Abstract
The nuclear factor erythroid 2‐like 2 (NRF2) is the master regulator of endogenous antioxidant responses. Oxidative damage is a shared and early‐appearing feature in X‐linked adrenoleukodystrophy (X‐ALD) patients and the mouse model (Abcd1 null mouse). This rare neurometabolic disease is caused by the loss of function of the peroxisomal transporter ABCD1, leading to an accumulation of very long‐chain fatty acids and the induction of reactive oxygen species of mitochondrial origin. Here, we identify an impaired NRF2 response caused by aberrant activity of GSK‐3β. We find that GSK‐3β inhibitors can significantly reactivate the blunted NRF2 response in patients’ fibroblasts. In the mouse models (Abcd1 − and Abcd1 −/Abcd2 −/− mice), oral administration of dimethyl fumarate (DMF/BG12/Tecfidera), an NRF2 activator in use for multiple sclerosis, normalized (i) mitochondrial depletion, (ii) bioenergetic failure, (iii) oxidative damage, and (iv) inflammation, highlighting an intricate cross‐talk governing energetic and redox homeostasis in X‐ALD. Importantly, DMF halted axonal degeneration and locomotor disability suggesting that therapies activating NRF2 hold therapeutic potential for X‐ALD and other axonopathies with impaired GSK‐3β/NRF2 axis.
Keywords: adrenoleukodystrophy, dimethyl fumarate, GSK‐3, NRF2, oxidative stress
Subject Categories: Genetics, Gene Therapy & Genetic Disease; Metabolism; Neuroscience
Introduction
Oxidative stress and mitochondrial dysfunction contribute to the onset and progression of age‐related neurodegenerative diseases, such as amyotrophic lateral sclerosis, Parkinson's, Huntington's, and Alzheimer's disease (Lin & Beal, 2006). A common theme among these disorders, as well as the prototypic demyelinating disease multiple sclerosis, is axonal degeneration (Li et al, 2001; Tallantyre et al, 2010).
Endogenous antioxidant responses are controlled by nuclear factor erythroid 2‐like 2 (NRF2, encoded by NFE2L2), which binds to antioxidant response element (ARE) in the promoter region of target genes, subsequently activating the transcription of genes encoding phase II detoxifying enzymes and cytoprotective defences against oxidative stress (Itoh et al, 1997). These genes include heme oxygenase‐1 (HMOX1), NAD(P)H:quinone oxidoreductase‐1 (NQO1), and enzymes of glutathione metabolism, such as glutathione S‐transferases (GST), glutamate‐cysteine ligase (GCL), and glutathione peroxidases (McMahon et al, 2001; Lee et al, 2003). NRF2 also regulates proteostasis (Komatsu et al, 2010; Pajares et al, 2016), neuroinflammation (Innamorato et al, 2008; Rojo et al, 2010), and bioenergetic homeostasis (Holmstrom et al, 2013) in the nervous system, such that activating NRF2‐dependent responses initiates a sustained neuroprotective effect in several neurodegenerative disorder models (Kanninen et al, 2009; Neymotin et al, 2011; Stack et al, 2011; Kaidery et al, 2013; Lastres‐Becker et al, 2016). We therefore sought to explore the role of NRF2 pathway in the neurodegenerative processes of X‐linked adrenoleukodystrophy (X‐ALD; McKusick no. 300100).
This is the most common peroxisomal disease and leukodystrophy with an incidence of 1:15,000 (Kemper et al, 2017). It is caused by mutations in the ABCD1 gene (Mosser et al, 1993) located on Xq.28, which encodes a peroxisomal transporter that moves very long‐chain fatty acids (VCLFA) into the peroxisome for degradation by β‐oxidation (van Roermund et al, 2008; Wiesinger et al, 2013). As a consequence, very long‐chain fatty acids (VLCFA), especially C26:0, accumulate in tissues and plasma and constitute a pathognomonic biomarker for diagnosis. There are two main forms of the disease (Engelen et al, 2012). First, cerebral adrenoleukodystrophy is present mostly in boys between 5 and 10 years (35–40% of the cases) but also in adolescents and adult men, who present a strong inflammatory demyelinating reaction in central nervous system white matter. Second, adrenomyeloneuropathy occurs in 60% of the cases and affects adult men and heterozygous women over the age of 40 (Engelen et al, 2014). Adrenomyeloneuropathy is characterized by peripheral neuropathy and distal axonopathy involving corticospinal tracts of the spinal cord. The clinical presentation of X‐ALD varies even in the same family, which suggests the presence of modifier genes or environmental factors (Berger et al, 1994; Turk et al, 2017). Current therapeutic options are restricted to bone marrow transplantation (Miller et al, 2011) and hematopoietic stem cell gene therapy (Cartier et al, 2009; Eichler et al, 2017), and are limited by a very narrow therapeutic window, which reinforces the need to develop additional therapies for this devastating disease.
The mouse model of X‐ALD (Abcd1 − mice) develops axonopathy and locomotor impairment very late in life, at 20 months of age, resembling adrenomyeloneuropathy, the most frequent X‐ALD phenotype (Pujol et al, 2002). The closest homolog Abcd2 exhibits overlapping metabolic functions (Fourcade et al, 2009) and has been postulated as modifier of the biochemical defect (Muneer et al, 2014). Double mutant Abcd1 − /Abcd2 −/− mice develop a more severe, earlier onset axonopathy starting at 12 months of age, what makes them a more suitable model for therapeutic essays (Pujol et al, 2002; Mastroeni et al, 2009; Lopez‐Erauskin et al, 2011; Morato et al, 2013, 2015; Launay et al, 2015, 2017). Using these mouse models and patients’ samples, studies by our laboratory and others have revealed that VLCFA‐induced oxidative stress is a critical, early pathogenic factor in X‐ALD (Vargas et al, 2004; Powers et al, 2005; Fourcade et al, 2008, 2010; Hein et al, 2008; Lopez‐Erauskin et al, 2011; Petrillo et al, 2013), although the exact mechanisms by which VLCFA‐induced redox imbalance causes neurodegeneration in X‐ALD remain unclear (Fourcade et al, 2015). Here, we examined whether the NRF2 antioxidant pathway could contribute to the increased oxidative damage detected in this disease, in both the Abcd1 − mouse model and the skin fibroblasts derived from X‐ALD patients. We also treated X‐ALD mouse models (Abcd1 − and Abcd1 −/Abcd2 −/− mice) with dimethyl fumarate (DMF, BG‐12, Tecfidera), an NRF2 activator (Linker et al, 2011; Scannevin et al, 2012), that is a currently approved medication for relapsing‐remitting multiple sclerosis (Fox et al, 2012; Gold et al, 2012).
Results
GSK‐3β/NRF2 antioxidant pathway is altered in Abcd1 − mice
We previously identified a redox dyshomeostasis in X‐ALD, characterized by an excess of reactive oxygen species (ROS) production and repression of key antioxidant enzymes (Fourcade et al, 2008). Since NRF2 plays a critical role in the antioxidant cellular defence, we asked whether the NRF2‐dependent antioxidant pathway was altered in the Abcd1 null mouse. We found decreased NRF2 protein levels in Abcd1 − mice spinal cord at 12 months of age (Fig 1A), a presymptomatic disease stage in this mouse model. Dysregulated NRF2 protein levels were organ‐specific, as we did not observe any changes in non‐affected tissues in the mouse model, such as cerebral cortex or liver (Fig EV1). To verify that lower protein levels had functional consequences, we measured mRNA expression of NRF2 classical target genes (Hmox1, Nqo1 and glutathione S‐transferase alpha‐3, Gsta3) at the same age. We observed a slight but significant decreased expression of these three NRF2 target genes in the Abcd1 − mouse spinal cord at 12 months of age (Fig 1B), consistent with a downregulated NRF2 pathway.
Figure 1. Altered GSK‐3β/NRF2 antioxidant pathway in Abcd1 − mice.
-
ARepresentative immunoblot of NRF2 protein level measured in WT (n = 6) and Abcd1 − (n = 6) mice spinal cord at 12 months of age. Protein levels normalized relative to γ‐tubulin (γ‐TUB) and quantification depicted as fold change to WT mice.
-
BNRF2‐dependent antioxidant gene expression (Hmox1, Nqo1, and Gsta3) in WT (n = 8) and Abcd1 − (n = 8) mice spinal cord at 12 months of age. Gene expression normalized relative to mouse Rplp0 and depicted as fold change to WT mice.
-
C, DRepresentative immunoblots of pSer473 AKT, pThr308 AKT, AKT, pSer9 GSK‐3β, pTyr216 GSK‐3β, and GSK‐3β protein level in WT (n = 12) and Abcd1 − (n = 12) mice spinal cord at 12 months of age. Protein level normalized relative to corresponding non‐phosphorylated proteins or γ‐TUB (in the case of AKT and GSK‐3β). Quantification depicted as fold change to WT mice.
Figure EV1. Basal NRF2 levels in other mice tissues and human fibroblasts.
-
ARepresentative immunoblots of NRF2 protein level in WT (n = 8) and Abcd1 − (n = 8) mice cerebral cortex and liver at 12 months of age. Protein levels normalized relative to γ‐tubulin (γ‐TUB) and quantification depicted as fold change to WT mice.
-
BRepresentative immunoblots of NRF2 protein level in total extracts from CTL (n = 5) and X‐ALD (n = 5) fibroblasts. Protein levels normalized relative to γ‐TUB. Quantification is depicted as fold change to control fibroblasts.
Several signals can regulate NRF2‐dependent responses, in particular those that modulate GSK‐3β activity (Salazar et al, 2006; Rojo et al, 2008; Rada et al, 2011). We thus examined the activity of the AKT/GSK‐3β pathway in the spinal cord of Abcd1 − mice by measuring the phosphorylation of serine 473 (pSer473) and threonine 308 (pThr308) residues of AKT, which reflects its activation. We also measured the phosphorylation of serine 9 (pSer9) and tyrosine 216 (pTyr216) residues of GSK‐3β, which indicate inhibition or activation of GSK‐3β, respectively. We found less AKT activation in Abcd1 − mice spinal cord, as shown by decreased pThr308 AKT relative to total AKT levels. Defective AKT phosphorylation resulted in the activation of GSK‐3β, indicated by reduced pSer9 GSK‐3β compared with total GSK‐3β levels (Fig 1C and D). We did not observe any changes in pSer473, pTyr216, or in the total levels of AKT and GSK‐3β (Fig 1C and D). These data indicate a dysregulated AKT/GSK‐3β/NRF2 axis in the Abcd1 − mouse spinal cord, with predicted higher activity of GSK‐3β upstream of NRF2.
Impaired NRF2‐dependent antioxidant pathway is mediated by GSK‐3β in patients’ fibroblasts
Primary fibroblasts from X‐ALD patients provide a good surrogate cell model to dissect disease mechanisms, as they recapitulate the main disease hallmarks: accumulation of VLCFA (Moser et al, 1980), higher production of free radicals of mitochondrial origin (Lopez‐Erauskin et al, 2013), loss of energetic homeostasis (Galino et al, 2011), altered proteostasis (Launay et al, 2013, 2015), and endoplasmic reticulum (ER) stress (van de Beek et al, 2017; Launay et al, 2017). Using this cell system, we determined whether patients’ fibroblasts exhibited an altered AKT/GSK‐3β/NRF2 pathway.
At baseline, we observed equivalent NRF2 protein levels in patients’ fibroblasts compared with controls (Fig EV1).
We then tested the functionality of the NRF2 pathway, by treating patients’ and control fibroblasts either with C26:0, the primary VLCFA accumulated in patients, or with oligomycin, which acts as a generator of mitochondrial ROS inhibiting complex V (Fourcade et al, 2008; Paupe et al, 2009). Both compounds produce mitochondrial ROS in these fibroblasts (Lopez‐Erauskin et al, 2013). We show that both C26:0 and oligomycin activated NRF2‐dependent responses in control fibroblasts, characterized by both higher NRF2 translocation to the nucleus (Fig 2A and B) and increased expression of NRF2 target genes (HMOX1, NQO1, and GCLC mRNA; Fig 2C). However, this physiological response against oxidative stress was blunted in X‐ALD fibroblasts with both ROS‐producing stimuli (Fig 2A–C).
Figure 2. Impaired AKT/GSK‐3β/NRF2 antioxidant response after oxidative stress in X‐ALD patients’ fibroblasts.
-
A, BRepresentative immunoblots of NRF2 protein translocation to the nucleus upon VLCFA (C26:0, 50 μM, 24 h) or oligomycin (15 μM, 18 h) in control (CTL, n = 5 per condition, left panels) and X‐ALD (n = 5 per condition, right panels) fibroblasts. Protein levels normalized relative to lamin B1 in the nuclear fraction, aldolase A (ALDOA) in the cytoplasmic fraction, and γ‐TUB in the total fraction. Quantification depicted as fold change to vehicle‐treated (Veh) fibroblasts.
-
CNRF2‐dependent antioxidant gene expression (HMOX1, NQO1, and GCLC) upon oxidative stress in CTL (n = 5 per condition) and X‐ALD (n = 5 per condition) fibroblasts. Gene expression normalized relative to RPLP0. Quantification depicted as fold change to vehicle‐treated (Veh) fibroblasts.
-
D, ERepresentative immunoblots of pSer473 AKT, pThr308 AKT, AKT, pSer9 GSK‐3β, and GSK‐3β measured after oxidative stress in CTL (n = 5 per condition) and X‐ALD (n = 5 per condition) fibroblasts. Protein levels normalized relative to corresponding non‐phosphorylated proteins or γ‐TUB (in the case of AKT and GSK‐3β). Quantification depicted as fold change to vehicle‐treated (Veh) fibroblasts.
-
FNRF2‐dependent antioxidant gene expression (HMOX1, NQO1, and GCLC) after GSK‐3β inhibition in VLCFA‐treated CTL (n = 8 per condition) and X‐ALD (n = 8 per condition) fibroblasts. Gene expression normalized relative to RPLP0. Quantification depicted as fold change to vehicle‐treated (Veh) fibroblasts.
Moreover, both treatments elicited AKT activation (increased pSer473 and pThr308) and subsequent GSK‐3β inactivation (higher pSer9 GSK‐3β levels) in control fibroblasts (Fig 2D and E). Again, this physiological response against oxidative stress was impaired in X‐ALD fibroblasts, as phosphorylated levels of AKT and GSK‐3β did not change following C26:0 or oligomycin treatment (Fig 2D and E).
As GSK‐3β activation can repress NRF2, we sought to determine whether this phenomenon was interrelated in the cellular model. For this, we assessed whether specific GSK‐3β inhibitors (CT99021 and SB216763; Coghlan et al, 2000; Ring et al, 2003) could restore a normal NRF2‐dependent response in X‐ALD fibroblasts. Indeed, treatment with both compounds reactivated the NRF2 pathway, characterized by an upregulation of the NRF2‐target genes HMOX1, NQO1, and GCLC in patients’ fibroblasts upon incubation with excess of C26:0 (Fig 2F).
Collectively, these data indicate that the aberrant GSK‐3β activation upstream of NRF2 governs the blunted NRF2‐dependent response upon oxidative stress in this disease model.
DMF rescues mitochondrial depletion, bioenergetic failure, and oxidative damage in Abcd1 − mice
To elucidate the impact of a defective NRF2‐dependent response in the pathogenesis of adrenoleukodystrophy, we decided to treat Abcd1 − mice with DMF, a classical activator of NRF2 (Linker et al, 2011; Scannevin et al, 2012). Dimethyl fumarate has therapeutic efficacy for relapsing‐remitting multiple sclerosis (Fox et al, 2012; Gold et al, 2012) and besides, preclinical tests show success to treat other neurodegenerative diseases like Huntington's (Ellrichmann et al, 2011) and Parkinson's disease (Ahuja et al, 2016; Lastres‐Becker et al, 2016).
Before treating the animals, we tested DMF in control and X‐ALD fibroblasts. We found that DMF reactivated the NRF2‐blunted response upon VLCFA addition (Fig EV2), similar to the GSK‐3β inhibitors used (Fig 2F). Moreover, DMF alone induced HMOX1 and NQO1 expression in control fibroblasts and also HMOX1 expression in X‐ALD fibroblasts (Fig EV2). Thus, these new data reinforced the rational for DMF treatment in vivo.
Figure EV2. DMF effect on NRF2 response in X‐ALD fibroblasts.
Expression of NRF2 target genes was measured in CTL (n = 3) and X‐ALD (n = 3) after C26:0 (50 μM, 24 h) and/or DMF (20 μM, 6 h). Gene expression normalized relative to RPLP0. Quantification depicted as fold change to vehicle‐treated (Veh) fibroblasts. Data are presented as mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001 (one‐way ANOVA followed by Tukey's post hoc test). See the exact P‐values in Appendix Table S3.
We fed Abcd1 − mice with DMF‐containing chow at 100 mg/kg, starting at 8 months of age, for 4 months. First, we verified the efficacy of dietary DMF administration by measuring NRF2 protein levels and mRNA expression of three classical NRF2‐target genes (Hmox1, Nqo1, and Gsta3). Dimethyl fumarate treatment rescued both NRF2 protein levels (Fig 3A) and NRF2 targets in Abcd1 − mice spinal cord at 12 months of age (Fig 3B).
Figure 3. NRF2 activation by DMF prevents oxidative damage to proteins and lipids, mitochondrial depletion, and bioenergetic failure in Abcd1 − mice.
-
ARepresentative immunoblot of NRF2 protein levels in WT (n = 6), Abcd1 − (n = 6) and DMF‐treated Abcd1 − mice (Abcd1 − + DMF, n = 6) mice spinal cord at 12 months of age. Protein levels normalized relative to γ‐TUB. Quantification depicted as fold change to WT mice.
-
BNRF2‐dependent antioxidant gene expression (Hmox1, Nqo1, and Gsta3) in WT (n = 8), Abcd1 − (n = 8), and Abcd1 − + DMF (n = 8) mice spinal cord at 12 months of age. Gene expression normalized relative to Rplp0. Quantification represented as fold change to WT mice.
-
COxidative lesions to lipids and proteins in WT (n = 5), Abcd1 − (n = 5), and Abcd1 − + DMF (n = 5) mice spinal cord at 12 months of age. AASA, CEL, CML, and MDAL levels measured by GC/MS. Quantification represented as fold change to WT mice.
-
DmtDNA levels in WT (n = 8), Abcd1 − (n = 8), and Abcd1 − + DMF (n = 8) mice spinal cord at 12 months of age. mtDNA content expressed as the ratio of mtDNA (CytB levels) to nDNA (Cebpa levels). Quantification depicted as fold change to WT mice.
-
ESirt1, Ppargc1a, Nrf1, and Tfam gene expression in WT (n = 8), Abcd1 − (n = 8), and Abcd1 − + DMF (n = 8) mice spinal cord at 12 months of age. Gene expression normalized relative to Rplp0. Quantification depicted as fold change to WT mice.
-
FATP levels in WT (n = 8), Abcd1 − (n = 8), and Abcd1 − + DMF (n = 8) mice spinal cord at 12 months of age. Quantification represented as fold change to WT mice.
Next, we measured the effect of DMF on several quantitative markers of oxidative damage to lipids and proteins, such as direct carbonylation of proteins (Aminoadipic semialdehyde: AASA), glycoxidation (Nɛ‐(carboxyethyl)‐lysine: CEL and Nɛ‐(carboxymethyl)‐lysine: CML), and protein lipoxidation (Nɛ‐malondialdehyde‐lysine: MDAL; Fourcade et al, 2008). We found an antioxidant role for DMF in this model, as it normalized AASA, CEL, CML, and MDAL in Abcd1 − mice spinal cord (Fig 3C).
We also examined the effect of DMF on mitochondrial dysfunction (Morato et al, 2013, 2015). DMF normalized mitochondrial biogenesis, based on different parameters: mtDNA levels (Fig 3D) and mRNA expression of sirtuin‐1, Sirt1; peroxisome proliferator‐activated receptor gamma coactivator 1‐alpha, Ppargc1a; nuclear respiratory factor‐1, Nrf1; and transcription factor A, mitochondrial, Tfam (Fig 3E; Morato et al, 2013, 2015). We previously reported decreased levels of ATP in the spinal cord of Abcd1 − mice (Galino et al, 2011), suggesting that deficient energy homeostasis is a key feature in X‐ALD pathology. In this study, we reveal that DMF prevented bioenergetic failure, as it normalized ATP levels (Fig 3F). These effects seem to be independent of VLCFA levels, since DMF treatment did not alter C24:0 or C26:0 levels in the spinal cord of 12‐month‐old Abcd1 − mice (Fig EV3). Altogether, DMF activated NRF2‐dependent antioxidant pathway and prevented mitochondrial depletion, bioenergetic failure, and oxidative damage in the spinal cord of the disease mouse model.
Figure EV3. VLCFA levels after DMF treatment in the spinal cord of X‐ALD mouse model.
Saturated fatty acids 22:0, 24:0, and 26:0 level in the spinal cord of 12‐month‐old WT, Abcd1 −, and Abcd1 − + DMF mice (n = 5). Fatty acid quantification was done by gas–liquid chromatography (see Materials and Methods). VLCFA 24:0 and 26:0 levels are normalized to the long‐chain fatty acid 22:0 in the 26:0/22:0 and the 24:0/22:0 ratios. Quantification is depicted as fold change to WT mice. Data are presented as mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001 (one‐way ANOVA followed by Tukey's post hoc test). See the exact P‐values in Appendix Table S3.
DMF treatment prevents inflammatory imbalance in Abcd1 − mice
Although patients presenting with pure adrenomyeloneuropathy do not exhibit overt brain inflammation that induces demyelination, we previously found low‐grade inflammatory dysregulation in the Abcd1 − mouse spinal cord and in adrenomyeloneuropathy patients. Our functional genomics assay detected activation of the NF‐κB‐mediated inflammatory pathway and increased expression of several pro‐inflammatory cytokines in the Abcd1 − mouse spinal cord (Schluter et al, 2012). In adrenomyeloneuropathy patients, we recently reported a general dysregulation of inflammatory pathways in peripheral blood mononuclear cells (PBMC) and plasma (Ruiz et al, 2015).
Since DMF is also a classical immunomodulatory drug (Schilling et al, 2006; Linker et al, 2011), we examined its effects on mRNA expression of several inflammation‐related genes in the Abcd1 − mice spinal cord. At 12 months of age, Abcd1 − mice exhibited a general imbalance of both pro‐ and anti‐inflammatory markers, characterized by the induction of pro‐inflammatory markers including nuclear factor kappa B subunit 2 (Nfkb2), interleukin 1 beta (Il1b), tumor necrosis factor alpha (Tnfa), tumor necrosis factor receptor superfamily member 1a (Tnfrsf1a), chemokine (C‐C motif) ligand 5 (Ccl5), chemokine (C‐X‐C motif) ligand 9 (Cxcl9), chemokine (C‐X‐C motif) ligand 10 (Cxcl10), and chemokine (C‐C motif) receptor type 6 (Ccr6) (Fig 4A). Also, we observed an upregulation of some anti‐inflammatory markers, such as chitinase‐like 3 (Chil3), chemokine (C‐X‐C motif) ligand 12 (Cxcl12), insulin‐like growth factor 1 (Igf1), and transforming growth factor, beta 1 (Tgfb1) (Fig 4B). Interleukin 6 (Il6), resistin like alpha (Retnla, also called Fizz1), and macrophage migration inhibitory factor (Mif) were decreased in the Abcd1 − mouse spinal cord (Fig 4A and B).
Figure 4. DMF treatment restores inflammatory profile in Abcd1 − mice.
-
APro‐inflammatory (Nfkb2, Il1b, Il6, Tnfa, Tnfrsf1a, Ccl5, Cxcl9, Cxcl10, Ccr6) gene expression profile.
-
BAnti‐inflammatory (Fizz1, Chil3, Cxcl12, Il10, Igf1, Mif, Tgfb1) gene expression profile.
Dimethyl fumarate prevented most alterations observed in the inflammatory profile in the Abcd1 − mice spinal cord and normalized mRNA levels of Nfkb2, Il6, Tnfa, Ccl5, Cxcl10, Ccr6 (pro‐inflammatory; Fig 4A), and Mif, Cxcl12, Tgfb1, Igf1 (anti‐inflammatory; Fig 4B). However, DMF had no effect on Tnfrsf1a, Cxcl9 (pro‐inflammatory), and Fizz1 (anti‐inflammatory) mRNA expression in the Abcd1 − mice spinal cord (Fig 4A and B). DMF exacerbated the induction of Il1b (pro‐inflammatory) and Chil3 (anti‐inflammatory), and induced the expression of interleukin 10 (Il10), an anti‐inflammatory cytokine, in the Abcd1 − mouse spinal cord (Fig 4A and B). These data demonstrate that DMF normalized the inflammatory profile in Abcd1 − mice.
DMF halts axonal degeneration in Abcd1 − /Abcd2 −/− mice
We then evaluated the effects of DMF on axonal degeneration and locomotor impairment in X‐ALD mouse model. We fed Abcd1 −/Abcd2 −/− (DKO) mice with DMF for 6 months, starting at 12 months of age. First, we characterized the immunohistochemical signs of neuropathology present in DKO mice at 18 months of age, after DMF treatment. We assessed (i) microgliosis; (ii) astrocytosis; (iii) axonal degeneration, shown by accumulation of amyloid precursor protein (APP) and synaptophysin in axonal swellings; (iv) lipidic myelin debris, shown by Sudan Black staining (Pujol et al, 2004); (v) oxidative damage to DNA, indicated by increased 8‐oxo‐7,8‐dihydro‐2′‐deoxyguanosine (8‐oxo‐dG) staining (Lopez‐Erauskin et al, 2011); (vi) unhealthy motor neurons with reduced staining of SMI‐32, an antibody that labels a non‐phosphorylated epitope of neurofilament proteins; and (vii) decreased mitochondrial content observed by cytochrome c (Cyt C) staining in motor neurons (Morato et al, 2013; Fig 5A–Y). Dimethyl fumarate reversed microgliosis and astrocytosis, as it normalized the density of astrocytes and microglial cells in DKO mice (Fig 5A–F and Y), prevented axonal accumulation of APP and synaptophysin (Fig 5G–L and Y), halted the appearance of myelin debris along the spinal cord (Fig 5M–O), and reduced DNA oxidative damage shown by 8‐oxo‐dG staining (Fig 5P–R) in DKO mice. In addition, motor neuron health and mitochondrial levels improved with DMF treatment (Fig 5S–X). Altogether, these data reveal that DMF treatment significantly ameliorated the neuropathology in Abcd1 −/Abcd2 −/− mice.
Figure 5. DMF treatment halts axonal degeneration and locomotor impairment in Abcd1 − /Abcd2 −/− mice.
-
A–XImmunohistological analysis of axonal pathologies performed in 18‐month‐old WT, Abcd1 − /Abcd2 −/− (DKO), and DKO mice treated with DMF (DKO + DMF) (n = 5 per genotype and condition). Spinal cord immunohistological sections processed for (A–C) Iba1, (D–F) GFAP, (G–I) synaptophysin, (J–L) APP, (M–O) Sudan Black, (P–R) 8‐oxo‐dG, (S–U) SMI‐32, and (V–X) Cyt C. Representative images for (A, D, G, J, M, P, S, V) WT, (B, E, H, K, N, Q, T, W) DKO, and (C, F, I, L, O, R, U, X) DKO + DMF are shown. Scale bars = 125 μm (A–R) and 25 μm (S–X). Black arrows indicate APP or synaptophysin accumulations (H and K), and myelin debris (N) in DKO mice.
-
YQuantification of GFAP+ and Iba1+ cells per mm2, and synaptophysin and APP accumulations in spinal cord immunohistological sections of WT (n = 5), DKO (n = 5), and DKO + DMF (n = 5) mice.
-
ZBar cross and treadmill tests performed on 18‐month‐old WT (n = 14), DKO (n = 16), and DKO + DMF (n = 14) mice. In the bar cross, data refer to number of slips and time (seconds) spent to cross the bar. In the treadmill test, data refer to number of shocks and time of shocks at the last time point measured (7 min and 30 s).
DMF reverses locomotor deficits in Abcd1 − /Abcd2 −/− mice
Next, we measured the effect of DMF on the locomotor phenotype of DKO mice using bar cross and treadmill tests at the end of the treatment. As previously described (Pujol et al, 2004; Lopez‐Erauskin et al, 2011), DKO mice at 18 months of age took longer time to cross the bar and slipped off more times while crossing the bar. However, DMF‐treated DKO mice behaved similar to wild‐type (WT) mice. These data indicate that DMF improved the ability of DKO mice to cross the bar (Fig 5Z). As earlier described (Morato et al, 2015), DKO mice behaved worse than WT in the treadmill test, as the total number and duration of shocks were higher than in WT. Dimethyl fumarate treatment also ameliorated the performance of DKO mice in this test (Fig 5Z). In summary, these data indicate that DMF treatment halted the progression of the locomotor deficits observed in Abcd1 −/Abcd2 −/− mice.
Discussion
In this work, we uncover an impaired AKT/GSK‐3β/NRF2 axis in X‐ALD, composed of a blunted NRF2‐dependent response which obeys an aberrant upstream activation of GSK‐3β. This impaired NRF2‐dependent antioxidant response suggests a mechanism by which excess of C26:0 causes oxidative damage only in patients’ fibroblasts in contrast with controls, even though both populations present similar amounts of ROS after C26:0 treatment (Fourcade et al, 2008). Indeed, the NRF2 target genes Hmox1, Nqo1, and Gsta3, whose expression we show is reduced in Abcd1 − mice spinal cord, mediate a cellular defence against toxic, carcinogenic, and pharmacologically active electrophilic compounds (Lee et al, 2003; Dinkova‐Kostova & Talalay, 2010). We propose that oxidative damage in this disease may be a consequence of the low activity of these enzymes, incapable of compensating for the increased ROS production. Inactivation of the NRF2 pathway is not a phenomenon limited to X‐ALD, but is reported in several neurodegenerative disorders including Alzheimer's disease (Ramsey et al, 2007; Kanninen et al, 2008), amyotrophic lateral sclerosis (Sarlette et al, 2008), Friedrich's ataxia (Paupe et al, 2009; Shan et al, 2013), and experimental autoimmune encephalomyelitis mouse models (Morales Pantoja et al, 2016). A recent meta‐analysis identified the NRF2 pathway as a common dysregulated hub in Alzheimer's and Parkinson's disease patients (Wang et al, 2017). Moreover, NRF2 can contribute to Parkinson's and Huntington's disease pathology (Johnson & Johnson, 2015). Indeed, NRF2‐deficient mice are more vulnerable to striatal toxicity induced by systemic administration of 3‐nitropropionic acid (3‐NP) (Calkins et al, 2005), 1‐methyl‐4‐phenyl‐1,2,3,6 tetrahydropyridine (MPTP) (Burton et al, 2006; Chen et al, 2009), or 6‐hydroxydopamine (6‐OHDA) used to induce basal ganglia neural dysfunction (Jakel et al, 2007). Of note, NRF2‐deficient mice also develop a more severe myelin oligodendrocyte glycoprotein (MOG)‐induced experimental autoimmune encephalomyelitis with increased oxidative damage in the CNS, finally leading to enhanced demyelination and more pronounced axonal loss (Johnson et al, 2010). This provides a direct link between insufficient antioxidant response and axonal damage. Further, genetic variations in the NRF2 gene have been associated with risk and/or age of onset in amyotrophic lateral sclerosis, Alzheimer's, and Parkinson's disease (von Otter et al, 2010a,b; Bergstrom et al, 2014).
Glial cells are involved in the NRF2‐mediated neuroprotective effects. Ex vivo studies and analysis of neurodegenerative models for motor neuron disorders, Parkinson's disease, or cerebral ischemia indicate that NRF2‐mediated neuroprotection critically involves astrocyte‐induced effects (Kraft et al, 2004; Shih et al, 2005; Chen et al, 2009). Initial evidence of the importance of NRF2 in glial cells comes from Nrf2 knockout mice, which display astrogliosis and myelinopathy in the cerebellum (Hubbs et al, 2007). Also, striatum is protected from MPTP toxicity in transgenic mice which overexpress NRF2 in astrocytes (Chen et al, 2009).
Little is known about the link between AKT/GSK‐3β and NRF2 in neurodegenerative diseases. Exacerbated GSK‐3β activity is also present in other peroxisomal diseases, like rhizomelic chondrodysplasia punctata, in which plasmalogen deficiency leads to AKT inactivation and GSK‐3β activation (da Silva et al, 2014). Future work should address and quantify both the functionality of the NRF2 pathway in rhizomelic chondrodysplasia punctata and the AKT/GSK‐3β/NRF2 axis in other peroxisomal disorders, given the possibility of targeted treatments like DMF, for these metabolic diseases. Increased GSK‐3β also occurs in other neurodegenerative conditions, like tauopathies, in which GSK‐3β is one of the kinases responsible for pathological phosphorylation of Tau (Llorens‐Martin et al, 2014); Parkinson's disease (Duka et al, 2009; Credle et al, 2015) or multiple sclerosis (Beurel et al, 2013).
In the present work, we inhibited GSK‐3β in X‐ALD fibroblasts using two different drugs, which restored NRF2 pathway function and activated transcription of NRF2 target genes upon oxidative stress. Thus, we reveal GSK‐3β inhibition as a new therapeutic strategy in X‐ALD, which is currently under investigation for other neurodegenerative diseases. In the Senescence Accelerated Mouse‐Prone 8 (SAMP8) mouse, an Alzheimer's disease mouse model, GSK‐3β inhibition caused NRF2 activation and decreased oxidative stress, together with reduced Tau phosphorylation and improved learning and memory (Farr et al, 2014). Another study uncovered the therapeutic potential of GSK‐3β pathway inhibition to restore neurodevelopmental defects in hereditary spastic paraplegia (HSP) patients with SPG11 mutations (Mishra et al, 2016). Pathways that modulate GSK‐3β, such as phosphoinositide 3‐kinase (PI3K)/AKT and WNT/β‐catenin, also regulate myelination (Fancy et al, 2009; Guo et al, 2016). Unfortunately, GSK‐3 inhibitors have so far met little success in clinical trials for neurodegenerative diseases. Two phase II clinical trials with the GSK‐3β inhibitor, Tideglusib, showed no clinical benefits in Alzheimer's disease (Lovestone et al, 2015) and progressive supranuclear palsy (Tolosa et al, 2014). We therefore chose DMF to activate NRF2 in our X‐ALD preclinical models using a similar dosage to that administered to human multiple sclerosis patients, paving the way to clinical translation. DMF treatment is advantageous because it enhances the NRF2 antioxidant pathway, but also exerts pleiotropic effects improving proteostasis, mitochondrial function, and neuroinflammation (Johnson & Johnson, 2015), cellular responses that also contribute to the pathogenesis of adrenoleukodystrophy (Fourcade et al, 2015). Indeed, previous in vitro studies described the effects of DMF on mitochondrial function (Scannevin et al, 2012; Ahuja et al, 2016; Peng et al, 2016). Here, we describe a positive effect of DMF on mitochondrial biogenesis and function in the central nervous system in vivo, characterized by increased mtDNA levels and mitochondrial biogenesis regulatory gene expression (Sirt1, Ppargc1a, Nrf1, Tfam), as well as normalized ATP levels in the spinal cord of Abcd1 − mice. These results are supported by recent data in mice and multiple sclerosis patients treated with DMF (Hayashi et al, 2017).
Neuroinflammation is another common feature of neurodegenerative diseases. In this study, we observed normalization in the gene expression of Nfkb2 transcription factor and pro‐inflammatory cytokines like Tnfa, Ccl5, Cxcl10, and Ccr6, concomitant with an increase in the anti‐inflammatory cytokines Il10 and Chil3. This DMF effect is consistent with previous reports showing an in vivo anti‐inflammatory effect in the experimental autoimmune encephalomyelitis animal model (Schilling et al, 2006). We also show that DMF prevented microgliosis and astrocytosis in Abcd1 −/Abcd2 −/− mice, consistent with results from recent studies in Parkinson's disease mouse models (Jing et al, 2015; Lastres‐Becker et al, 2016). NRF2 activation also occurs in PBMC and glial cells from multiple sclerosis patients treated with DMF from the DEFINE and CONFIRM studies (Gopal et al, 2017). Yet, the immunomodulatory effect of DMF in the nervous system can be NRF2‐dependent (Linker et al, 2011) or independent (Brennan et al, 2016). G protein‐coupled receptor 109A (GPR109A), also known as the hydroxycarboxylic acid receptor 2 (HCA2), is another DMF target (Parodi et al, 2015). Future studies on the role of HCA2 in X‐ALD and other demyelinating diseases will further enlighten the mechanism of action of DMF in the neuroinflammatory axis.
In view of these data, DMF exhibits a great potential to treat X‐ALD and other neurodegenerative diseases with an overall good safety profile (Fox et al, 2012; Gold et al, 2012). However, some precautions need to be observed with this drug, as side effects need to be monitored and evaluated carefully. The most important is lymphocytopenia (Fox et al, 2016). Of > 230,000 patients treated with DMF in the period of 3 years following commercial availability, five cases of progressive multifocal leukoencephalopathy (PML) have been reported, in the setting of moderate to severe prolonged lymphocytopenia (Pardo & Jones, 2017). As a consequence, FDA and EMA (EMA/627077/2015) recently issued updated safety recommendations to minimize PML risk, which include regular blood counts. Recent reports indicate that a reduction in T cells rather than a general reduction in lymphocyte count may be associated with these cases (Gieselbach et al, 2017), which still represent a very low percentage of all the patients treated with fumaric acid esters.
In summary, our data uncover a novel role of GSK‐3β/NRF2 in the physiopathogenesis of X‐ALD. By identifying the mechanism impaired in the endogenous antioxidant response in this disease, we reveal a novel therapeutic intervention using DMF treatment to overcome the molecular pathogenesis and clinical signs of adrenoleukodystrophy in the mouse. Our data provide strong rationale to propose phase II clinical trials with DMF in adrenoleukodystrophy patients.
Materials and Methods
Reagents and antibodies
The following chemicals were used: DMF (Ref. 242926), hexacosanoic acid (C26:0, Ref. H0388), and oligomycin (Ref. O4876) were purchased from Sigma‐Aldrich (Steinheim, Germany). GSK‐3β inhibitors CHIR99021 (6‐[[2‐[[4‐(2,4‐dichlorophenyl)‐5‐(5‐methyl‐1H‐imidazol‐2‐yl)‐2‐pyrimidinyl]amino]ethyl]amino]‐3‐pyridinecarbonitrile; Ref. 361559) and SB216763 (3‐(2,4‐dichlorophenyl)‐4‐(1‐methyl‐1H‐indol‐3‐yl)‐1H‐pyrrole‐2,5‐dione; Ref. 1616) were purchased from Calbiochem (Billerica, MA, USA) and Tocris Biosciences (Bristol, UK), respectively. Detailed information on antibodies is summarized in Appendix Table S1.
Mouse experiments
We used male mice of a pure C57BL/6J background. All methods employed in this study were in accordance with the ARRIVE guidelines, the Guide for the Care and Use of Laboratory Animals (Guide, 8th edition, 2011, NIH) and European (2010/63/UE) and Spanish (RD 53/2013) legislation. Experimental protocols were approved by IDIBELL, IACUC (Institutional Animal Care and Use Committee), and regional authority (3546 DMAH, Generalitat de Catalunya, Spain). IDIBELL animal facility is accredited by The Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC, Unit 1155). Animals were housed at 22°C on specific pathogen‐free conditions, in a 12‐h light/dark cycle, and ad libitum access to food and water. Cages contained three to four animals.
We used two X‐ALD mouse models in this study. We evaluated the biochemical signs of adult X‐ALD in Abcd1 − mice at 12 months of age. These mice present oxidative stress (Fourcade et al, 2008) and energetic homeostasis impairment (Galino et al, 2011) before the first clinical signs of adrenomyeloneuropathy‐like pathology (axonopathy and locomotor impairment) appear at 20 months (Pujol et al, 2002).
To address the therapeutic effect of DMF, we assessed the clinical signs of adrenomyeloneuropathy in Abcd1 − /Abcd2 −/− (DKO) mice, which display increased VLCFA accumulation in the spinal cord (Pujol et al, 2004), higher levels of oxidative damage to proteins (Fourcade et al, 2008; Galino et al, 2011), and a more severe adrenomyeloneuropathy‐like pathology with an earlier onset at 12 months of age (Pujol et al, 2004). These mice are the preferred X‐ALD mouse model for therapeutic testing (Mastroeni et al, 2009; Lopez‐Erauskin et al, 2011; Morato et al, 2013, 2015; Launay et al, 2015, 2017).
For biochemical analysis, we euthanized the mice and stored the tissues at −80°C after snap‐freezing them in liquid nitrogen. For histological analysis, spinal cord was harvested from 18‐month‐old mice after perfusing them with 4% paraformaldehyde (PFA; Sigma‐Aldrich, Ref. 441244) in 0.1 M phosphate buffer pH 7.4. Histological and behavioral experiments were performed in a blind manner with respect to the animal's genotype and the treatment administered.
DMF administration to mice
Dimethyl fumarate was mixed into AIN‐76A chow from Dyets (Bethlehem, PA, USA) to provide a dose of 100 mg/kg/day. Human equivalent dose would be 8 mg/kg/day (240 mg in a typical 60 kg person). This is equivalent to the starting dose of BG‐12/Tecfidera for multiple sclerosis patients, 120 mg twice a day (EMA/204830/2013).
To characterize biochemical signs in adult X‐ALD mice, 8‐month‐old animals were randomly assigned to one of the following dietary groups for 4 months. Group I: WT mice received normal AIN‐76A chow (n = 12); group II: Abcd1 − mice received normal AIN‐76A chow (n = 12); group III: Abcd1 − mice received AIN‐76A chow containing DMF (n = 12). To evaluate the effect of DMF on the clinical signs of adrenomyeloneuropathy‐like pathology, 12‐month‐old animals were randomly assigned to one of the following dietary groups for 6 months. Group I: WT mice received normal AIN‐76A chow (n = 14); group II: Abcd1 −/Abcd2 −/− mice received normal AIN‐76A chow (n = 16); and group III: Abcd1 −/Abcd2 −/− mice received AIN‐76A chow containing DMF (n = 14). DMF had no effect on weight or food intake under any treatment protocol, and none of the mice administered with DMF experienced any adverse events or death during the treatment.
Human samples
Primary human fibroblasts were prepared from skin biopsies collected from healthy individuals (n = 8) and adrenomyeloneuropathy patients (n = 8) according to the IDIBELL guidelines for sampling, including informed consent obtained from the persons involved or their representatives according to the Declaration of Helsinki and approved by the ethical committee of IDIBELL.
The fibroblasts were grown in Dulbecco's modified Eagle's medium (Gibco, Thermo Fisher Scientific Inc., Rockford, IL, USA) containing 10% fetal bovine serum (Cultek, Ref. 91S1800; Madrid, Spain), 100 U/ml penicillin, and 100 μg/ml streptomycin (Pen Strep; Gibco, Ref. 15140‐122) and maintained at 37°C in a humidified 95% air/5% CO2 incubator. The compounds tested were added at 80–90% cell confluence. 15 μM oligomycin and 50 μM C26:0 were diluted in ethanol and added for 18 and 24 h, respectively. DMF (20 μM), dissolved in ethanol, and GSK‐3β inhibitors (CHIR99021 at 3 μM and SB216763 at 10 μM), dissolved in dimethylsulfoxide (DMSO), were added 18 h after C26:0 treatment for 6 h. All experiments were performed with fibroblasts at passage 10–20.
Nuclear‐cytoplasmic fractionation in human fibroblasts
We performed subcellular fractionation to study NRF2 translocation to the nucleus, using a non‐ionic detergent lysis method with slight modifications (Abmayr et al, 2006). Briefly, cells grown in 100 mm diameter dishes (Nunc Dish, Thermo Fisher Inc.) were washed in ice‐cold phosphate buffer saline (PBS) pH 7.4 and collected by trypsinization (0.25% Trypsin‐EDTA Solution A; Biological Industries USA, Cromwell, CT, USA) in a 15‐ml falcon tube. After centrifugation and a new ice‐cold PBS wash, the cell pellet was resuspended with 140 μl of lysis buffer (0.1% Nonidet P‐40 in PBS, plus proteases (Complete Mini, Ref. 11836153001; Roche Diagnostics GmbH; Mannheim; Germany) and phosphatases (PhosSTOP, Ref. 04906845001; Roche Diagnostics GmbH) inhibitors) and scratched 20 times to lyse the cells. After 10‐min incubation on ice, we centrifuged at 300 g during 5 min at 4°C in an Eppendorf® microcentrifuge. Supernatant was collected as cytoplasmic fraction. Then, we added 70 μl of RIPA buffer (50 mM Tris pH 8.0, 150 mM NaCl, 12 mM deoxycholic acid, and 1% Nonidet P‐40; complemented with protease/phosphatase inhibitors) to the pellet to obtain the nuclear fraction. After homogenizing the pellet through a syringe with a 25G needle and 30 min of shaking at 4°C, we centrifuged for 10 min at 16,100 g at 4°C. Supernatant was collected as nuclear fraction. Then, we performed immunoblot procedures as described below. Lamin B1 and aldolase A were used as markers for nuclear and cytoplasmic fraction, respectively.
Quantitative real‐time PCR
RNA extraction and retrotranscription into cDNA, DNA extraction and quantitative RT–PCR analysis were performed as previously described (Morato et al, 2013). Total RNA was extracted from human fibroblasts and mouse tissues using RNeasy Kit (Qiagen, Hilden, Germany). Total DNA was extracted from mouse spinal cord using Gentra Puregene Tissue Kit (Qiagen, Hilden, Germany). The expression of the genes of interest was analyzed by Q–PCR using TaqMan® Gene Expression Assays (Thermo Fisher Scientific Inc.) and standardized TaqMan® probes (Appendix Table S2) on a LightCycler® 480 Real‐Time PCR System (Roche Diagnostics GmbH). Relative quantification was carried out using the “Delta‐Delta Ct” (ΔΔCt) method with Rplp0 as endogenous control. To quantify mouse mitochondrial DNA (mtDNA) content, primers for mouse cytochrome b (Cytb) were designed (Custom TaqMan Gene Expression Assays; Thermo Fisher Scientific Inc.). The sequences for Cytb primers were as follows: ATGACCCCAATACGCAAAATTA (forward) and GGAGGACATAGCCTATGAAGG (reverse), and the FAM‐labeled probe sequence was TTGCAACTATAGCAACAG. Quantification of mtDNA was referred to nuclear DNA (nDNA), determined by the amplification of the intron‐less mouse nuclear gene Cebpa (Morato et al, 2013). Transcript quantification was performed in triplicate for each sample.
Immunoblot
Human fibroblasts and mouse tissues were homogenized in RIPA buffer and then sonicated, centrifuged, and heated for 10 min at 70°C after adding 4X NuPAGE® LDS Sample Buffer (Invitrogen, Thermo Fisher Scientific Inc.). 20–50 μg of proteins was loaded onto 8% Novex NuPAGE® SDS–PAGE gel system (Invitrogen, Thermo Fisher Scientific Inc.) and run for 60–90 min at 120 V in NuPAGE® MOPS SDS Running Buffer (Invitrogen, Thermo Fisher Scientific Inc.) supplemented with 5 mM sodium bisulfite (Ref. 243973, Sigma‐Aldrich). SeeBlue® Plus2 Pre‐stained (Invitrogen, Thermo Fisher Scientific Inc.) was used as a ladder.
Regarding the different AKT or GSK‐3β phosphorylations, we run the same quantity of samples (processed at the same time) in several gels in parallel, always performing Ponceau staining and Y‐tubulin immunoblotting to confirm equal loading. Resolved proteins were transferred onto nitrocellulose membranes using iBlot® 2 Gel Transfer Device (Invitrogen, Thermo Fisher Scientific Inc.). After blocking in 5% bovine serum albumin (BSA, Sigma‐Aldrich) in 0.05% TBS‐Tween (TBS‐T) for 1 h at room temperature, membranes were incubated with corresponding diluted primary antibodies (Appendix Table S1) in 5% BSA in 0.05% TBS‐T overnight at 4°C. Following incubation with diluted secondary antibody (Appendix Table S1) in 0.05% TBS‐T for 1 h at room temperature, proteins were detected with ECL Western blotting analysis system (GE Healthcare, Buckinghamshire, UK), followed by exposure to CL‐XPosure Film (Thermo Fisher Scientific Inc.) as earlier described (Galino et al, 2011). It is worth noting that the correct band for NRF2 is at 100 kDa, not at the predicted 68 kDa (Lau et al, 2013). Immunoblots were quantified by densitometry using ImageJ v1.50i (U. S. National Institutes of Health, Bethesda, MD, USA).
ATP
ATP levels were measured by a chemiluminescence system using ATPlite 1step (PerkinElmer, Inc., Waltham, MA, USA), as already described (Galino et al, 2011).
Evaluation of oxidative lesions
AASA, CML, CEL, and MDAL concentrations in total proteins from spinal cord homogenates were measured by gas chromatography/mass spectrometry (GC/MS), as reported (Fourcade et al, 2008). The amounts of products were expressed as the ratio of micromole of AASA, CML, CEL, or MDAL per mol of lysine.
Measurement of very long‐chain fatty acids
Content of very long‐chain fatty acids in total lipids from spinal cord was analyzed as methyl ester derivative by gas chromatography, as described before (Morato et al, 2013). Briefly, separation was performed by a DBWAX capillary column (30 m × 0.25 mm × 0.20 μm) in a GC System 7890A with a Series Injector 7683B and a FID detector (Agilent Technologies). The injection port was maintained at 220°C, and the detector at 250°C; the temperature program was 5 min at 145°C, then 2°C/min to 240°C with a hold of 10 min, then 0.5°C/min to 250°C, and finally hold at 250°C for 5 min. Identification of fatty acid methyl esters was made by comparison with authentic standards (Sigma and Larodan Fine Chemicals). Results are represented as fold change to WT mice.
Immunohistochemistry
Spinal cords were embedded in paraffin, and serial sections (4 μm thick) were cut in a transversal or longitudinal (1 cm long) plane after perfusion with 4% PFA. Immunohistochemistry (IHC) studies performed in WT, Abcd1 − /Abcd2 −/− (DKO), and Abcd1 − /Abcd2 −/− mice treated with DMF (DKO+DMF) were carried out using the avidin–biotin peroxidase method, as reported earlier (Launay et al, 2015).
After primary antibody incubation, the sections were incubated with the Labelled Streptavidin‐Biotin2 System (LSAB2, Ref. K0675, Dako). Staining was visualized after incubation with 3,3′‐diaminobenzidine (DAB) substrate chromogen (Ref. D5637, Sigma‐Aldrich), which results in a brown‐colored precipitate at the antigen site. After dehydrating the sections, slides were mounted with DPX (Ref. 06522, Sigma‐Aldrich).
Images were acquired using Olympus BX51 microscope (20x/N.A 0.50 Ph 1 UPlan FL N; Olympus Corporation, Tokyo, Japan) connected to an Olympus DP71 camera and Cell^B software (Olympus Corporation). The researcher was blinded to both genotype and treatment of the sample when analyzing the results. The number of GFAP+ cells (astrocytes) and Iba1+ cells (microglia) per mm2 was determined in the spinal cord's ventral horn of WT, Abcd1 −/Abcd2 −/−, and DMF‐treated Abcd1 −/Abcd2 −/− mice (n = 5). The number of brown‐colored cells was considered and counted with Cell Counter ImageJ plugin. Data are presented as an average of two 20× images per animal for each group.
Analysis of locomotion
Locomotor deficits were assessed with the bar cross test and the treadmill test, as already described (Morato et al, 2013).
Statistical analysis
Sample size was chosen according to previous experience in the laboratory, in similar experiments with long‐term oral treatments that were performed with the same animal model. No animals were excluded from analysis. Animals and samples were allocated to different treatment groups by randomization. Researchers were blinded to the group assignment and to the animal number when performing the locomotor experiments until the data were processed for statistical analysis.
The values were expressed as the mean ± standard deviation (SD). The significant differences when comparing two groups were determined by a two‐tailed unpaired Student's t‐test (*P < 0.05, **P < 0.01, ***P < 0.001). When comparing more than two groups, significant differences were determined by one‐way ANOVA followed by Tukey's/Dunnett's post hoc tests (*/# P < 0.05, **/## P < 0.01, ***/### P < 0.001) or Kruskal–Wallis non‐parametric test followed by Dunn's post hoc test ($ P < 0.05, $$ P < 0.01, $$$ P < 0.001), after verifying normality (Shapiro–Wilk test). Statistical analyses were performed using SPSS for Windows version 12.0.
Author contributions
MD, MFB, SF, and AP conceived the study. PR‐R, NL, MR, NYC, and AN performed the experiments. PR‐R, NL, MR, NYC, AN, MP‐O, RP, IF, SF, and AP designed and/or interpreted aspects of the different experiments. AP led the project and acquired the main funding. PR‐R, SF, and AP wrote the original draft. PR‐R, SF, and AP reviewed and edited the manuscript. All the co‐authors gave inputs on the manuscript.
Conflict of interest
The authors declare that they have no conflict of interest.
The paper explained.
Problem
X‐linked adrenoleukodystrophy (X‐ALD) is a rare disease that met the public eye in the early 90s thanks to the movie Lorenzo's Oil which has, despite recent advances in gene therapy, still no satisfactory treatment for most cases. The underlying genetic defect causes the malfunction of the fatty acid transporter ABCD1. Because early hallmarks of X‐ALD are oxidative damage and bioenergetic impairment, here we evaluated the endogenous antioxidant response seeking for suitable drug targets.
Results
Using mouse models of X‐ALD and cells obtained from the skin of X‐ALD patients, we uncovered an impaired NRF2 antioxidant response caused by aberrant activity of GSK‐3β, a kinase upstream in this cascade. We found that GSK‐3β inhibitors reactivated the blunted NRF2 response in patients’ fibroblasts. In the mouse models (Abcd1 − and Abcd1 −/Abcd2 −/− mice), oral administration of dimethyl fumarate (DMF/BG12/Tecfidera), an FDA‐approved NRF2 activator, normalized molecular defects relative to ABCD1 deficiency such as (i) oxidative damage, (ii) mitochondrial depletion and bioenergetic failure, and (iii) neuroinflammation. Moreover, DMF halted axonal degeneration and locomotor disability in the mouse model.
Impact
This preclinical study identifies a druggable pathway underlying axonal degeneration in X‐ALD and paves the way to use dimethyl fumarate in phase II clinical trials. The study highlights as well the potential of drugs targeting the GSK‐3β/NRF2 axis for other axonal disorders with shared pathomechanisms.
For more information
(i) X‐ALD in OMIM: http://omim.org/entry/300100
(ii) X‐ALD database: http://adrenoleukodystrophy.info
(iii) European Leukodystrophy Association: http://ela-asso.com/en/
(iv) Author's website: http://www.neurometabolic-lab.org/
Supporting information
Appendix
Expanded View Figures PDF
Review Process File
Source Data for Figure 1
Source Data for Figure 2
Source Data for Figure 3
Acknowledgements
We thank Laia Grau, Juanjo Martínez, and Cristina Guilera (Neurometabolic Diseases Laboratory, IDIBELL) for technical assistance. IDIBELL is part of the CERCA Institution (Centres de Recerca de Catalunya) of the Generalitat of Catalonia. This study was supported by grants from the Spanish Institute for Health Carlos III and “Fondo Europeo de Desarrollo Regional (FEDER), Union Europea, una manera de hacer Europa” [PFIS FI12/00457] to P.R‐R., [FIS PI14/01115, FIS PI17/00134] to M.P.O., [FIS PI13/00584, FIS PI14/00328] to R.P., [FIS PI11/01043, FIS PI14/00410, FIS PI17/00916] to A.P., [Miguel Servet program CP11/00080, CPII16/00016, FIS PI15/00857] to S.F.; the European Commission [FP7‐241622] to A.P., the European Leukodystrophy Association [ELA2012‐033C1] to A.P; the Autonomous Government of Catalonia [SGR 2017SGR696] to R.P. and [SGR 2014SGR1430; 2017SGR1206] to A.P.; and the Centre for Biomedical Research on Rare Diseases (CIBERER) to N.L. and M.R. Locomotor experiments were performed by the SEFALer unit F5 (CIBERER) led by A.P.
EMBO Mol Med (2018) 10: e8604
Contributor Information
Stéphane Fourcade, Email: sfourcade@idibell.cat.
Aurora Pujol, Email: apujol@idibell.cat.
References
- Abmayr SM, Yao T, Parmely T, Workman JL (2006) Preparation of nuclear and cytoplasmic extracts from mammalian cells. Curr Protoc Mol Biol Chapter 12: Unit 12.11 [DOI] [PubMed] [Google Scholar]
- Ahuja M, Ammal Kaidery N, Yang L, Calingasan N, Smirnova N, Gaisin A, Gaisina IN, Gazaryan I, Hushpulian DM, Kaddour‐Djebbar I et al (2016) Distinct Nrf2 signaling mechanisms of fumaric acid esters and their role in neuroprotection against 1‐Methyl‐4‐Phenyl‐1,2,3,6‐tetrahydropyridine‐induced experimental parkinson's‐like disease. J Neurosci 36: 6332–6351 [DOI] [PMC free article] [PubMed] [Google Scholar]
- van de Beek MC, Ofman R, Dijkstra I, Wijburg F, Engelen M, Wanders R, Kemp S (2017) Lipid‐induced endoplasmic reticulum stress in X‐linked adrenoleukodystrophy. Biochim Biophys Acta 1863: 2255–2265 [DOI] [PubMed] [Google Scholar]
- Berger J, Molzer B, Fae I, Bernheimer H (1994) X‐linked adrenoleukodystrophy (ALD): a novel mutation of the ALD gene in 6 members of a family presenting with 5 different phenotypes. Biochem Biophys Res Commun 205: 1638–1643 [DOI] [PubMed] [Google Scholar]
- Bergstrom P, von Otter M, Nilsson S, Nilsson AC, Nilsson M, Andersen PM, Hammarsten O, Zetterberg H (2014) Association of NFE2L2 and KEAP1 haplotypes with amyotrophic lateral sclerosis. Amyotroph Lateral Scler Frontotemporal Degener 15: 130–137 [DOI] [PubMed] [Google Scholar]
- Beurel E, Kaidanovich‐Beilin O, Yeh WI, Song L, Palomo V, Michalek SM, Woodgett JR, Harrington LE, Eldar‐Finkelman H, Martinez A et al (2013) Regulation of Th1 cells and experimental autoimmune encephalomyelitis by glycogen synthase kinase‐3. J Immunol 190: 5000–5011 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brennan MS, Patel H, Allaire N, Thai A, Cullen P, Ryan S, Lukashev M, Bista P, Huang R, Rhodes KJ et al (2016) Pharmacodynamics of dimethyl fumarate are tissue specific and involve NRF2‐dependent and ‐independent mechanisms. Antioxid Redox Signal 24: 1058–1071 [DOI] [PubMed] [Google Scholar]
- Burton NC, Kensler TW, Guilarte TR (2006) In vivo modulation of the Parkinsonian phenotype by Nrf2. Neurotoxicology 27: 1094–1100 [DOI] [PubMed] [Google Scholar]
- Calkins MJ, Jakel RJ, Johnson DA, Chan K, Kan YW, Johnson JA (2005) Protection from mitochondrial complex II inhibition in vitro and in vivo by Nrf2‐mediated transcription. Proc Natl Acad Sci USA 102: 244–249 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cartier N, Hacein‐Bey‐Abina S, Bartholomae CC, Veres G, Schmidt M, Kutschera I, Vidaud M, Abel U, Dal‐Cortivo L, Caccavelli L et al (2009) Hematopoietic stem cell gene therapy with a lentiviral vector in X‐linked adrenoleukodystrophy. Science 326: 818–823 [DOI] [PubMed] [Google Scholar]
- Chen PC, Vargas MR, Pani AK, Smeyne RJ, Johnson DA, Kan YW, Johnson JA (2009) Nrf2‐mediated neuroprotection in the MPTP mouse model of Parkinson's disease: critical role for the astrocyte. Proc Natl Acad Sci USA 106: 2933–2938 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Coghlan MP, Culbert AA, Cross DA, Corcoran SL, Yates JW, Pearce NJ, Rausch OL, Murphy GJ, Carter PS, Roxbee Cox L et al (2000) Selective small molecule inhibitors of glycogen synthase kinase‐3 modulate glycogen metabolism and gene transcription. Chem Biol 7: 793–803 [DOI] [PubMed] [Google Scholar]
- Credle JJ, George JL, Wills J, Duka V, Shah K, Lee YC, Rodriguez O, Simkins T, Winter M, Moechars D et al (2015) GSK‐3beta dysregulation contributes to parkinson's‐like pathophysiology with associated region‐specific phosphorylation and accumulation of tau and alpha‐synuclein. Cell Death Differ 22: 838–851 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dinkova‐Kostova AT, Talalay P (2010) NAD(P)H:quinone acceptor oxidoreductase 1 (NQO1), a multifunctional antioxidant enzyme and exceptionally versatile cytoprotector. Arch Biochem Biophys 501: 116–123 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Duka T, Duka V, Joyce JN, Sidhu A (2009) Alpha‐Synuclein contributes to GSK‐3beta‐catalyzed Tau phosphorylation in Parkinson's disease models. FASEB J 23: 2820–2830 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Eichler F, Duncan C, Musolino PL, Orchard PJ, De Oliveira S, Thrasher AJ, Armant M, Dansereau C, Lund TC, Miller WP et al (2017) Hematopoietic stem‐cell gene therapy for cerebral adrenoleukodystrophy. N Engl J Med 377: 1630–1638 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ellrichmann G, Petrasch‐Parwez E, Lee DH, Reick C, Arning L, Saft C, Gold R, Linker RA (2011) Efficacy of fumaric acid esters in the R6/2 and YAC128 models of Huntington's disease. PLoS One 6: e16172 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Engelen M, Kemp S, de Visser M, van Geel BM, Wanders RJ, Aubourg P, Poll‐The BT (2012) X‐linked adrenoleukodystrophy (X‐ALD): clinical presentation and guidelines for diagnosis, follow‐up and management. Orphanet J Rare Dis 7: 51 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Engelen M, Barbier M, Dijkstra IM, Schur R, de Bie RM, Verhamme C, Dijkgraaf MG, Aubourg PA, Wanders RJ, van Geel BM et al (2014) X‐linked adrenoleukodystrophy in women: a cross‐sectional cohort study. Brain 137: 693–706 [DOI] [PubMed] [Google Scholar]
- Fancy SP, Baranzini SE, Zhao C, Yuk DI, Irvine KA, Kaing S, Sanai N, Franklin RJ, Rowitch DH (2009) Dysregulation of the Wnt pathway inhibits timely myelination and remyelination in the mammalian CNS. Genes Dev 23: 1571–1585 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Farr SA, Ripley JL, Sultana R, Zhang Z, Niehoff ML, Platt TL, Murphy MP, Morley JE, Kumar V, Butterfield DA (2014) Antisense oligonucleotide against GSK‐3beta in brain of SAMP8 mice improves learning and memory and decreases oxidative stress: involvement of transcription factor Nrf2 and implications for Alzheimer disease. Free Radic Biol Med 67: 387–395 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fourcade S, Lopez‐Erauskin J, Galino J, Duval C, Naudi A, Jove M, Kemp S, Villarroya F, Ferrer I, Pamplona R et al (2008) Early oxidative damage underlying neurodegeneration in X‐adrenoleukodystrophy. Hum Mol Genet 17: 1762–1773 [DOI] [PubMed] [Google Scholar]
- Fourcade S, Ruiz M, Camps C, Schluter A, Houten SM, Mooyer PA, Pampols T, Dacremont G, Wanders RJ, Giros M et al (2009) A key role for the peroxisomal ABCD2 transporter in fatty acid homeostasis. Am J Physiol Endocrinol Metab 296: E211–E221 [DOI] [PubMed] [Google Scholar]
- Fourcade S, Ruiz M, Guilera C, Hahnen E, Brichta L, Naudi A, Portero‐Otin M, Dacremont G, Cartier N, Wanders R et al (2010) Valproic acid induces antioxidant effects in X‐linked adrenoleukodystrophy. Hum Mol Genet 19: 2005–2014 [DOI] [PubMed] [Google Scholar]
- Fourcade S, Ferrer I, Pujol A (2015) Oxidative stress, mitochondrial and proteostasis malfunction in adrenoleukodystrophy: a paradigm for axonal degeneration. Free Radic Biol Med 88: 18–29 [DOI] [PubMed] [Google Scholar]
- Fox RJ, Miller DH, Phillips JT, Hutchinson M, Havrdova E, Kita M, Yang M, Raghupathi K, Novas M, Sweetser MT et al (2012) Placebo‐controlled phase 3 study of oral BG‐12 or glatiramer in multiple sclerosis. N Engl J Med 367: 1087–1097 [DOI] [PubMed] [Google Scholar]
- Fox RJ, Chan A, Gold R, Phillips JT, Selmaj K, Chang I, Novas M, Rana J, Marantz JL (2016) Characterizing absolute lymphocyte count profiles in dimethyl fumarate‐treated patients with MS: patient management considerations. Neurol Clin Pract 6: 220–229 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Galino J, Ruiz M, Fourcade S, Schluter A, Lopez‐Erauskin J, Guilera C, Jove M, Naudi A, Garcia‐Arumi E, Andreu AL et al (2011) Oxidative damage compromises energy metabolism in the axonal degeneration mouse model of x‐adrenoleukodystrophy. Antioxid Redox Signal 15: 2095–2107 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gieselbach RJ, Muller‐Hansma AH, Wijburg MT, de Bruin‐Weller MS, van Oosten BW, Nieuwkamp DJ, Coenjaerts FE, Wattjes MP, Murk JL (2017) Progressive multifocal leukoencephalopathy in patients treated with fumaric acid esters: a review of 19 cases. J Neurol 264: 1155–1164 [DOI] [PubMed] [Google Scholar]
- Gold R, Kappos L, Arnold DL, Bar‐Or A, Giovannoni G, Selmaj K, Tornatore C, Sweetser MT, Yang M, Sheikh SI et al (2012) Placebo‐controlled phase 3 study of oral BG‐12 for relapsing multiple sclerosis. N Engl J Med 367: 1098–1107 [DOI] [PubMed] [Google Scholar]
- Gopal S, Mikulskis A, Gold R, Fox RJ, Dawson KT, Amaravadi L (2017) Evidence of activation of the Nrf2 pathway in multiple sclerosis patients treated with delayed‐release dimethyl fumarate in the Phase 3 DEFINE and CONFIRM studies. Mult Scler 23: 1875–1883 [DOI] [PubMed] [Google Scholar]
- Guo X, Snider WD, Chen B (2016) GSK3beta regulates AKT‐induced central nervous system axon regeneration via an eIF2Bepsilon‐dependent, mTORC1‐independent pathway. Elife 5: e11903 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hayashi G, Jasoliya M, Sahdeo S, Saccà F, Pane C, Filla A, Marsili A, Puorro G, Lanzillo R, Brescia Morra V et al (2017) Dimethyl fumarate mediates Nrf2‐dependent mitochondrial biogenesis in mice and humans. Hum Mol Genet 26: 2864–2873 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hein S, Schonfeld P, Kahlert S, Reiser G (2008) Toxic effects of X‐linked adrenoleukodystrophy‐associated, very long chain fatty acids on glial cells and neurons from rat hippocampus in culture. Hum Mol Genet 17: 1750–1761 [DOI] [PubMed] [Google Scholar]
- Holmstrom KM, Baird L, Zhang Y, Hargreaves I, Chalasani A, Land JM, Stanyer L, Yamamoto M, Dinkova‐Kostova AT, Abramov AY (2013) Nrf2 impacts cellular bioenergetics by controlling substrate availability for mitochondrial respiration. Biol Open 2: 761–770 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hubbs AF, Benkovic SA, Miller DB, O'Callaghan JP, Battelli L, Schwegler‐Berry D, Ma Q (2007) Vacuolar leukoencephalopathy with widespread astrogliosis in mice lacking transcription factor Nrf2. Am J Pathol 170: 2068–2076 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Innamorato NG, Rojo AI, Garcia‐Yague AJ, Yamamoto M, de Ceballos ML, Cuadrado A (2008) The transcription factor Nrf2 Is a therapeutic target against brain inflammation. J Immunol 181: 680–689 [DOI] [PubMed] [Google Scholar]
- Itoh K, Chiba T, Takahashi S, Ishii T, Igarashi K, Katoh Y, Oyake T, Hayashi N, Satoh K, Hatayama I et al (1997) An Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzyme genes through antioxidant response elements. Biochem Biophys Res Commun 236: 313–322 [DOI] [PubMed] [Google Scholar]
- Jakel RJ, Townsend JA, Kraft AD, Johnson JA (2007) Nrf2‐mediated protection against 6‐hydroxydopamine. Brain Res 1144: 192–201 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jing X, Shi H, Zhang C, Ren M, Han M, Wei X, Zhang X, Lou H (2015) Dimethyl fumarate attenuates 6‐OHDA‐induced neurotoxicity in SH‐SY5Y cells and in animal model of Parkinson's disease by enhancing Nrf2 activity. Neuroscience 286: 131–140 [DOI] [PubMed] [Google Scholar]
- Johnson DA, Amirahmadi S, Ward C, Fabry Z, Johnson JA (2010) The absence of the pro‐antioxidant transcription factor Nrf2 exacerbates experimental autoimmune encephalomyelitis. Toxicol Sci 114: 237–246 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Johnson DA, Johnson JA (2015) Nrf2–a therapeutic target for the treatment of neurodegenerative diseases. Free Radic Biol Med 88: 253–267 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kaidery NA, Banerjee R, Yang L, Smirnova NA, Hushpulian DM, Liby KT, Williams CR, Yamamoto M, Kensler TW, Ratan RR et al (2013) Targeting Nrf2‐mediated gene transcription by extremely potent synthetic triterpenoids attenuate dopaminergic neurotoxicity in the MPTP mouse model of Parkinson's disease. Antioxid Redox Signal 18: 139–157 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kanninen K, Malm TM, Jyrkkanen HK, Goldsteins G, Keksa‐Goldsteine V, Tanila H, Yamamoto M, Yla‐Herttuala S, Levonen AL, Koistinaho J (2008) Nuclear factor erythroid 2‐related factor 2 protects against beta amyloid. Mol Cell Neurosci 39: 302–313 [DOI] [PubMed] [Google Scholar]
- Kanninen K, Heikkinen R, Malm T, Rolova T, Kuhmonen S, Leinonen H, Yla‐Herttuala S, Tanila H, Levonen AL, Koistinaho M et al (2009) Intrahippocampal injection of a lentiviral vector expressing Nrf2 improves spatial learning in a mouse model of Alzheimer's disease. Proc Natl Acad Sci USA 106: 16505–16510 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kemper AR, Brosco J, Comeau AM, Green NS, Grosse SD, Jones E, Kwon JM, Lam WK, Ojodu J, Prosser LA et al (2017) Newborn screening for X‐linked adrenoleukodystrophy: evidence summary and advisory committee recommendation. Genet Med 19: 121–126 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Komatsu M, Kurokawa H, Waguri S, Taguchi K, Kobayashi A, Ichimura Y, Sou YS, Ueno I, Sakamoto A, Tong KI et al (2010) The selective autophagy substrate p62 activates the stress responsive transcription factor Nrf2 through inactivation of Keap1. Nat Cell Biol 12: 213–223 [DOI] [PubMed] [Google Scholar]
- Kraft AD, Johnson DA, Johnson JA (2004) Nuclear factor E2‐related factor 2‐dependent antioxidant response element activation by tert‐butylhydroquinone and sulforaphane occurring preferentially in astrocytes conditions neurons against oxidative insult. J Neurosci 24: 1101–1112 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lastres‐Becker I, Garcia‐Yague AJ, Scannevin RH, Casarejos MJ, Kugler S, Rabano A, Cuadrado A (2016) Repurposing the NRF2 activator dimethyl fumarate as therapy against synucleinopathy in Parkinson's disease. Antioxid Redox Signal 25: 61–77 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lau A, Tian W, Whitman SA, Zhang DD (2013) The predicted molecular weight of Nrf2: it is what it is not. Antioxid Redox Signal 18: 91–93 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Launay N, Ruiz M, Fourcade S, Schluter A, Guilera C, Ferrer I, Knecht E, Pujol A (2013) Oxidative stress regulates the ubiquitin‐proteasome system and immunoproteasome functioning in a mouse model of X‐adrenoleukodystrophy. Brain 136: 891–904 [DOI] [PubMed] [Google Scholar]
- Launay N, Aguado C, Fourcade S, Ruiz M, Grau L, Riera J, Guilera C, Giros M, Ferrer I, Knecht E et al (2015) Autophagy induction halts axonal degeneration in a mouse model of X‐adrenoleukodystrophy. Acta Neuropathol 129: 399–415 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Launay N, Ruiz M, Grau L, Ortega FJ, Ilieva EV, Martinez JJ, Galea E, Ferrer I, Knecht E, Pujol A et al (2017) Tauroursodeoxycholic bile acid arrests axonal degeneration by inhibiting the unfolded protein response in X‐linked adrenoleukodystrophy. Acta Neuropathol 133: 283–301 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee JM, Calkins MJ, Chan K, Kan YW, Johnson JA (2003) Identification of the NF‐E2‐related factor‐2‐dependent genes conferring protection against oxidative stress in primary cortical astrocytes using oligonucleotide microarray analysis. J Biol Chem 278: 12029–12038 [DOI] [PubMed] [Google Scholar]
- Li H, Li SH, Yu ZX, Shelbourne P, Li XJ (2001) Huntingtin aggregate‐associated axonal degeneration is an early pathological event in Huntington's disease mice. J Neurosci 21: 8473–8481 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lin MT, Beal MF (2006) Mitochondrial dysfunction and oxidative stress in neurodegenerative diseases. Nature 443: 787–795 [DOI] [PubMed] [Google Scholar]
- Linker RA, Lee DH, Ryan S, van Dam AM, Conrad R, Bista P, Zeng W, Hronowsky X, Buko A, Chollate S et al (2011) Fumaric acid esters exert neuroprotective effects in neuroinflammation via activation of the Nrf2 antioxidant pathway. Brain 134: 678–692 [DOI] [PubMed] [Google Scholar]
- Llorens‐Martin M, Jurado J, Hernandez F, Avila J (2014) GSK‐3beta, a pivotal kinase in Alzheimer disease. Front Mol Neurosci 7: 46 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lopez‐Erauskin J, Fourcade S, Galino J, Ruiz M, Schluter A, Naudi A, Jove M, Portero‐Otin M, Pamplona R, Ferrer I et al (2011) Antioxidants halt axonal degeneration in a mouse model of X‐adrenoleukodystrophy. Ann Neurol 70: 84–92 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lopez‐Erauskin J, Galino J, Ruiz M, Cuezva JM, Fabregat I, Cacabelos D, Boada J, Martinez J, Ferrer I, Pamplona R et al (2013) Impaired mitochondrial oxidative phosphorylation in the peroxisomal disease X‐linked adrenoleukodystrophy. Hum Mol Genet 22: 3296–3305 [DOI] [PubMed] [Google Scholar]
- Lovestone S, Boada M, Dubois B, Hull M, Rinne JO, Huppertz HJ, Calero M, Andres MV, Gomez‐Carrillo B, Leon T et al, (2015) A phase II trial of tideglusib in Alzheimer's disease. J Alzheimers Dis 45: 75–88 [DOI] [PubMed] [Google Scholar]
- Mastroeni R, Bensadoun JC, Charvin D, Aebischer P, Pujol A, Raoul C (2009) Insulin‐like growth factor‐1 and neurotrophin‐3 gene therapy prevents motor decline in an X‐linked adrenoleukodystrophy mouse model. Ann Neurol 66: 117–122 [DOI] [PubMed] [Google Scholar]
- McMahon M, Itoh K, Yamamoto M, Chanas SA, Henderson CJ, McLellan LI, Wolf CR, Cavin C, Hayes JD (2001) The Cap'n'Collar basic leucine zipper transcription factor Nrf2 (NF‐E2 p45‐related factor 2) controls both constitutive and inducible expression of intestinal detoxification and glutathione biosynthetic enzymes. Cancer Res 61: 3299–3307 [PubMed] [Google Scholar]
- Miller WP, Rothman SM, Nascene D, Kivisto T, DeFor TE, Ziegler RS, Eisengart J, Leiser K, Raymond G, Lund TC et al (2011) Outcomes after allogeneic hematopoietic cell transplantation for childhood cerebral adrenoleukodystrophy: the largest single‐institution cohort report. Blood 118: 1971–1978 [DOI] [PubMed] [Google Scholar]
- Mishra HK, Prots I, Havlicek S, Kohl Z, Perez‐Branguli F, Boerstler T, Anneser L, Minakaki G, Wend H, Hampl M et al (2016) GSK3beta‐dependent dysregulation of neurodevelopment in SPG11‐patient iPSC model. Ann Neurol 79: 826–840 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Morales Pantoja IE, Hu CL, Perrone‐Bizzozero NI, Zheng J, Bizzozero OA (2016) Nrf2‐dysregulation correlates with reduced synthesis and low glutathione levels in experimental autoimmune encephalomyelitis. J Neurochem 139: 640–650 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Morato L, Galino J, Ruiz M, Calingasan NY, Starkov AA, Dumont M, Naudi A, Martinez JJ, Aubourg P, Portero‐Otin M et al (2013) Pioglitazone halts axonal degeneration in a mouse model of X‐linked adrenoleukodystrophy. Brain 136: 2432–2443 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Morato L, Ruiz M, Boada J, Calingasan NY, Galino J, Guilera C, Jove M, Naudi A, Ferrer I, Pamplona R et al (2015) Activation of sirtuin 1 as therapy for the peroxisomal disease adrenoleukodystrophy. Cell Death Differ 22: 1742–1753 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moser HW, Moser AB, Kawamura N, Murphy J, Suzuki K, Schaumburg H, Kishimoto Y (1980) Adrenoleukodystrophy: elevated C26 fatty acid in cultured skin fibroblasts. Ann Neurol 7: 542–549 [DOI] [PubMed] [Google Scholar]
- Mosser J, Douar AM, Sarde CO, Kioschis P, Feil R, Moser H, Poustka AM, Mandel JL, Aubourg P (1993) Putative X‐linked adrenoleukodystrophy gene shares unexpected homology with ABC transporters. Nature 361: 726–730 [DOI] [PubMed] [Google Scholar]
- Muneer Z, Wiesinger C, Voigtlander T, Werner HB, Berger J, Forss‐Petter S (2014) Abcd2 is a strong modifier of the metabolic impairments in peritoneal macrophages of ABCD1‐deficient mice. PLoS One 9: e108655 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Neymotin A, Calingasan NY, Wille E, Naseri N, Petri S, Damiano M, Liby KT, Risingsong R, Sporn M, Beal MF et al (2011) Neuroprotective effect of Nrf2/ARE activators, CDDO ethylamide and CDDO trifluoroethylamide, in a mouse model of amyotrophic lateral sclerosis. Free Radic Biol Med 51: 88–96 [DOI] [PMC free article] [PubMed] [Google Scholar]
- von Otter M, Landgren S, Nilsson S, Celojevic D, Bergstrom P, Hakansson A, Nissbrandt H, Drozdzik M, Bialecka M, Kurzawski M et al (2010a) Association of Nrf2‐encoding NFE2L2 haplotypes with Parkinson's disease. BMC Med Genet 11: 36 [DOI] [PMC free article] [PubMed] [Google Scholar]
- von Otter M, Landgren S, Nilsson S, Zetterberg M, Celojevic D, Bergstrom P, Minthon L, Bogdanovic N, Andreasen N, Gustafson D et al (2010b) Nrf2‐encoding NFE2L2 haplotypes influence disease progression but not risk in Alzheimer's disease and age‐related cataract. Mech Ageing Dev 131: 105–110 [DOI] [PubMed] [Google Scholar]
- Pajares M, Jimenez‐Moreno N, Garcia‐Yague AJ, Escoll M, de Ceballos ML, Van Leuven F, Rabano A, Yamamoto M, Rojo AI, Cuadrado A (2016) Transcription factor NFE2L2/NRF2 is a regulator of macroautophagy genes. Autophagy 12: 1902–1916 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pardo G, Jones DE (2017) The sequence of disease‐modifying therapies in relapsing multiple sclerosis: safety and immunologic considerations. J Neurol 264: 2351–2374 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Parodi B, Rossi S, Morando S, Cordano C, Bragoni A, Motta C, Usai C, Wipke BT, Scannevin RH, Mancardi GL et al (2015) Fumarates modulate microglia activation through a novel HCAR2 signaling pathway and rescue synaptic dysregulation in inflamed CNS. Acta Neuropathol 130: 279–295 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Paupe V, Dassa EP, Goncalves S, Auchere F, Lonn M, Holmgren A, Rustin P (2009) Impaired nuclear Nrf2 translocation undermines the oxidative stress response in Friedreich ataxia. PLoS One 4: e4253 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peng H, Li H, Sheehy A, Cullen P, Allaire N, Scannevin RH (2016) Dimethyl fumarate alters microglia phenotype and protects neurons against proinflammatory toxic microenvironments. J Neuroimmunol 299: 35–44 [DOI] [PubMed] [Google Scholar]
- Petrillo S, Piemonte F, Pastore A, Tozzi G, Aiello C, Pujol A, Cappa M, Bertini E (2013) Glutathione imbalance in patients with X‐linked adrenoleukodystrophy. Mol Genet Metab 109: 366–370 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Powers JM, Pei Z, Heinzer AK, Deering R, Moser AB, Moser HW, Watkins PA, Smith KD (2005) Adreno‐leukodystrophy: oxidative stress of mice and men. J Neuropathol Exp Neurol 64: 1067–1079 [DOI] [PubMed] [Google Scholar]
- Pujol A, Hindelang C, Callizot N, Bartsch U, Schachner M, Mandel JL (2002) Late onset neurological phenotype of the X‐ALD gene inactivation in mice: a mouse model for adrenomyeloneuropathy. Hum Mol Genet 11: 499–505 [DOI] [PubMed] [Google Scholar]
- Pujol A, Ferrer I, Camps C, Metzger E, Hindelang C, Callizot N, Ruiz M, Pampols T, Giros M, Mandel JL (2004) Functional overlap between ABCD1 (ALD) and ABCD2 (ALDR) transporters: a therapeutic target for X‐adrenoleukodystrophy. Hum Mol Genet 13: 2997–3006 [DOI] [PubMed] [Google Scholar]
- Rada P, Rojo AI, Chowdhry S, McMahon M, Hayes JD, Cuadrado A (2011) SCF/{beta}‐TrCP promotes glycogen synthase kinase 3‐dependent degradation of the Nrf2 transcription factor in a Keap1‐independent manner. Mol Cell Biol 31: 1121–1133 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ramsey CP, Glass CA, Montgomery MB, Lindl KA, Ritson GP, Chia LA, Hamilton RL, Chu CT, Jordan‐Sciutto KL (2007) Expression of Nrf2 in neurodegenerative diseases. J Neuropathol Exp Neurol 66: 75–85 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ring DB, Johnson KW, Henriksen EJ, Nuss JM, Goff D, Kinnick TR, Ma ST, Reeder JW, Samuels I, Slabiak T et al (2003) Selective glycogen synthase kinase 3 inhibitors potentiate insulin activation of glucose transport and utilization in vitro and in vivo . Diabetes 52: 588–595 [DOI] [PubMed] [Google Scholar]
- van Roermund CW, Visser WF, Ijlst L, van Cruchten A, Boek M, Kulik W, Waterham HR, Wanders RJ (2008) The human peroxisomal ABC half transporter ALDP functions as a homodimer and accepts acyl‐CoA esters. FASEB J 22: 4201–4208 [DOI] [PubMed] [Google Scholar]
- Rojo AI, Sagarra MR, Cuadrado A (2008) GSK‐3beta down‐regulates the transcription factor Nrf2 after oxidant damage: relevance to exposure of neuronal cells to oxidative stress. J Neurochem 105: 192–202 [DOI] [PubMed] [Google Scholar]
- Rojo AI, Innamorato NG, Martin‐Moreno AM, De Ceballos ML, Yamamoto M, Cuadrado A (2010) Nrf2 regulates microglial dynamics and neuroinflammation in experimental Parkinson's disease. Glia 58: 588–598 [DOI] [PubMed] [Google Scholar]
- Ruiz M, Jove M, Schluter A, Casasnovas C, Villarroya F, Guilera C, Ortega FJ, Naudi A, Pamplona R, Gimeno R et al (2015) Altered glycolipid and glycerophospholipid signaling drive inflammatory cascades in adrenomyeloneuropathy. Hum Mol Genet 24: 6861–6876 [DOI] [PubMed] [Google Scholar]
- Salazar M, Rojo AI, Velasco D, de Sagarra RM, Cuadrado A (2006) Glycogen synthase kinase‐3beta inhibits the xenobiotic and antioxidant cell response by direct phosphorylation and nuclear exclusion of the transcription factor Nrf2. J Biol Chem 281: 14841–14851 [DOI] [PubMed] [Google Scholar]
- Sarlette A, Krampfl K, Grothe C, Neuhoff N, Dengler R, Petri S (2008) Nuclear erythroid 2‐related factor 2‐antioxidative response element signaling pathway in motor cortex and spinal cord in amyotrophic lateral sclerosis. J Neuropathol Exp Neurol 67: 1055–1062 [DOI] [PubMed] [Google Scholar]
- Scannevin RH, Chollate S, Jung MY, Shackett M, Patel H, Bista P, Zeng W, Ryan S, Yamamoto M, Lukashev M et al (2012) Fumarates promote cytoprotection of central nervous system cells against oxidative stress via the nuclear factor (erythroid‐derived 2)‐like 2 pathway. J Pharmacol Exp Ther 341: 274–284 [DOI] [PubMed] [Google Scholar]
- Schilling S, Goelz S, Linker R, Luehder F, Gold R (2006) Fumaric acid esters are effective in chronic experimental autoimmune encephalomyelitis and suppress macrophage infiltration. Clin Exp Immunol 145: 101–107 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schluter A, Espinosa L, Fourcade S, Galino J, Lopez E, Ilieva E, Morato L, Asheuer M, Cook T, McLaren A et al (2012) Functional genomic analysis unravels a metabolic‐inflammatory interplay in adrenoleukodystrophy. Hum Mol Genet 21: 1062–1077 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shan Y, Schoenfeld RA, Hayashi G, Napoli E, Akiyama T, Iodi Carstens M, Carstens EE, Pook MA, Cortopassi GA (2013) Frataxin deficiency leads to defects in expression of antioxidants and Nrf2 expression in dorsal root ganglia of the Friedreich's ataxia YG8R mouse model. Antioxid Redox Signal 19: 1481–1493 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shih AY, Imbeault S, Barakauskas V, Erb H, Jiang L, Li P, Murphy TH (2005) Induction of the Nrf2‐driven antioxidant response confers neuroprotection during mitochondrial stress in vivo . J Biol Chem 280: 22925–22936 [DOI] [PubMed] [Google Scholar]
- da Silva TF, Eira J, Lopes AT, Malheiro AR, Sousa V, Luoma A, Avila RL, Wanders RJ, Just WW, Kirschner DA et al (2014) Peripheral nervous system plasmalogens regulate Schwann cell differentiation and myelination. J Clin Invest 124: 2560–2570 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stack C, Ho D, Wille E, Calingasan NY, Williams C, Liby K, Sporn M, Dumont M, Beal MF (2011) Triterpenoids CDDO‐ethyl amide and CDDO‐trifluoroethyl amide improve the behavioral phenotype and brain pathology in a transgenic mouse model of Huntington's disease. Free Radic Biol Med 49: 147–158 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tallantyre E, Bo L, Al‐Rawashdeh O, Owens T, Polman C, Lowe J, Evangelou N (2010) Clinico‐pathological evidence that axonal loss underlies disability in progressive multiple sclerosis. Mult Scler J 16: 406–411 [DOI] [PubMed] [Google Scholar]
- Tolosa E, Litvan I, Hoglinger GU, Burn D, Lees A, Andres MV, Gomez‐Carrillo B, Leon T, Del Ser T, Investigators T (2014) A phase 2 trial of the GSK‐3 inhibitor tideglusib in progressive supranuclear palsy. Mov Disord 29: 470–478 [DOI] [PubMed] [Google Scholar]
- Turk BR, Theisen BE, Nemeth CL, Marx JS, Shi X, Rosen M, Jones RO, Moser AB, Watkins PA, Raymond GV et al (2017) Antioxidant capacity and superoxide dismutase activity in adrenoleukodystrophy. JAMA Neurol 74: 519–524 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vargas CR, Wajner M, Sirtori LR, Goulart L, Chiochetta M, Coelho D, Latini A, Llesuy S, Bello‐Klein A, Giugliani R et al (2004) Evidence that oxidative stress is increased in patients with X‐linked adrenoleukodystrophy. Biochim Biophys Acta 1688: 26–32 [DOI] [PubMed] [Google Scholar]
- Wang Q, Li WX, Dai SX, Guo YC, Han FF, Zheng JJ, Li GH, Huang JF (2017) Meta‐analysis of Parkinson's disease and alzheimer's disease revealed commonly impaired pathways and dysregulation of NRF2‐dependent genes. J Alzheimers Dis 56: 1525–1539 [DOI] [PubMed] [Google Scholar]
- Wiesinger C, Kunze M, Regelsberger G, Forss‐Petter S, Berger J (2013) Impaired very long‐chain acyl‐CoA beta‐oxidation in human X‐linked adrenoleukodystrophy fibroblasts is a direct consequence of ABCD1 transporter dysfunction. J Biol Chem 288: 19269–19279 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Appendix
Expanded View Figures PDF
Review Process File
Source Data for Figure 1
Source Data for Figure 2
Source Data for Figure 3