tert-butyl hydroperoxide for 10 hr as young adults. Mean ± SD of n = 5 biological replicates. *p<0.05 considered significant. ns (p>0.05), not significant (Student’s t-test with Holm-Bonferroni correction). Alleles used for (A) and (B) were egl-9(sa307), hif-1(ia4), and cyp-36A1(gk824636). Alleles used for (C–E) were egl-9(n586), cyp-36A1(n5666), and nIs674 (nIs [cyp-36A1(+)]), and all strains used in (C–E) contained the nIs470 (Pcysl-2::gfp) transgene.

Figure 2—source data 1. RNA-seq GO enrichment analysis.
Gene ontology enrichment analysis terms for genes more than twofold upregulated in egl-9 mutants and significantly suppressed by hif-1(lf) and cyp-36A1(lf).
elife-36828-fig2-data1.xlsx (48.7KB, xlsx)
DOI: 10.7554/eLife.36828.007

Figure 2.

Figure 2—figure supplement 1. Replicate data for survival on Pseudomonas aeruginosa.

Figure 2—figure supplement 1.

Replicate data for Figure 2C. Wild type (n = 150) vs. egl-9(lf) (n = 50), p<0.001; egl-9(lf) vs. cyp-36A1(lf); egl-9(lf) (n = 163), p<0.001; cyp-36A1(lf); egl-9(lf) vs. cyp-36A1(lf); egl-9(lf); nIs [cyp-36A1(+)] (n = 51), p<0.001; wild type vs. cyp-36A1(lf) (n = 35), p>0.05, as determined by the log-rank (Mantel-Cox) test, correcting for multiple comparisons with the Holm-Bonferroni method.
Open in a new tab

CYP-36A1 functions cell non-autonomously to regulate gene expression

We next sought to identify the site of action of CYP-36A1. We hypothesized that CYP-36A1 might function cell non-autonomously, as is the case for other cytochrome P450 enzymes that generate signaling molecules (Nebert et al., 2013; Evans and Mangelsdorf, 2014; Gerisch and Antebi, 2004). We observed cyp-36A1 expression in many tissues, including neurons, intestine, hypoderm, and muscle (Figure 3—figure supplement 2). To test the hypothesis of cell non-autonomous CYP-36A1 function, we focused on a cyp-36A1-mediated abnormality of egl-9(lf) mutants for which the site of dysfunction is well defined. Specifically, we examined expression of a GFP transcriptional reporter for the gene T24B8.5 (Shivers et al., 2009), which is expressed in only the intestine and based on our RNA-seq data is upregulated in egl-9(lf) mutants in a cyp-36A1-dependent manner. Interestingly, T24B8.5 expression is also upregulated in response to infection, ER stress, and oxidative stress (Shivers et al., 2009; Lim et al., 2014; Park et al., 2009). Expression of the reporter recapitulated the T24B8.5 expression changes observed by RNA-seq: increased expression of GFP was observed in egl-9(lf) mutants, which was suppressed by a second mutation in either hif-1 or cyp-36A1 (Figure 3A and C and Figure 3—figure supplement 3). To determine the site of action of cyp-36A1 for regulation of intestinal T24B8.5 expression, we expressed wild-type cyp-36A1 cDNA using tissue-specific promoters. We found that the low PT24B8.5::gfp expression of cyp-36A1(lf); egl-9(lf) double mutants was rescued by expressing cyp-36A1(+) either cell autonomously in the intestine or cell non-autonomously in neurons, hypoderm or body-wall muscle (Figure 3B and C and Figure 3—figure supplement 3). cyp-36A1(+) expression in all four tissues also rescued the suppression of the egg-laying defect of cyp-36A1(lf); egl-9(lf) mutants (Figure 3—figure supplement 1). Next we found that expressing a nondegradable constitutively active HIF-1 mutant protein (P621A) (Pocock and Hobert, 2008) in any of the same four tissues also promoted intestinal expression of the GFP reporter and that this HIF-1-mediated increase in expression required cyp-36A1 (Figure 3D and E and Figure 3—figure supplement 4). Thus, CYP-36A1 can function cell non-autonomously to regulate gene expression downstream of HIF-1, consistent with the hypothesis that CYP-36A1 acts by generating a diffusible signal.

Figure 3. HIF-1 and CYP-36A1 cell non-autonomously regulate expression of a stress-responsive gene.

(A) PT24B8.5::gfp expression of the indicated genotypes (n = 10 animals per image). Scale bars, 100 μm. (B) Expression of cyp-36A1(+) specifically in neurons, hypoderm, muscle, or intestine of cyp-36A1(lf); egl-9(lf) animals increased expression of PT24B8.5::gfp in intestine (n = 10 animals per image). Scale bars, 100 μm. (C) Quantification of fluorescence intensity for (A) and (B), measured as average intensity for a 300 μm section of the intestine in the midbody of each animal, as indicated. *p<0.05, **p<0.01, ***p<0.001 considered significant (Student’s t-test with Holm-Bonferroni correction). Mean ± SD of n = 10 animals. See figure supplement for replicate data. (D) Expression of hif-1(P621A), which encodes a stable variant of HIF-1 (Pocock and Hobert, 2008), specifically in neurons, hypoderm, muscle, or intestine increased expression of PT24B8.5::gfp in intestine; increased expression was suppressed by cyp-36A1(lf) (n = 10 animals per image). Scale bars, 100 μm. (E) Quantification of fluorescence intensity for (D), measured as average intensity for a 300 μm section of the intestine in the midbody of each animal, as indicated. *p<0.05, ***p<0.01, ***p<0.001 considered significant (Student’s t-test with Holm-Bonferroni correction). Mean ± SD of n = 10 animals. See figure supplement for replicate data. Alleles used were egl-9(sa307), hif-1(ia4), cyp-36A1(gk824636), nEx2699[Pneurons::hif-1(P621A)], otEx3156 [Phypoderm::hif-1(P621A)], otEx3165 [Pmuscle::hif-1(P621A)], nEx2860 [Pintestine:: hif-1(P621A)], nEx2853 [Pneurons::cyp(+)], nEx2856 [Phypoderm::cyp(+)], nEx2859 [Pmuscle::cyp(+)], and nEx2849 [Pintestine::cyp(+)]. All strains contained the agIs219 (PT24B8.5::gfp) transgene.

Figure 3.

Figure 3—figure supplement 1. cyp-36A1 expression in multiple tissues rescues the egg-laying phenotype of cyp-36A1(lf); egl-9(lf).

Figure 3—figure supplement 1.

(A–H) Distribution of stages of eggs laid by adult hermaphrodites of the indicated genotypes. All strains contained the agIs219 (PT24B8.5::gfp) transgene. (A) Stages of eggs laid by wild-type animals. (B) egl-9(sa307) animals laid later stage eggs than wild type (p<0.001, Chi-square test with Holm-Bonferroni correction). (C) cyp-36A1(gk824636) suppressed the egg-laying defect of egl-9(sa307) mutants (p<0.001). (D) Stages of eggs laid by cyp-36A1(gk824636) single mutants were not significantly different from those laid by wild-type animals (p>0.05). (E–H) Expression of cyp-36A1(+) specifically in neurons, hypoderm, muscle, or intestine of cyp-36A1(gk824636); egl-9(sa307) animals all rescued the suppression by cyp-36A1(lf) of the egg-laying defect of egl-9(lf) (p<0.001).
Figure 3—figure supplement 2. cyp-36A1 is expressed in many tissues.

Figure 3—figure supplement 2.

(A–D) Paired fluorescent (left in each panel) and Nomarski (right in each panel) micrographs showing expression of a transcriptional Pcyp-36A1::gfp reporter (nIs682) in an adult worm. Expression was observed in the head (A), midbody (B and C), and tail (D), including in neurons, body-wall muscle, vulval muscle, intestine, and hypoderm, as indicated. Scale bars, 20 μm.
Figure 3—figure supplement 3. Replicate data for PT24B8.5::gfp reporter expression.

Figure 3—figure supplement 3.

Replicate data for Figure 3C. Quantification of n = 10 animals. ***p<0.001 considered significant. ns (p>0.05), not significant (Student’s t-test with Holm-Bonferroni correction).
Figure 3—figure supplement 4. Replicate data for PT24B8.5::gfp reporter expression.

Figure 3—figure supplement 4.

Replicate data for Figure 3E. Quantification of n = 10 animals. **p<0.01, ***p<0.001 considered significant (Student’s t-test with Holm-Bonferroni correction).
Open in a new tab

A screen for suppressors of cyp-36A1(lf) identifies the nuclear receptor gene nhr-46

We performed a mutagenesis screen to identify CYP-36A1 effectors that regulate egg-laying behavior, stress responses, and gene expression. We screened for mutations that suppressed both the low PT24B8.5::gfp expression and normal egg laying of cyp-36A1(lf); egl-9(lf) double mutants, looking for triple mutants that, like egl-9(lf) single mutants, had high GFP expression and were egg-laying defective. By screening for suppressors of the two abnormalities simultaneously, we were able to focus on effectors of CYP-36A1 rather than finding genes that affect only egg laying or only expression of T24B8.5 independently of the EGL-9/HIF-1/CYP-36A1 pathway. From this screen we identified one nonsense and one missense allele of the nuclear receptor gene nhr-46 (Figure 4A–4D and Figure 4—figure supplement 1), both of which caused an egg-laying defect and high expression of the PT24B8.5::gfp reporter. We tested whether nhr-46 also functions in regulating stress responses downstream of cyp-36A1 and found that cyp-36A1(lf); nhr-46(lf); egl-9(lf) triple mutants were more resistant to Pseudomonas infection, ER stress, and oxidative stress than cyp-36A1(lf); egl-9(lf) double mutants (Figure 4E–4G and Figure 4—figure supplement 2). Thus, NHR-46 is a downstream effector of CYP-36A1 in regulation of stress resistance as well as of behavior and gene expression. Interestingly, nhr-46(lf) single mutants displayed wild-type egg laying (Figure 4D), tunicamycin resistance (Figure 4F), and oxidative stress resistance (Figure 4G), and nearly wild-type survival on Pseudomonas (Figure 4E and Figure 4—figure supplement 2), indicating that in addition to nhr-46 at least one other pathway is required to transduce egl-9-mediated modulation of egg laying and stress resistance. For example, in egl-9(lf) mutants or hypoxia, HIF-1 might drive expression of two (or more) targets that act together to inhibit egg laying and promote stress resistance. Thus, cyp-36A1 activation and consequent nhr-46 inhibition would promote egg-laying inhibition and stress resistance in egl-9(lf) mutant animals – in which this second pathway was also activated – but not in nhr-46(lf) single mutants – in which this second pathway was not activated. nhr-46(lf) single mutants had increased expression of the PT24B8.5::gfp reporter (Figure 4B and C and Figure 4—figure supplement 1), suggesting that at least some gene expression changes can be mediated by nhr-46 alone.

Figure 4. The nuclear hormone receptor NHR-46 acts downstream of CYP-36A1.

(A) nhr-46 gene diagram; isoform C45E5.6b is shown. n6125 and n6126 are in the NHR-46 ligand-binding domain. Scale bar, 100 bases. (B) PT24B8.5::gfp fluorescence of the indicated genotypes (n = 10 animals per image). Scale bars, 100 μm. (C) Quantification of fluorescence intensity for (B), measured as average intensity for a 300 μm section of the intestine in the midbody of each animal, as indicated. *p<0.05, ***p<0.001 considered significant (Student’s t-test with Holm-Bonferroni correction). Mean ±SD of n = 10 animals. See figure supplement for replicate data. (D) Distribution of stages of eggs newly laid by adult hermaphrodites of the indicated genotypes. ***p<0.001 considered significant. ns (p>0.05), not significant (Chi-square test with Holm-Bonferroni correction). (E) Survival of animals grown from the L4 larval stage on the pathogen Pseudomonas aeruginosa. Wild type (n = 129) vs. egl-9(lf) (n = 67) p<0.001; egl-9(lf) vs. cyp-36A1(lf); egl-9(lf) (n = 129), p<0.001; cyp-36A1(lf); egl-9(lf) vs. cyp-36A1(lf); nhr-46(lf); egl-9(lf) (n = 94), p<0.001; wild type vs. cyp-36A1(lf) (n = 106), p<0.05; wild type vs. nhr-46(lf) (n = 121), p<0.001, as determined by the log-rank (Mantel-Cox) test, correcting for multiple comparisons with the Holm-Bonferroni method. egl-9(lf) allele was egl-9(n586). See figure supplement for replicate data. (F) Survival of animals to the L4 larval stage or later after growth for three days from the L1 larval stage on plates containing 5 μg/ml tunicamycin. Mean ± SD of n = 3 biological replicates. ***p<0.001 considered significant. ns (p>0.05), not significant (Student’s t-test with Holm-Bonferroni correction). (G) Survival of animals exposed to 7.5 mM tert-butyl hydroperoxide for 10 hr as young adults. Mean ± SD of n = 4 biological replicates. *p<0.05 considered significant. ns, not significant (Student’s t-test with Holm-Bonferroni correction). Alleles used for (B–G) were egl-9(sa307), cyp-36A1(gk824636), nhr-46(n6126), and nEx2586 (nEx [nhr-46(+)]) except where otherwise noted. All strains in (B), (C), (D), (F), and (G) contained the agIs219 (PT24B8.5::gfp) transgene.

Figure 4.

Figure 4—figure supplement 1. Replicate data for PT24B8.5::gfp reporter expression.

Figure 4—figure supplement 1.

Replicate data for Figure 4C. Quantification of n = 10 animals. ***p<0.001 considered significant (Student’s t-test with Holm-Bonferroni correction).
Figure 4—figure supplement 2. Replicate data for survival on Pseudomonas aeruginosa.

Figure 4—figure supplement 2.

Replicate data for Figure 4E. Wild type (n = 34) vs. egl-9(n586) (n = 61), p<0.001; egl-9(lf) vs. cyp-36A1(lf); egl-9(lf) (n = 52), p<0.05; cyp-36A1(lf); egl-9(lf) vs. cyp-36A1(lf); nhr-46(lf); egl-9(lf) (n = 39), p<0.001; wild type vs. cyp-36A1(lf) (n = 91), p>0.05; wild type vs. nhr-46(lf) (n = 54), p<0.05, as determined by the log-rank (Mantel-Cox) test, correcting for multiple comparisons with the Holm-Bonferroni method.
Open in a new tab

nhr-46 functions tissue-specifically to regulate gene expression and behavior

nhr-46 is expressed in many tissues, including neurons, hypoderm, muscle, intestine, and the spermatheca (Feng et al., 2012). Tissue-specific expression of nhr-46 in the intestine, but not in neurons or muscle, rescued the high GFP expression caused by nhr-46(lf), indicating that nhr-46 acts cell autonomously in the intestine to control intestinal expression of T24B8.5 (Figure 5A and B and Figure 5—figure supplement 1). nhr-46 expression in neurons fully rescued the egg-laying defect of cyp-36A1(lf); nhr-46(lf); egl-9(lf) triple mutants (Figure 5C), demonstrating that nhr-46 function in neurons is sufficient to regulate egg-laying behavior. nhr-46 expression in intestine, but not muscle, also partially rescued the egg-laying defect of cyp-36A1(lf); nhr-46(lf); egl-9(lf) triple mutants (Figure 5C). In combination with the tissue-specific CYP-36A1 and HIF-1 experiments described above, these results suggest that a CYP-36A1-regulated cell non-autonomous signal from any tissue can act on NHR-46 in the intestine to drive intestinal T24B8.5 expression and in either the nervous system or the intestine to regulate egg-laying behavior. That nhr-46 can act in either of two different tissues to regulate egg laying suggests that a second intercellular signal, for example a peptide or other hormone, might regulate egg laying downstream of NHR-46.

Figure 5. NHR-46 acts in different tissues to regulate T24B8.5 expression and egg laying.

(A) Expression of nhr-46(+) in the intestine but not in neurons or muscle rescued the high PT24B8.5::gfp expression in the intestine of cyp-36A1(lf); nhr-46(lf); egl-9(lf) mutants (n = 10 animals per image). Scale bars, 100 μm. (B) Quantification of fluorescence intensity for (A), measured as average intensity for a 300 μm section of the intestine in the midbody of each animal, as indicated. **p<0.01, ***p<0.001 considered significant. ns (p>0.05), not significant (Student’s t-test with Holm-Bonferroni correction). Mean ±SD of n = 10 animals. See figure supplement for replicate data. (C) Distribution of stages of eggs laid by adult hermaphrodites. Expression of nhr-46(+) in the intestine partially rescued the egg-laying defect of cyp-36A1(lf); nhr-46(lf); egl-9(lf) mutants. Neuronal nhr-46(+) expression fully rescued the egg-laying defect. Expression of nhr-46(+) in muscle did not rescue the egg-laying defect of cyp-36A1(lf); nhr-46(lf); egl-9(lf) mutants. ***p<0.001 considered significant. ns (p>0.05), not significant (Chi-square test with Holm-Bonferroni correction). Alleles used were egl-9(sa307), cyp-36A1(gk824636), nhr-46(n6126), nEx2713 [Pneurons::nhr-46(+)], nEx2715 [Pmuscle::nhr-46(+)], and nEx2864 [Pintestine::nhr-46(+)]. All strains contained the agIs219 (PT24B8.5::gfp) transgene.

Figure 5.

Figure 5—figure supplement 1. Replicate data for PT24B8.5::gfp reporter expression.

Figure 5—figure supplement 1.

Replicate data for Figure 5B. Quantification of n = 10 animals. **p<0.01, ***p<0.001 considered significant. ns (p>0.05), not significant (Student’s t-test with Holm-Bonferroni correction).
Open in a new tab

Discussion

These studies define a novel molecular genetic pathway that mediates cell non-autonomous regulation of gene expression by the HIF-1 transcription factor. Our genetic analysis indicates that hif-1 activates the cytochrome P450 cyp-36A1, which in turn inhibits the nuclear receptor nhr-46 (Figure 6A). We speculate that the molecular function of CYP-36A1 is to generate an unidentified hormone that binds and regulates NHR-46, similar to other cytochrome P450 enzymes that function upstream of nuclear receptors (Evans and Mangelsdorf, 2014) and consistent with our observed cell non-autonomous function of CYP-36A1. We propose the following model (Figure 6B): In wild-type animals, EGL-9 inhibits HIF-1 activity, such that the HIF-1 target cyp-36A1 is not transcribed. The unliganded NHR-46 represses expression of genes that promote stress resistance and inhibit egg laying. In egl-9(lf) mutants, as in hypoxia-exposed worms, HIF-1 is stabilized and drives increased cyp-36A1 expression. A CYP-36A1-generated hormone then binds NHR-46 and antagonizes the repressive function of NHR-46, accounting for the observed negative regulatory relationship between cyp-36A1 and nhr-46. Ligand-bound NHR-46 is likely activated to promote the expression of target genes, by analogy to a well-established mechanism of nuclear receptor regulation in which ligand binding mediates a switch from repressive to activating nuclear receptor function (Evans and Mangelsdorf, 2014). Alternatively, CYP-36A1 might degrade a ligand that activates NHR-46.

Figure 6. Model for the regulation of physiology and behavior by NHR-46 and CYP-36A1.

Figure 6.

Open in a new tab

(A) The genetic pathway in which egl-9 inhibits hif-1, which activates cyp-36A1, which in turn inhibits nhr-46. (B) Model for how CYP-36A1 and NHR-46 function downstream of HIF-1. We suggest that CYP-36A1, which is transcriptionally upregulated by HIF-1, generates a hormone that binds NHR-46, thereby promoting transcriptional and physiological changes. See text for details.

Cell non-autonomous regulation of stress resistance by HIF involves multiple pathways

Numerous studies have reported that HIF-1 promotes longevity and stress resistance of C. elegans (Darby et al., 1999; Treinin et al., 2003; Bellier et al., 2009; Mehta et al., 2009; Zhang et al., 2009; Chen et al., 2009; Lee et al., 2010; Shao et al., 2010; Budde and Roth, 2011; Kirienko et al., 2013; Fawcett et al., 2015). Nonetheless, despite substantial interest in the role of this pathway in stress biology, few relevant HIF effectors have been identified. Interestingly, a recent study reported that HIF-dependent serotonin signaling from the nervous system cell non-autonomously drives expression of the xenobiotic detoxification enzyme flavin-containing monooxygenase-2 (FMO-2) in the intestine, resulting in increased stress resistance and consequent extension of lifespan (Leiser et al., 2015). Here we report that a different signal, likely a lipophilic hormone, acts cell non-autonomously downstream of HIF to regulate gene expression and stress resistance. Consistent with the findings of Leiser et al. (2015), our RNA-seq data showed that in egl-9(lf) mutants there is a strong induction of fmo-2 expression and that this induction is suppressed by hif-1 mutation (Supplementary file 2), that is HIF-1 upregulates fmo-2 expression. Notably, this HIF-dependent expression of fmo-2 does not require cyp-36A1: the high fmo-2 expression of egl-9(lf) mutants is not suppressed by cyp-36A1(lf). We therefore suggest that serotonin-mediated fmo-2 expression and cyp-36A1/nhr-46-mediated gene expression are parallel pathways downstream of HIF that regulate stress resistance.

Human cytochrome P450 enzymes might act as mediators of HIF-dependent gene expression

We speculate that some human CYPs might serve as mediators of HIF-dependent gene expression changes through a mechanism analogous to that we describe above for CYP-36A1. In support of this hypothesis, previous studies have identified several human cytochrome P450 enzymes that are putative direct HIF targets based on whole-genome ChIP-chip and ChIP-seq analysis (Mole et al., 2009; Schödel et al., 2011). We note that the humoral nature of a CYP-generated molecule would make it a candidate mediator of non-autonomous regulation of hypoxia response by the EGLN/HIF pathway, such as is observed in remote ischemic preconditioning (Cai et al., 2013; Olenchock et al., 2016).

Cytochrome P450 enzymes might be major players in the hypoxia-response pathway

We previously identified another cytochrome P450 gene, cyp-13A12, as acting downstream of egl-9 in a locomotory behavior (Ma et al., 2013). In contrast to CYP-36A1, which is upregulated by HIF-1, CYP-13A12 is downregulated by HIF-1 upon hypoxia exposure or in egl-9(lf) mutants. The downstream effectors of CYP-36A1 and CYP-13A12 are also distinct, as we show here that CYP-36A1 regulates a nuclear receptor that controls transcription, whereas CYP-13A12 generates eicosanoids that act on a seconds-to-minutes timescale unlikely to require gene expression changes. Thus, different cytochrome P450 enzymes can act broadly, through multiple mechanisms, downstream of the EGL-9/HIF-1 hypoxia-response pathway in C. elegans. We propose that cytochrome P450 enzymes might similarly be important HIF effectors in mammals. Polymorphisms in numerous human cytochrome P450 genes have been associated with cardiovascular disease (Elbekai and El-Kadi, 2006; Rowland and Mangoni, 2014), for which HIF plays a protective role (Semenza, 2012), and with cancers (Agundez, 2004), for which HIF contributes to pathogenesis (Semenza, 2012). Furthermore, a study of genetic adaptations in humans to the environmentally hypoxic Tibetan plateau identified well-established members of the HIF pathway and, intriguingly, also noted positive selection at two cytochrome P450 loci (Simonson et al., 2010). Together these observations suggest that the cytochrome P450 family of enzymes is important in a wide range of hypoxia-associated contexts in humans. We suggest the presence of a mechanistic link between the canonical HIF pathway and the function of cytochrome P450 enzymes in humans and posit that an understanding of how these highly druggable enzymes (Schuster and Bernhardt, 2007) control processes downstream of HIF might reveal new therapeutic avenues for treating a broad array of disorders.

Cytochrome P450 enzymes require oxygen as a substrate and thus might be regulated by oxygen availability. A long-standing issue in the understanding of HIF function is ‘range finding,’ that is how activity of the EGLN/HIF pathway is modulated such that it responds to different oxygen set points depending on context to drive a diversity of biological outputs (Ratcliffe, 2013). We hypothesize that the oxygen sensitivity of HIF-regulated cytochrome P450 enzymes might enable them to function in such a range finding mechanism to narrow the range of oxygen concentrations at which a subset of HIF-regulated physiological changes are activated.

Materials and methods

Key resources table.

Reagent type
(species) or resource		 Designation Source or reference Identifiers Additional
information
Strain, strain background
(Caenorhabditis elegans)		 AU78 Dennis Kim agIs9 III
Strain, strain background
(C. elegans)		 CB6088 Jonathan Hodgkin egl-9(sa307) V hif-1(ia4) V
Strain, strain background
(C. elegans)		 JT307 Creg Darby egl-9(sa307) V
Strain, strain background
(C. elegans)		 MT20483 Dengke Ma/Bob
Horvitz		 nIs470 IV
Strain, strain background
(C. elegans)		 MT22836 this paper cyp-36A1(gk824636) I ; egl-9(sa307) V
Strain, strain background
(C. elegans)		 MT23218 this paper nIs682 X
Strain, strain background
(C. elegans)		 MT24164 this paper cyp-36A1(gk824636) I ; agIs9 III
Strain, strain background
(C. elegans)		 MT24165 this paper cyp-36A1(gk824636) I ; agIs9 III ;
egl-9(sa307) V
Strain, strain background
(C. elegans)		 MT24166 this paper agIs9 III ; egl-9(sa307) V hif-1(ia4) V
Strain, strain background
(C. elegans)		 MT24167 this paper agIs9 III ; egl-9(sa307) V
Strain, strain background
(C. elegans)		 MT24177 this paper agIs9 III ; hif-1(ia4) V
Strain, strain background
(C. elegans)		 MT24179 this paper cyp-36A1(n5666) I ; (nIs470) IV
Strain, strain background
(C. elegans)		 MT24520 this paper cyp-36A1(n5666) I ; (nIs470) IV ;
egl-9(n586ts) V ; nIs674
Strain, strain background
(C. elegans)		 MT24622 this paper cyp-36A1(n5666) I ; (nIs470) IV ;
egl-9(n586ts) V
Strain, strain background
(C. elegans)		 MT24684 this paper cyp-36A1(gk824636) I ; agIs9 III ;
nhr-46(n6126) IV ; egl-9(sa307) V ;
nEx2586
Strain, strain background
(C. elegans)		 MT24690 this paper agIs9 III ; otEx3165
Strain, strain background
(C. elegans)		 MT24692 this paper agIs9 III ; otEx3156
Strain, strain background
(C. elegans)		 MT24911 this paper cyp-36A1(gk824636) I ; agIs9 III ;
nhr-46(n6126) IV ; egl-9(sa307) V
Strain, strain background
(C. elegans)		 MT25047 this paper agIs9 III ; nEx2699
Strain, strain background
(C. elegans)		 MT25048 this paper cyp-36A1(gk824636) I ; agIs9 III ;
nEx2699
Strain, strain background
(C. elegans)		 MT25050 this paper cyp-36A1(gk824636) I ; agIs9 III ;
otEx3156
Strain, strain background
(C. elegans)		 MT25051 this paper cyp-36A1(gk824636) I ; agIs9 III ;
otEx3165
Strain, strain background
(C. elegans)		 MT25104 this paper cyp-36A1(gk824636) I ; agIs9 III ;
nhr-46(n6126) IV ; egl-9(sa307) V ;
nEx2713
Strain, strain background
(C. elegans)		 MT25107 this paper cyp-36A1(gk824636) I ; agIs9 III ;
nhr-46(n6126) IV ; egl-9(sa307) V ;
nEx2715
Strain, strain background
(C. elegans)		 MT25196 this paper agIs9 III ; nhr-46(n6125) IV
Strain, strain background
(C. elegans)		 MT25197 this paper cyp-36A1(gk824636) I ; agIs9 III ;
nhr-46(n6125) IV ; egl-9(sa307) V
Strain, strain background
(C. elegans)		 MT25211 this paper cyp-36A1(gk824636) I
Strain, strain background
(C. elegans)		 MT25212 this paper cyp-36A1(gk824636) I ; egl-9(n586ts) V
Strain, strain background
(C. elegans)		 MT25213 this paper cyp-36A1(gk824636) I ;
nhr-46(n6126) IV ; egl-9(n586ts) V
Strain, strain background
(C. elegans)		 MT25214 this paper nhr-46(n6126) IV
Strain, strain background
(C. elegans)		 MT25215 this paper egl-9(n586ts) V
Strain, strain background
(C. elegans)		 MT25596 this paper cyp-36A1(gk824636) I ; agIs9 III ;
egl-9(sa307) V ; nEx2853
Strain, strain background
(C. elegans)		 MT25599 this paper cyp-36A1(gk824636) I ; agIs9 III ;
egl-9(sa307) V ; nEx2856
Strain, strain background
(C. elegans)		 MT25601 this paper cyp-36A1(gk824636) I ; agIs9 III ;
egl-9(sa307) V ; nEx2849
Strain, strain background
(C. elegans)		 MT25605 this paper cyp-36A1(gk824636) I ; agIs9 III ;
egl-9(sa307) V ; nEx2859
Strain, strain background
(C. elegans)		 MT25606 this paper agIs9 III ; nEx2860
Strain, strain background
(C. elegans)		 MT25610 this paper cyp-36A1(gk824636) I ; agIs9 III ;
nhr-46(n6126) IV ; egl-9(sa307) V ; nEx2864
Strain, strain background
(C. elegans)		 MT25611 this paper cyp-36A1(gk824636) I ; agIs9 III ; nEx2860
Strain, strain background
(C. elegans)		 MT25627 this paper agIs9 III ; nhr-46(n6126) IV
Strain, strain background
(C. elegans)		 ZG31 Huaqi Jiang/Jo Anne Powell-Coffman hif-1(ia4) V
Open in a new tab

C. elegans strains and transgenes

All C. elegans strains were cultured as described previously (Brenner, 1974). We used the N2 Bristol strain as the reference wild-type strain, and the polymorphic Hawaiian strain CB4856 (Davis et al., 2005) for genetic mapping and SNP analysis. We used the following mutations and transgenes:

LGI: cyp-36A1(n5666, gk824636)

LGIII: agIs219[PT24B8.5::gfp::unc-54 3’UTR, Pttx-3::gfp::unc-54 3’UTR]

LGIV: nhr-46(n6125, n6126), nIs470[Pcysl-2::gfp, Pmyo-2::mCherry], him-8(e1489)

LGV: egl-9(n586, sa307), hif-1(ia4)

LGX: nIs682[Pcyp-36A1::gfp::unc-54 3’UTR, Pmyo-3::mCherry::unc-54 3’UTR]

Unknown linkage: nIs674[Pcyp-36A1::cyp-36A1(+) gDNA::cyp-36A1 3’UTR, Pmyo-3::mCherry::unc-54 3’UTR]

Extrachromosomal arrays

otEx3156 [Pdpy-7::hif-1(P621A), Pttx-3::rfp], otEx3165 [Punc-120::hif-1(P621A), Pttx-3::rfp], nEx2699 [Prab-3::hif-1(P621A)::F2A::mCherry::tbb-2 3'UTR, Pttx-3::mCherry], nEx2860 [Pvha-6::hif-1(P621A)::F2A::mCherry::tbb-2 3'UTR, rol-6(su1006dm)], nEx2849 [Pvha-6::cyp-36A1 cDNA::F2A::mCherry::tbb-2 3'UTR, rol-6(su1006dm)], nEx2856 [Pdpy-7::cyp-36A1 cDNA::F2A::mCherry::tbb-2 3'UTR, rol-6(su1006dm)], nEx2853 [Prab-3::cyp-36A1 cDNA::F2A::mCherry::tbb-2 3'UTR, rol-6(su1006dm)], nEx2859 [Punc-54::cyp-36A1 cDNA::F2A::mCherry::tbb-2 3'UTR, Pttx-3::mCherry::tbb-2 3’UTR], nEx2586 [Pnhr-46::nhr-46(+) gDNA::nhr-46 3’UTR, Pmyo-3::mCherry::unc-54 3’UTR], nEx2715[Punc-54::nhr-46 cDNA::F2A::mCherry::tbb-2 3'UTR], nEx2713 [Prab-3::nhr-46 cDNA::F2A::mCherry::tbb-2 3'UTR], nEx2864 [Pvha-6::nhr-46 cDNA::F2A::mCherry::tbb-2 3'UTR, rol-6(su1006dm)]

Note on allele usage: For egl-9, the weaker n586 allele was used for the screen and in the initial phenotypic characterization of screen mutants (Figure 1A–1F and Figure 2C–2E). The stronger sa307 allele was used for all other experiments, except for in the slow killing assay, for which the sa307 allele is less protective than weaker alleles, as previously reported (Bellier et al., 2009). For cyp-36A1, the allele identified from the screen, n5666, was used in the initial phenotypic characterization (Figure 1D–1F and 2C–2E); the putative null allele gk824636 was used for all other experiments. Alleles for other genes were used as indicated in the figure legends.

Molecular biology and transgenic strain construction

The Pcyp-36A1::gfp::unc-54 3’UTR construct (transgene nIs682) was generated by using PCR fusion (Hobert, 2002) to fuse a PCR product containing the cyp-36A1 promoter fragment (4.4 kb of upstream sequence) to a PCR product containing gfp::unc-54 3’UTR. The cyp-36A1 rescuing construct (transgene nIs674) was generated by amplifying a PCR product from gDNA containing 4.4 kb upstream, the cyp-36A1 locus, and 1.6 kb downstream. The nhr-46 rescuing construct (transgene nEx2586) was generated by amplifying a PCR product from gDNA containing 1.9 kb upstream, the nhr-46 locus, and 0.9 kb downstream. All remaining constructs were generated using the Infusion cloning technique (Clontech). The promoter fragments used for dpy-7 (hypoderm) (Gilleard et al., 1997), vha-6 (intestine) (Allman et al., 2009) rab-3 (neurons) (Mahoney et al., 2006) and unc-54 (muscle) (D. Ma, personal communication) contain 1.3, 0.9, 1.4, and 1.9 kb, respectively, of sequence upstream of the start codons of each of these genes. Expression of tissue-specific rescuing transgenes was confirmed using mCherry tagging. We noticed expression in some unidentified cells outside the body-wall muscle near the junction of the pharynx and intestine in the strain cyp-36A1(gk824636); agIs9; egl-9(sa307); nEx2859 [Punc-54::cyp-36A1 cDNA::F2A::mCherry::tbb-2 3'UTR, Pttx-3::mCherry::tbb-2 3’UTR]; such expression might contribute to rescue of the mutant phenotype in that strain. C45E5.6b was used for nhr-46 cDNA. F38A6.3a with a P621A stabilizing mutation was used for hif-1 cDNA (Pocock and Hobert, 2008). Where present, the F2A sequence served as a ribosomal skip sequence to cause separation of the two peptides encoded before and after the F2A (Ahier and Jarriault, 2014). Transgenic strains were generated by germline transformation as described (Mello et al., 1991). All transgenic constructs were injected at 2.5–50 ng/μl.

Mutagenesis screen for suppressors of egl-9

To screen for suppressors of the egl-9 egg-laying defect, we mutagenized egl-9(n586) mutants with ethyl methanesulfonate (EMS) as described previously (Brenner, 1974). The starting strain contained the Pcysl-2::gfp (nIs470) transgene, which is highly expressed in egl-9(lf) mutants and served as a reporter for HIF-1 activity (Ma et al., 2012). We used a dissecting microscope to screen the F2 progeny for suppression of the egg-laying defect (i.e. the Egl phenotype), picking (1) adults that appeared less Egl than egl-9(n586) mutants, and (2) eggs laid by the F2 animals that were at an earlier developmental stage than those laid by egl-9(n586) mutants. Screen isolates were backcrossed to determine dominant vs. recessive and single-gene inheritance pattern and crossed to him-8(e1489); egl-9(sa307) hif-1(ia4) to test complementation with hif-1(lf). The screen allele n5666, which conferred a recessive phenotype and was not allelic to hif-1, mapped between SNPs pkP1052 and rs3139013 on LGI with SNP mapping (Davis et al., 2005) using a strain containing egl-9(n586) introgressed into the Hawaiian strain CB4856 (Ma et al., 2013). Whole-genome sequencing identified a mutation in cyp-36A1 in the n5666 interval, and transgenic rescue demonstrated that this cyp-36A1 mutation is the causative mutation, as described in the text.

Mutagenesis screen for suppressors of cyp-36A1

To screen for downstream effectors of cyp-36A1, we mutagenized cyp-36A1(gk824636); egl-9(sa307) with ethyl methanesulfonate (EMS). The starting strain contained the PT24B8.5::gfp (agIs219) transgene, which has low expression in cyp-36A1(gk824636); egl-9(sa307) mutants and served as a reporter for CYP-36A1 activity. We used a dissecting microscope equipped to examine GFP fluorescence to screen for F2 progeny with high GFP fluorescence and an Egl appearance. The only two isolates failed to complement and were found to be alleles of nhr-46 by whole-genome sequencing and transgenic rescue. The mutant phenotypes of cyp-36A1(lf); n6126; egl-9(lf) were rescued by an nhr-46(+) transgene, demonstrating that the mutation in nhr-46 is the causative mutation and suggesting that n6126 is a loss-of-function allele.

Behavioral assays

To quantify egg-laying behavior, we scored the developmental stages of eggs laid by young adult hermaphrodites as described previously (Ringstad and Horvitz, 2008). Egg-laying defective mutants retain eggs longer in the uterus, thus laying them at later developmental stages. To examine egg-laying behavior after exposure to hypoxia, young adult animals were placed in a hypoxia chamber (Coy Laboratory) at 1% O2 balanced by N2 for 24 hr, after which the egg-laying assay was performed in normoxia. Control animals were exposed to room air (21% O2) for 24 hr; animals were randomly allocated to 1% or 21% O2 treatment. Locomotion assays were performed on bacterial food and quantified using a custom worm tracker, as described previously (Paquin et al., 2016). Defecation assays were performed as described previously (Thomas, 1990), counting the number of defecation cycles in ten minutes.

Pseudomonas aeruginosa killing assay

Sensitivity to the Pseudomonas aeruginosa strain PA14 was assayed using the big lawn killing assay as described previously (Reddy et al., 2009). The big lawn killing assay was used to remove any influence of avoidance behavior on survival, as wild-type PA14 avoidance is dependent on normal aerotaxis behavior (Reddy et al., 2009), and egl-9(lf) mutants have previously been shown to display abnormal aerotaxis (Chang and Bargmann, 2008).

Tunicamycin survival assay

Sensitivity to tunicamycin was assayed by placing at least 100 starvation-synchronized L1 animals on NGM plates containing 5 μg/ml tunicamycin (Sigma), made using 10 mg/ml tunicamycin stock in DMSO and seeded with E. coli OP50 bacteria. Survival to the L4 larval stage or later was determined after three days.

t-BOOH survival assay

Sensitivity to tert-butyl hydroperoxide (t-BOOH) was assayed by placing ~60 young adult worms on NGM plates containing 7.5 mM t-BOOH, made using 70% t-BOOH solution (Sigma) and seeded with E. coli OP50 bacteria. Survival was evaluated after 10 hr.

Microscopy

Epifluorescence images of PT4B8.5::gfp expression were obtained using an AxioImager Z2 upright microscope (Zeiss) and ZEN software (Zeiss). Confocal images of Pcyp-36A1::gfp expression were obtained using an LSM 800 instrument (Zeiss) and ZEN software. Fluorescence intensity for the PT24B8.5::gfp reporter was quantified by measuring average intensity in a 300 μm section of the intestine centered on the vulva using FIJI software. PT24B8.5::gfp reporter imaging conditions were optimized for observation of fluorescence in the midbody; fluorescence was not saturated in this region in quantified images.

RNA isolation for qRT-PCR and RNA-seq

All strains were maintained at 22.5°C for at least two generations without starvation prior to experiment. ~150 very young adults (0–1 eggs in uterus) were picked into M9 buffer and allowed to settle. M9 was aspirated, and worms were then rinsed twice with M9 and twice with RNase-free water. Excess liquid was aspirated and the pellet was frozen in liquid nitrogen. RLT buffer (QIAGEN) was added to the frozen pellet, and worms were lysed using a BeadBug microtube homogenizer (Sigma) and 0.5 mm zirconium beads (Sigma). RNA was extracted using the RNeasy Mini kit (QIAGEN) according to the manufacturer’s instructions.

cyp-36A1 mRNA expression analysis by qRT-PCR

Reverse transcription was performed using SuperScript III (Invitrogen). Quantitative PCR was performed using Applied Biosystems Real-Time PCR Instruments. Expression levels were normalized to the expression of the ribosomal subunit gene rpl-32.

Primers for qRT-PCR

cyp-36A1 F: ACCAGCTTGTCCAACACCAA

cyp-36A1 R: CACGCTTTGGCTCCCATTTC

rpl-32 F: GGCTACACGACGGTATCTGT

rpl-32 R: CAAGGTCGTCAAGAAGAAGC

RNA-seq library preparation

RNA integrity and concentration were checked on a Fragment Analyzer (Advanced Analytical). The mRNA was purified by polyA-tail enrichment, fragmented, and reverse transcribed into cDNA (Illumina TruSeq). cDNA samples were then end-repaired and adaptor-ligated using the SPRI-works Fragment Library System I (Beckman Coulter Genomics) and indexed during amplification. Libraries were quantified using the Fragment Analyzer (Advanced Analytical) and qPCR before being loaded for single-end sequencing using the Illumina HiSeq 2000.

RNA-seq data analysis

Reads were aligned against the C. elegans ce10 genome assembly using bwa 0.7.5a (Li and Durbin, 2009) and samtools/0.1.19 (1000 Genome Project Data Processing Subgroup et al., 2009) (bwa aln/bwa samse), and mapping rates, fraction of multiply-mapping reads, number of unique 20-mers at the 5’ end of the reads, insert size distributions and fraction of ribosomal RNAs were calculated using dedicated perl scripts and bedtools v. 2.17.0 (Quinlan and Hall, 2010). For expression analysis, reads were aligned against the C. elegans ce10 genome/ENSEMBL 65 annotation using RSEM 1.2.15 (Li and Dewey, 2011) and bowtie 1.0.1 (Langmead et al., 2009), with the following parameters: -p 6 --bowtie-chunkmbs 1024 --output-genome-bam. Raw expected read counts were retrieved and used for differential expression analysis with Bioconductor’s edgeR package in the R 3.2.3 statistical environment (Robinson et al., 2010). First, common, trended, and gene-specific read dispersion across sequencing libraries and genes was estimated using the estimateDisp function. Given the small number of replicates, a gene-wise negative binomial generalized linear model (GLM) with quasi-likelihood tests (as implemented in the glmQLFit function) was used to test for differential expression between conditions (Lun et al., 2016). Briefly, this statistical framework works by first fitting the observed and expected distributions of read counts for each gene across conditions using a GLM, which is based on the negative binomial distribution and the observed read dispersion. The significance of biases in read counts is then tested using the quasi-likelihood F-test (implemented in glmQLFTest). This test provides more robust and reliable error rate control at low number of replicates, because it reflects the uncertainty in read distribution better than the likelihood ratio test. Models were fitted across all conditions and relevant differential expression testing was performed using glmQLFTest between pairs of conditions of interest. P values were adjusted for multiple comparisons using the Benjamini-Hochberg procedure (Benjamini and Hochberg, 1995). Gene ontology enrichment analysis was performed using GOrilla (Eden et al., 2009), examining genes that were significantly downregulated in cyp-36A1(lf); egl-9(lf) double mutants vs. egl-9(lf) single mutants (i.e. orange circle in Figure 2B) as compared to genes that were at least twofold upregulated in egl-9(lf) mutants vs. wild type (adjusted p value<0.05) and significantly downregulated in egl-9(lf) hif-1(lf) vs. egl-9(lf) (adjusted p value<0.05) (i.e. purple circle in Figure 2B).

Statistical analysis

Chi-square tests were used to compare the distribution of stages of eggs laid by wild-type and mutant animals. Unpaired t-tests were used to compare cyp-36A1 mRNA expression between strains, survival on tunicamycin between strains, survival on t-BOOH between strains, and PT24B8.5::gfp reporter fluorescence intensity between strains. Log-rank (Mantel-Cox) tests were used to compare survival of different strains on Pseudomonas aeruginosa. In cases of multiple comparisons, a Holm-Bonferroni correction was applied. Statistical tests were performed using GraphPad Prism software (Graphpad Prism, RRID:SCR_002798) version 7.0a. Biological replicates were performed using separate populations of animals.

Accession numbers

The GEO accession number for the RNA-seq dataset in this paper is GSE108283.

Acknowledgements

We thank K Burkhart, A Doi, S Sando, V Dwivedi, J Saul, E Lee, JN Kong, and D Ghosh for helpful discussion. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

H Robert Horvitz, Email: horvitz@mit.edu.

Matt Kaeberlein, University of Washington, United States.

Didier YR Stainier, Max Planck Institute for Heart and Lung Research, Germany.

Funding Information

This paper was supported by the following grants:

  • National Institutes of Health GM024663 to Corinne L Pender, H Robert Horvitz.

  • Howard Hughes Medical Institute to Corinne L Pender, H Robert Horvitz.

  • National Institutes of Health T32GM007287 to Corinne L Pender.

Additional information

Competing interests

No competing interests declared.

Author contributions

Conceptualization, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing—original draft, Writing—review and editing.

Conceptualization, Supervision, Funding acquisition, Visualization, Methodology, Writing—review and editing.

Additional files

Supplementary file 1. Genes that were significantly differentially expressed between wild type and egl-9(lf) and at least twofold downregulated in egl-9(lf) vs. wild type.
elife-36828-supp1.xlsx (327.9KB, xlsx)
DOI: 10.7554/eLife.36828.019
Supplementary file 2. Genes that were significantly differentially expressed between wild type and egl-9(lf) and at least twofold upregulated in egl-9(lf) vs. wild type.
elife-36828-supp2.xlsx (137.3KB, xlsx)
DOI: 10.7554/eLife.36828.020
Transparent reporting form
elife-36828-transrepform.pdf (314.7KB, pdf)
DOI: 10.7554/eLife.36828.021

Data availability

Sequencing data have been deposited in GEO under accession code GSE108283.

The following dataset was generated:

Pender CL, author; Horvitz HR, author. Hypoxia-inducible factor cell non-autonomously regulates C. elegans stress responses and behavior via a nuclear receptor. 2017 www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE108283 Publicly available at the NCBI Gene Expression Omnibus (accession no: GSE108283).

References

  1. Agundez JA. Cytochrome P450 gene polymorphism and cancer. Current Drug Metabolism. 2004;5:211–224. doi: 10.2174/1389200043335621. [DOI] [PubMed] [Google Scholar]
  2. Ahier A, Jarriault S. Simultaneous expression of multiple proteins under a single promoter in Caenorhabditis elegans via a versatile 2A-based toolkit. Genetics. 2014;196:605–613. doi: 10.1534/genetics.113.160846. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Allman E, Johnson D, Nehrke K. Loss of the apical V-ATPase a-subunit VHA-6 prevents acidification of the intestinal lumen during a rhythmic behavior in C. elegans. American Journal of Physiology-Cell Physiology. 2009;297:C1071–C1081. doi: 10.1152/ajpcell.00284.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Angeles-Albores D, Puckett Robinson C, Williams BA, Wold BJ, Sternberg PW. Reconstructing a metazoan genetic pathway with transcriptome-wide epistasis measurements. Proceedings of the National Academy of Sciences. 2018;115:E2930–E2939. doi: 10.1073/pnas.1712387115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bellier A, Chen CS, Kao CY, Cinar HN, Aroian RV. Hypoxia and the hypoxic response pathway protect against pore-forming toxins in C. elegans. PLoS Pathogens. 2009;5:e1000689. doi: 10.1371/journal.ppat.1000689. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Benjamini Y, Hochberg Y. Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of the Royal Statistical Society. Series B. 1995;57:289–300. [Google Scholar]
  7. Bishop T, Lau KW, Epstein AC, Kim SK, Jiang M, O'Rourke D, Pugh CW, Gleadle JM, Taylor MS, Hodgkin J, Ratcliffe PJ. Genetic analysis of pathways regulated by the von Hippel-Lindau tumor suppressor in Caenorhabditis elegans. PLoS Biology. 2004;2:e289. doi: 10.1371/journal.pbio.0020289. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Brenner S. The genetics of Caenorhabditis elegans. Genetics. 1974;77:71–94. doi: 10.1093/genetics/77.1.71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Budde MW, Roth MB. The response of Caenorhabditis elegans to hydrogen sulfide and hydrogen cyanide. Genetics. 2011;189:521–532. doi: 10.1534/genetics.111.129841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cai Z, Luo W, Zhan H, Semenza GL. Hypoxia-inducible factor 1 is required for remote ischemic preconditioning of the heart. PNAS. 2013;110:17462–17467. doi: 10.1073/pnas.1317158110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chang AJ, Bargmann CI. Hypoxia and the HIF-1 transcriptional pathway reorganize a neuronal circuit for oxygen-dependent behavior in Caenorhabditis elegans. PNAS. 2008;105:7321–7326. doi: 10.1073/pnas.0802164105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Chen D, Thomas EL, Kapahi P. HIF-1 modulates dietary restriction-mediated lifespan extension via IRE-1 in Caenorhabditis elegans. PLoS Genetics. 2009;5:e1000486. doi: 10.1371/journal.pgen.1000486. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Darby C, Cosma CL, Thomas JH, Manoil C. Lethal paralysis of Caenorhabditis elegans by Pseudomonas aeruginosa. PNAS. 1999;96:15202–15207. doi: 10.1073/pnas.96.26.15202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Davis MW, Hammarlund M, Harrach T, Hullett P, Olsen S, Jorgensen EM. Rapid single nucleotide polymorphism mapping in C. elegans. BMC Genomics. 2005;6:118. doi: 10.1186/1471-2164-6-118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Dennis EA, Norris PC. Eicosanoid storm in infection and inflammation. Nature Reviews Immunology. 2015;15:511–523. doi: 10.1038/nri3859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Eden E, Navon R, Steinfeld I, Lipson D, Yakhini Z. GOrilla: a tool for discovery and visualization of enriched GO terms in ranked gene lists. BMC Bioinformatics. 2009;10:48. doi: 10.1186/1471-2105-10-48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Elbekai RH, El-Kadi AO. Cytochrome P450 enzymes: central players in cardiovascular health and disease. Pharmacology & Therapeutics. 2006;112:564–587. doi: 10.1016/j.pharmthera.2005.05.011. [DOI] [PubMed] [Google Scholar]
  18. Epstein AC, Gleadle JM, McNeill LA, Hewitson KS, O'Rourke J, Mole DR, Mukherji M, Metzen E, Wilson MI, Dhanda A, Tian YM, Masson N, Hamilton DL, Jaakkola P, Barstead R, Hodgkin J, Maxwell PH, Pugh CW, Schofield CJ, Ratcliffe PJ. C. elegans EGL-9 and mammalian homologs define a family of dioxygenases that regulate HIF by prolyl hydroxylation. Cell. 2001;107:43–54. doi: 10.1016/S0092-8674(01)00507-4. [DOI] [PubMed] [Google Scholar]
  19. Evans RM, Mangelsdorf DJ. Nuclear receptors, RXR, and the big bang. Cell. 2014;157:255–266. doi: 10.1016/j.cell.2014.03.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Fawcett EM, Hoyt JM, Johnson JK, Miller DL. Hypoxia disrupts proteostasis in Caenorhabditis elegans. Aging Cell. 2015;14:92–101. doi: 10.1111/acel.12301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Feng H, Craig H, Hope I. Expression pattern analysis of regulatory transcription factors in Caenorhabditis elegans. In: Deplancke B, Gheldof N, editors. Gene Regulatory Networks. Humana Press; 2012. pp. 21–50. [DOI] [PubMed] [Google Scholar]
  22. Gerisch B, Antebi A. Hormonal signals produced by DAF-9/cytochrome P450 regulate C. elegans dauer diapause in response to environmental cues. Development. 2004;131:1765–1776. doi: 10.1242/dev.01068. [DOI] [PubMed] [Google Scholar]
  23. Gilleard JS, Barry JD, Johnstone IL. cis regulatory requirements for hypodermal cell-specific expression of the Caenorhabditis elegans cuticle collagen gene dpy-7. Molecular and Cellular Biology. 1997;17:2301–2311. doi: 10.1128/MCB.17.4.2301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Hobert O. PCR fusion-based approach to create reporter gene constructs for expression analysis in transgenic C. elegans. BioTechniques. 2002;32:728–730. doi: 10.2144/02324bm01. [DOI] [PubMed] [Google Scholar]
  25. Ivan M, Kondo K, Yang H, Kim W, Valiando J, Ohh M, Salic A, Asara JM, Lane WS, Kaelin WG, Jr WGK. HIFalpha targeted for VHL-mediated destruction by proline hydroxylation: implications for O2 sensing. Science. 2001;292:464–468. doi: 10.1126/science.1059817. [DOI] [PubMed] [Google Scholar]
  26. Jaakkola P, Mole DR, Tian YM, Wilson MI, Gielbert J, Gaskell SJ, von Kriegsheim A, Hebestreit HF, Mukherji M, Schofield CJ, Maxwell PH, Pugh CW, Ratcliffe PJ. Targeting of HIF-alpha to the von Hippel-Lindau ubiquitylation complex by O2-regulated prolyl hydroxylation. Science. 2001;292:468–472. doi: 10.1126/science.1059796. [DOI] [PubMed] [Google Scholar]
  27. Jiang H, Guo R, Powell-Coffman JA. The Caenorhabditis elegans hif-1 gene encodes a bHLH-PAS protein that is required for adaptation to hypoxia. PNAS. 2001;98:7916–7921. doi: 10.1073/pnas.141234698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kaelin WG, Ratcliffe PJ. Oxygen sensing by metazoans: the central role of the HIF hydroxylase pathway. Molecular Cell. 2008;30:393–402. doi: 10.1016/j.molcel.2008.04.009. [DOI] [PubMed] [Google Scholar]
  29. Kirienko NV, Kirienko DR, Larkins-Ford J, Wählby C, Ruvkun G, Ausubel FM. Pseudomonas aeruginosa disrupts Caenorhabditis elegans iron homeostasis, causing a hypoxic response and death. Cell Host & Microbe. 2013;13:406–416. doi: 10.1016/j.chom.2013.03.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kudron MM, Victorsen A, Gevirtzman L, Hillier LW, Fisher WW, Vafeados D, Kirkey M, Hammonds AS, Gersch J, Ammouri H, Wall ML, Moran J, Steffen D, Szynkarek M, Seabrook-Sturgis S, Jameel N, Kadaba M, Patton J, Terrell R, Corson M, Durham TJ, Park S, Samanta S, Han M, Xu J, Yan KK, Celniker SE, White KP, Ma L, Gerstein M, Reinke V, Waterston RH. The ModERN resource: genome-wide binding profiles for hundreds of Drosophila and Caenorhabditis elegans Transcription Factors. Genetics. 2018;208:937–949. doi: 10.1534/genetics.117.300657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology. 2009;10:R25. doi: 10.1186/gb-2009-10-3-r25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Lee SJ, Hwang AB, Kenyon C. Inhibition of respiration extends C. elegans life span via reactive oxygen species that increase HIF-1 activity. Current Biology. 2010;20:2131–2136. doi: 10.1016/j.cub.2010.10.057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Leiser SF, Miller H, Rossner R, Fletcher M, Leonard A, Primitivo M, Rintala N, Ramos FJ, Miller DL, Kaeberlein M. Cell nonautonomous activation of flavin-containing monooxygenase promotes longevity and health span. Science. 2015;350:1375–1378. doi: 10.1126/science.aac9257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Li B, Dewey CN. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics. 2011;12:323. doi: 10.1186/1471-2105-12-323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009;25:1754–1760. doi: 10.1093/bioinformatics/btp324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, 1000 Genome Project Data Processing Subgroup The sequence alignment/Map format and SAMtools. Bioinformatics. 2009;25:2078–2079. doi: 10.1093/bioinformatics/btp352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Lim Y, Lee D, Kalichamy K, Hong SE, Michalak M, Ahnn J, Kim DH, Lee SK. Sumoylation regulates ER stress response by modulating calreticulin gene expression in XBP-1-dependent mode in Caenorhabditis elegans. International Journal of Biochemistry & Cell Biology. 2014;53:399–408. doi: 10.1016/j.biocel.2014.06.005. [DOI] [PubMed] [Google Scholar]
  38. Lun ATL, Chen Y, Smyth GK. It’s DE-Licious: A Recipe for Differential Expression Analyses of RNA-Seq Experiments Using Quasi-Likelihood Methods in edgeRStatistical Genomics. New York, NY: Humana Press; 2016. pp. 391–416. [DOI] [PubMed] [Google Scholar]
  39. Ma DK, Rothe M, Zheng S, Bhatla N, Pender CL, Menzel R, Horvitz HR. Cytochrome P450 drives a HIF-regulated behavioral response to reoxygenation by C. elegans. Science. 2013;341:554–558. doi: 10.1126/science.1235753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Ma DK, Vozdek R, Bhatla N, Horvitz HR. CYSL-1 interacts with the O2-sensing hydroxylase EGL-9 to promote H2S-modulated hypoxia-induced behavioral plasticity in C. elegans. Neuron. 2012;73:925–940. doi: 10.1016/j.neuron.2011.12.037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Mahoney TR, Liu Q, Itoh T, Luo S, Hadwiger G, Vincent R, Wang ZW, Fukuda M, Nonet ML. Regulation of synaptic transmission by RAB-3 and RAB-27 in Caenorhabditis elegans. Molecular Biology of the Cell. 2006;17:2617–2625. doi: 10.1091/mbc.e05-12-1170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Maxwell PH, Wiesener MS, Chang GW, Clifford SC, Vaux EC, Cockman ME, Wykoff CC, Pugh CW, Maher ER, Ratcliffe PJ. The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature. 1999;399:271–275. doi: 10.1038/20459. [DOI] [PubMed] [Google Scholar]
  43. Mehta R, Steinkraus KA, Sutphin GL, Ramos FJ, Shamieh LS, Huh A, Davis C, Chandler-Brown D, Kaeberlein M. Proteasomal regulation of the hypoxic response modulates aging in C. elegans. Science. 2009;324:1196–1198. doi: 10.1126/science.1173507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Mello CC, Kramer JM, Stinchcomb D, Ambros V. Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. The EMBO Journal. 1991;10:3959. doi: 10.1002/j.1460-2075.1991.tb04966.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Miller DL, Roth MB. C. elegans are protected from lethal hypoxia by an embryonic diapause. Current Biology. 2009;19:1233–1237. doi: 10.1016/j.cub.2009.05.066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Mole DR, Blancher C, Copley RR, Pollard PJ, Gleadle JM, Ragoussis J, Ratcliffe PJ. Genome-wide association of hypoxia-inducible factor (HIF)-1alpha and HIF-2alpha DNA binding with expression profiling of hypoxia-inducible transcripts. Journal of Biological Chemistry. 2009;284:16767–16775. doi: 10.1074/jbc.M901790200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Nakazawa MS, Keith B, Simon MC. Oxygen availability and metabolic adaptations. Nature Reviews Cancer. 2016;16:663–673. doi: 10.1038/nrc.2016.84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Nebert DW, Wikvall K, Miller WL. Human cytochromes P450 in health and disease. Philosophical Transactions of the Royal Society B: Biological Sciences. 2013;368:20120431. doi: 10.1098/rstb.2012.0431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Olenchock BA, Moslehi J, Baik AH, Davidson SM, Williams J, Gibson WJ, Chakraborty AA, Pierce KA, Miller CM, Hanse EA, Kelekar A, Sullivan LB, Wagers AJ, Clish CB, Vander Heiden MG, Kaelin WG. EGLN1 inhibition and rerouting of α-Ketoglutarate suffice for remote ischemic protection. Cell. 2016;164:884–895. doi: 10.1016/j.cell.2016.02.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Palazon A, Goldrath AW, Nizet V, Johnson RS. HIF transcription factors, inflammation, and immunity. Immunity. 2014;41:518–528. doi: 10.1016/j.immuni.2014.09.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Paquin N, Murata Y, Froehlich A, Omura DT, Ailion M, Pender CL, Constantine-Paton M, Horvitz HR. The conserved VPS-50 protein functions in dense-core vesicle maturation and acidification and controls animal behavior. Current Biology. 2016;26:862–871. doi: 10.1016/j.cub.2016.01.049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Park SK, Tedesco PM, Johnson TE. Oxidative stress and longevity in Caenorhabditis elegans as mediated by SKN-1. Aging Cell. 2009;8:258–269. doi: 10.1111/j.1474-9726.2009.00473.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Pocock R, Hobert O. Oxygen levels affect axon guidance and neuronal migration in Caenorhabditis elegans. Nature Neuroscience. 2008;11:894–900. doi: 10.1038/nn.2152. [DOI] [PubMed] [Google Scholar]
  54. Pocock R, Hobert O. Hypoxia activates a latent circuit for processing gustatory information in C. elegans. Nature Neuroscience. 2010;13:610–614. doi: 10.1038/nn.2537. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Powell-Coffman JA. Hypoxia signaling and resistance in C. elegans. Trends in Endocrinology & Metabolism. 2010;21:435–440. doi: 10.1016/j.tem.2010.02.006. [DOI] [PubMed] [Google Scholar]
  56. Prahlad V, Morimoto RI. Integrating the stress response: lessons for neurodegenerative diseases from C. elegans. Trends in Cell Biology. 2009;19:52–61. doi: 10.1016/j.tcb.2008.11.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Quinlan AR, Hall IM. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. 2010;26:841–842. doi: 10.1093/bioinformatics/btq033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Ratcliffe PJ. Oxygen sensing and hypoxia signalling pathways in animals: the implications of physiology for cancer. Journal of Physiology. 2013;591:2027–2042. doi: 10.1113/jphysiol.2013.251470. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Reddy KC, Andersen EC, Kruglyak L, Kim DH. A polymorphism in npr-1 is a behavioral determinant of pathogen susceptibility in C. elegans. Science. 2009;323:382–384. doi: 10.1126/science.1166527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Rendic S, Guengerich FP. Survey of human oxidoreductases and cytochrome P450 enzymes involved in the metabolism of xenobiotic and natural chemicals. Chemical Research in Toxicology. 2015;28:38–42. doi: 10.1021/tx500444e. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Ringstad N, Horvitz HR. FMRFamide neuropeptides and acetylcholine synergistically inhibit egg-laying by C. elegans. Nature Neuroscience. 2008;11:1168–1176. doi: 10.1038/nn.2186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26:139–140. doi: 10.1093/bioinformatics/btp616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Rowland A, Mangoni AA. Cytochrome P450 and ischemic heart disease: current concepts and future directions. Expert Opinion on Drug Metabolism & Toxicology. 2014;10:191–213. doi: 10.1517/17425255.2014.859675. [DOI] [PubMed] [Google Scholar]
  64. Schito L, Rey S. Cell-Autonomous metabolic reprogramming in hypoxia. Trends in Cell Biology. 2018;28:128–142. doi: 10.1016/j.tcb.2017.10.006. [DOI] [PubMed] [Google Scholar]
  65. Schuster I, Bernhardt R. Inhibition of cytochromes P450: existing and new promising therapeutic targets. Drug Metabolism Reviews. 2007;39:481–499. doi: 10.1080/03602530701498455. [DOI] [PubMed] [Google Scholar]
  66. Schödel J, Oikonomopoulos S, Ragoussis J, Pugh CW, Ratcliffe PJ, Mole DR. High-resolution genome-wide mapping of HIF-binding sites by ChIP-seq. Blood. 2011;117:e207–e217. doi: 10.1182/blood-2010-10-314427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Semenza GL. Oxygen sensing, homeostasis, and disease. New England Journal of Medicine. 2011;365:537–547. doi: 10.1056/NEJMra1011165. [DOI] [PubMed] [Google Scholar]
  68. Semenza GL. Hypoxia-inducible factors in physiology and medicine. Cell. 2012;148:399–408. doi: 10.1016/j.cell.2012.01.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Shao Z, Zhang Y, Ye Q, Saldanha JN, Powell-Coffman JA. C. elegans SWAN-1 binds to EGL-9 and regulates HIF-1-mediated resistance to the bacterial pathogen Pseudomonas aeruginosa PAO1. PLoS Pathogens. 2010;6:e1001075. doi: 10.1371/journal.ppat.1001075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Shen C, Nettleton D, Jiang M, Kim SK, Powell-Coffman JA. Roles of the HIF-1 hypoxia-inducible factor during hypoxia response in Caenorhabditis elegans. Journal of Biological Chemistry. 2005;280:20580–20588. doi: 10.1074/jbc.M501894200. [DOI] [PubMed] [Google Scholar]
  71. Shivers RP, Kooistra T, Chu SW, Pagano DJ, Kim DH. Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans. Cell Host & Microbe. 2009;6:321–330. doi: 10.1016/j.chom.2009.09.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Shore DE, Ruvkun G. A cytoprotective perspective on longevity regulation. Trends in Cell Biology. 2013;23:409–420. doi: 10.1016/j.tcb.2013.04.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Simonson TS, Yang Y, Huff CD, Yun H, Qin G, Witherspoon DJ, Bai Z, Lorenzo FR, Xing J, Jorde LB, Prchal JT, Ge R. Genetic evidence for high-altitude adaptation in Tibet. Science. 2010;329:72–75. doi: 10.1126/science.1189406. [DOI] [PubMed] [Google Scholar]
  74. Taylor RC, Berendzen KM, Dillin A. Systemic stress signalling: understanding the cell non-autonomous control of proteostasis. Nature Reviews Molecular Cell Biology. 2014;15:211–217. doi: 10.1038/nrm3752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Thomas JH. Genetic analysis of defecation in Caenorhabditis elegans. Genetics. 1990;124:855–872. doi: 10.1093/genetics/124.4.855. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Thompson O, Edgley M, Strasbourger P, Flibotte S, Ewing B, Adair R, Au V, Chaudhry I, Fernando L, Hutter H, Kieffer A, Lau J, Lee N, Miller A, Raymant G, Shen B, Shendure J, Taylor J, Turner EH, Hillier LW, Moerman DG, Waterston RH. The million mutation project: a new approach to genetics in Caenorhabditis elegans. Genome Research. 2013;23:1749–1762. doi: 10.1101/gr.157651.113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Treinin M, Shliar J, Jiang H, Powell-Coffman JA, Bromberg Z, Horowitz M. HIF-1 is required for heat acclimation in the nematode Caenorhabditis elegans. Physiological Genomics. 2003;14:17–24. doi: 10.1152/physiolgenomics.00179.2002. [DOI] [PubMed] [Google Scholar]
  78. Trent C, Tsuing N, Horvitz HR. Egg-laying defective mutants of the nematode Caenorhabditis elegans. Genetics. 1983;104:619–647. doi: 10.1093/genetics/104.4.619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Wang GL, Jiang BH, Rue EA, Semenza GL. Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. PNAS. 1995;92:5510–5514. doi: 10.1073/pnas.92.12.5510. [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Wouters BG, Koritzinsky M. Hypoxia signalling through mTOR and the unfolded protein response in cancer. Nature Reviews Cancer. 2008;8:851–864. doi: 10.1038/nrc2501. [DOI] [PubMed] [Google Scholar]
  81. Zhang Y, Shao Z, Zhai Z, Shen C, Powell-Coffman JA. The HIF-1 hypoxia-inducible factor modulates lifespan in C. elegans. PLoS One. 2009;4:e6348. doi: 10.1371/journal.pone.0006348. [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision letter

Editor: Matt Kaeberlein1

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "Hypoxia-inducible factor cell non-autonomously regulates C. elegans stress responses and behavior via a nuclear receptor" for consideration by eLife. Your article has been reviewed by three peer reviewers, including Matt Kaeberlein as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Didier Stainier as the Senior Editor.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

Pender and Horvitz describe a new mechanism by which HIF-1 activity in neurons regulates gene expression in a cell non-autonomous fashion to control egg laying and stress resistance in C. elegans. This is a nicely constructed and mostly complete story that makes a compelling case for the model that activation of HIF-1 in neurons directly induces expression of CYP-36A1 in neurons which then acts cell non-autonomously to suppress the activity of NHR-46 in intestine and perhaps other tissues. Suppression of NHR-46 activity by this model then drives both the egg-laying defect and the enhanced resistance to specific stressors including P. aeruginosa, tunicamycin, and t-BOOH. All three reviewers appreciated the importance and interest of the study and were generally supportive of publication, with a few significant comments that the authors should be able to address.

Major Comments:

1) What happens in the nhr-46(lf) single mutant to egg laying and stress resistance? According to the model, this mutant should show both phenotypes, but I didn't see that data included. If the mutant does not show these phenotypes, how can the current model explain that?

2) The assertions made in the manuscript are generally strongly supported by the data provided, but the evidence that cyp-36A1 regulates gene expression cell non-autonomously and through the downstream effector nhr-46 in Figure 3 could perhaps be strengthened. The images shown are intriguing, but the use of only the midbody region, lack of quantification, and the data showing that every transgene rescued the T24B8.5 induction gets very "hand-wavy" to this reviewer. At the very least, it would be nice to have full images, a reproducible method of quantification, and a better explanation for why the midbody would be more important, and that this isn't an artifact of modified transport, delayed signaling, or GFP buildup (each of which could be interesting on their own). The assertion that CYP-36A1 generates a diffusible signal is reasonable, but other explanations exist and the lack of any negative transgenic data is confounding. In addition, there seems (from the images), to be a lot of worm to worm variation, which is unexplained and not statistically or experimentally examined.

3) Related to #2, similar concerns about the lack of quantification and unclear statistical rigor apply to GFP images in other figures. How many times were these experiments replicated? 3-5 animals in one experiment is not sufficient. Were the tissue restrictions on gene expression in tissue-specific lines confirmed in any way?

4) Although the rescue of the n5666 mutation by a transgene carrying the cyp-36A1 gene provides strong evidence that the n5666 mutation is a recessive allele and likely a loss-of-function allele. Given this, does RNAi knockdown of cyp-36A1 recapitulate the same phenotype? This would seem to be a trivial experiment that would strengthen the authors' model. Is the n5666 mutation expected to cause a loss of function in the protein, perhaps through disruption of a conserved domain?

eLife. 2018 Jul 16;7:e36828. doi: 10.7554/eLife.36828.026

Author response

Major Comments:

1) What happens in the nhr-46(lf) single mutant to egg laying and stress resistance? According to the model, this mutant should show both phenotypes, but I didn't see that data included. If the mutant does not show these phenotypes, how can the current model explain that?

nhr-46(lf) single mutants display wild-type egg laying (added to manuscript; Figure 4D) and nearly wild-type stress resistance (Figures 4E, 4F, and 4G), though they have increased expression of the PT24B8.5::gfp reporter, similar to cyp-36A1(lf); nhr-46(lf); egl-9(lf) mutants (added to manuscript; Figures 4B and 4C). We have updated the manuscript to include this information as well as our interpretation of this interesting result (subsection “A screen for suppressors of cyp-36A1(lf) identifies the nuclear receptor gene nhr-46”). Specifically, we suggest that at least one additional pathway downstream of egl-9 acts in parallel to nhr-46 to regulate egl-9-mediated modulation of egg laying and stress resistance, though at least some gene expression changes can be mediated by nhr-46 alone:

“Interestingly, nhr-46(lf) single mutants display wild-type egg laying (Figure 4D), tunicamycin resistance (Figure 4F), and oxidative stress resistance (Figure 4G), and nearly wild-type survival on Pseudomonas (Figure 4E and Figure 4—figure supplement 2), indicating that in addition to nhr-46 at least one other pathway is required to transduce egl-9-mediated modulation of egg laying and stress resistance. For example, in egl-9(lf) mutants or hypoxia, HIF-1 might drive expression of two (or more) targets that act together to inhibit egg laying and promote stress resistance. Thus, cyp-36A1 activation and consequent nhr-46 inhibition would promote egg-laying inhibition and stress resistance in egl-9(lf) mutant animals – in which this second pathway was also activated – but not in nhr-46(lf) single mutants – in which this second pathway was not activated. nhr-46(lf) single mutants have increased expression of the PT24B8.5::gfp reporter (Figures 4B, 4C and figure 4—figure supplement 1), suggesting that at least some gene expression changes can be mediated by nhr-46 alone.”

2) The assertions made in the manuscript are generally strongly supported by the data provided, but the evidence that cyp-36A1 regulates gene expression cell non-autonomously and through the downstream effector nhr-46 in Figure 3 could perhaps be strengthened. The images shown are intriguing, but the use of only the midbody region, lack of quantification, and the data showing that every transgene rescued the T24B8.5 induction gets very "hand-wavy" to this reviewer. At the very least, it would be nice to have full images, a reproducible method of quantification, and a better explanation for why the midbody would be more important, and that this isn't an artifact of modified transport, delayed signaling, or GFP buildup (each of which could be interesting on their own). The assertion that CYP-36A1 generates a diffusible signal is reasonable, but other explanations exist and the lack of any negative transgenic data is confounding. In addition, there seems (from the images), to be a lot of worm to worm variation, which is unexplained and not statistically or experimentally examined.

We have updated all images to show whole worms rather than just the midbody. We have also quantified fluorescence for all images and, although there is worm-to-worm variability as the reviewers note, we find statistical significance for all previously-described differences in fluorescence intensity.

Regarding the importance of midbody expression, as can now be observed with the whole-worm images, we do see differences in the expression in the foregut and hindgut as well. However, expression of the reporter is higher in the foregut and hindgut than in the midgut in all strains, including the wild type (as shown previously, Shivers et al., 2010), such that expression changes are most easily observed in the midbody. To quantify fluorescence, we assessed average intensity in a 300 μm section of the intestine centered on the vulva, as is now described in Materials and methods.

Regarding the lack of negative transgenic data, we hypothesize that expressing cyp-36A1 in a much more restricted set of cells would not be sufficient to rescue cyp-36A1(lf), more because of a lower overall level of expression than because of a specific localization. We do not believe that such experiments would add substantially to this manuscript. The expression patterns for rescue constructs were confirmed as described below.

3) Related to #2, similar concerns about the lack of quantification and unclear statistical rigor apply to GFP images in other figures. How many times were these experiments replicated? 3-5 animals in one experiment is not sufficient. Were the tissue restrictions on gene expression in tissue-specific lines confirmed in any way?

We agree with these concerns. We have increased the number of animals per experiment to 10, have performed each experiment in duplicate, and have quantified and performed statistical analysis on fluorescence intensity, as described above and in Materials and methods.

Hypoderm and muscle-specific HIF-1-expressing strains have been characterized previously (Pocock and Hobert, 2008). For all other tissue-specific constructs, we have added an mCherry tag to the relevant cDNA and confirmed correct expression, as described in the Materials and methods.

4) Although the rescue of the n5666 mutation by a transgene carrying the cyp-36A1 gene provides strong evidence that the n5666 mutation is a recessive allele and likely a loss-of-function allele. Given this, does RNAi knockdown of cyp-36A1 recapitulate the same phenotype? This would seem to be a trivial experiment that would strengthen the authors' model. Is the n5666 mutation expected to cause a loss of function in the protein, perhaps through disruption of a conserved domain?

The gk824636 nonsense allele of cyp-36A1 causes the same mutant phenotype as n5666 (Figure 3—figure supplement 3C). The residue altered by the n5666 mutation is indeed a conserved glycine (e.g. conserved in the closest human homolog CYP2A6), suggesting that it is important for CYP-36A1 function. These observations strongly support our statement that n5666 is likely a reduction-of-function allele. RNAi knockdown of cyp-36A1 does not recapitulate the n5666 mutant phenotype; however, RNAi-mediated knockdown might not sufficiently reduce CYP-36A1 activity to cause the same phenotype as the mutant.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Figure 2—source data 1. RNA-seq GO enrichment analysis.

    Gene ontology enrichment analysis terms for genes more than twofold upregulated in egl-9 mutants and significantly suppressed by hif-1(lf) and cyp-36A1(lf).

    elife-36828-fig2-data1.xlsx (48.7KB, xlsx)
    DOI: 10.7554/eLife.36828.007
    Supplementary file 1. Genes that were significantly differentially expressed between wild type and egl-9(lf) and at least twofold downregulated in egl-9(lf) vs. wild type.
    elife-36828-supp1.xlsx (327.9KB, xlsx)
    DOI: 10.7554/eLife.36828.019
    Supplementary file 2. Genes that were significantly differentially expressed between wild type and egl-9(lf) and at least twofold upregulated in egl-9(lf) vs. wild type.
    elife-36828-supp2.xlsx (137.3KB, xlsx)
    DOI: 10.7554/eLife.36828.020
    Transparent reporting form
    elife-36828-transrepform.pdf (314.7KB, pdf)
    DOI: 10.7554/eLife.36828.021

    Data Availability Statement

    Sequencing data have been deposited in GEO under accession code GSE108283.

    The following dataset was generated:

    Pender CL, author; Horvitz HR, author. Hypoxia-inducible factor cell non-autonomously regulates C. elegans stress responses and behavior via a nuclear receptor. 2017 www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE108283 Publicly available at the NCBI Gene Expression Omnibus (accession no: GSE108283).

    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES