Abstract
Background and Objectives:
Diarrheal disease is still a major health problem in developing countries, where it is considered as one of the leading causes of morbidity and mortality especially in children. Escherichia coli is one of the important enteropathogenic bacteria which causes diarrhea in people. The aim of this study was to investigate the prevalence and antimicrobial resistance of shiga toxin–producing E. coli (STEC), Enterohaemorrhagic E. coli (EHEC), and Enteropathogenic E. coli (EPEC) in fecal samples collected from patients with acute diarrhea in a number of Iranian provinces.
Materials and Methods:
A total of 102 strains of E. coli were isolated from fecal samples collected from patients with acute diarrhea using microbiological phenotypic tests. The antibiotic susceptibility pattern of all isolates was determined by the disk agar diffusion (DAD) method. The presence of eae, bfp, stx1, sts2 and EAF genes in the isolates was investigated by PCR. The results were analyzed by SPSS; version 17.0 software.
Results:
Out of 102 E. coli isolates screened for specific genes, 52 strains of E. coli were identified to harbor STEC 26 (50%), EPEC 13 (25%) and EHEC 13 (25%). Greatest resistance was observed to amoxicillin and ampicillin 40 (76.9%), and most sensitivity to imipenem 52 (100%) and gentamicin 40 (76.9%). We also found that 80.77% of diarrheic E. coli isolates were multidrug resistant (MDR).
Conclusion:
The results showed that E. coli is one of the major causes of diarrhea and is highly resistant to commonly used antibiotics; therefore, officials must pay great attention to this issue in order to increase the health of the community.
Keywords: Diarrhea, Enteropathogenic Escherichia coli, Enterohaemorrhagic Escherichia coli, Shiga toxin-producing Escherichia coli
INTRODUCTION
Diarrheal disease is still a major health problem and is one of the most common causes of morbidity and mortality among infants and young children, especially in developing countries, accounting for around 2 million deaths annually (1, 2). In the past decades, diarrhea was one of the major causes of infant deaths in Iran (3). Among the bacterial pathogens, diarrheagenic Escherichia coli (DEC) is one of the important etiological agents of diarrhea (4). Strains of diarrheagenic E. coli, which cause diarrhea in humans, can be classified into at least seven different categories on the basis of their specific virulence properties, distinct epidemiology, and clinical features: Enterotoxigenic E. coli (ETEC), Enteroinvasive E. coli (EIEC), Enteroaggregative E. coli (EAEC), Diffuse-Adhering E. coli (DAEC), Cytolethal distending toxin-producing E. coli, Enteropathogenic E. coli (EPEC), and Enterohaemorrhagic E. coli (EHEC) (4, 5). The epidemiological significance of each DEC category in childhood diarrhea varies with the geographical area. As expected, it has become obvious that there are important regional differences in prevalence and other epidemiological features of these pathogens (2, 6).
EPEC was the first pathovar of E. coli to be recognized as a diarrheal pathogen (7, 8), and it plays an important role as a causative agent of infantile diarrhea among children in developing countries (9). These strains harbor both the bundle-forming pilus gene (bfpA) and Intimin, which is encoded by the chromosomal eae gene, which possess the ability to form A/E lesions on intestinal cells and do not contain shiga toxin encoding genes (2).
EPEC and STEC (Shiga toxin–producing E. coli) are distinguished by presence of the shiga toxin encoding genes (stx1 and stx2), being present only in STEC (4). The term EHEC is used to denote only the subset of stx positive strains that also contain Intimin (eae gene), which is part of a pathogenicity island termed the locus for enterocyte effacement (LEE) (10). However, there are LEE-negative STEC strains that are associated with disease (11). To identify DEC strains correctly, these organisms must be differentiated from non-pathogenic members of the normal flora by PCR to identify presence of specific virulence genes, which are absent in nonpathogenic strains (12).
Due to the importance of epidemiological scientific research into the prevalence and occurrence of outbreaks, determination of resistance to antibiotics is very important in bacterial isolates. Further, regular surveillance of antibiotic resistance provides information for antibiotic therapy and resistance control (12). In this study, we determined the prevalence of STEC and EPEC from acute diarrheagenic fecal samples in randomly-selected populations in Iran using culture and PCR to detect presence of eaeA, stx1, stx2, bfp and EAF genes and determined antimicrobial resistance profiles of the isolates.
MATERIALS AND METHODS
Definitions.
Diarrhea was defined as at least three loose stools in 24 h, any number of watery stools, or one or two loose stools in 24 h accompanied by at least one of the following symptoms: nausea, vomiting, abdominal cramps or fever of 38°C. Acute diarrhea was defined as diarrhea that lasted 14 days or less at the time of presentation. Isolates from children with persistent diarrhea were not included in this study. Persistent diarrhea was defined as diarrhea which lasted for more than 14 days at presentation. When diarrhea was present intermittently, it was considered persistent when diarrhea occurred during at least six days in a two-week period (13).
Sample collections and identification of isolates.
The present study included 102 E. coli strains isolated from 158 stool samples collected from patients (7 months to 90 years) with diarrhea who were referred to different hospitals in the north and northwest and western regions of Iran between 2012 and 2013. These isolates were stored on solid Luria-Bertani (LB) (1% tryptone, 0.5% yeast extract, 0.5% NaCl) medium at the Molecular Biology Department of Pasteur Institute of Iran.
At the time of this study in April 2014, a loopful of the LB agar was inoculated on LB broth and incubated at 37°C with shaking for 24 hrs. Then, it was inoculated on MacConkey (Merck, Germany) agar plates and incubated at 37°C for 24 hrs. Subsequently, E. coli-like colonies were subjected to different standard biochemical tests, including sugar fermentation, Simmons citrate agar, indole production, Motility, Methyl-Red, and Voges-Proskauer (IMVIC) methods described by Cowan (7). A sweep of five E. coli colonies on MacConkey agar were inoculated in LB broth and incubated overnight at 37°C and then stoked at −20°C until used.
Molecular diagnosis.
E. coli genomic DNA was extracted using a DNA extraction kit (Gene JET Plasmid Miniprep., Fermentas Company, Lithuania) according to manufacturer′s instructions. E. coli colonies were tested by PCR for the virulence genes. The primers (Table 1) were selected to detect five different virulence genes (stx1, stx2, eaeA, bfp and EAF) simultaneously in a single reaction. EPEC and EHEC were distinguished by presence of the Shiga toxin-encoding (stx1 and/or stx2) genes, which are present only in EHEC.
Table 1.
Primer sequences used for the polymerase chain reaction assay in this study
| Name | Sequence (5′ to 3′) | Size (bp) |
|---|---|---|
| eaeA | F CAGGTCGTCGTGTCTGCTAAA | 570 |
| eaeA | R TCAGCGTGGTTGGATCAACCT | |
| stx1 | F CGATGTTACGGTTTGTTACTGTGACAGC | 244 |
| stx1 | R AATGCCACGCTTCCCAGAATTG | |
| stx2 | F GTTTTGACCATCTTCGTCTGATTATTGAG | 324 |
| stx2 | R AGCGTAAGGCTTCTGCTGTGAC | |
| bfp | F GACACCTCATTGCTGAAGTCG | 910 |
| bfp | R CCAGAACACCTCCGTTATGC | |
| EAF | F CAGGGTAAAAGAAAGATGATAA | 397 |
| EAF | R TATGGGGACCATGTATTATCA |
Amplification was performed in a reaction mixture with a total volume of 25 μL and using 12.5 μL PCR Master Mix 2x, manufactured by FermentasCompany (Lithuania) containing 400 mM deoxy-nucleoside triphosphates, 4 mM MgCl2, 0.05 U/μL Taq DNA polymerase, 5.5 μL sterile Double distilled water, 1 μL from each primers, and 5 μL DNA template. Cycling parameter was used as follows: 95°C for 5 min to initially denature the DNA, then 30 cycles of 1 min at 94°C, 1 min at 50°C, 1 min at 72°C, and finally single prolonged extension at 72°C for 10 min for eaeA, stx1 and stx2 genes, and 3 min at 95°C, then 35 cycles of 1 min at 94°C, 45 sec at 55°C, 45 sec at 72°C, and finally a single prolonged extension at 72°C for 10 min for bfp and EAF genes. A negative control lacking a DNA template and/or E. coli K-12 was included in each experiment to exclude the possibility of reagent contamination. The E. coli strain used as positive control in the PCR test included E. coli ATCC E234864 (eaeA, bfp and EAF positive) and E. coli ATCC O157:H7 (eaeA, stx1 and stx2 positive) (7). The amplified product was visualized by gel electrophoresis in 1.5% agarose gel containing ethidium bromide for 45 min at 100 V and then visualized under UV light.
Antimicrobial susceptibility testing.
Antimicrobial susceptibilities of the isolates that yielded positive results in the PCR assay were determined on Mueller-Hinton agar (Merck, Germany) by the Kirby-Bauer method, according to the Clinical and Laboratory Standard Institute (CLSI) protocol (14). Twelve commercial antibacterial discs (PadtanTeb, Iran) from different classes, which are generally used in medical diagnostic laboratories in Iran, were employed. The discs included nalidixic acid (NA, 30 μg), gentamicin (G, 10 μg), ampicillin (AM, 10 μg), amoxicillin/clavulanate (AMC, 30 μg), amoxicillin (AMX, 25 μg), trimethoprim-sulfamethoxazole (STX, 25 μg), tetracycline (TE, 30 μg), ceftriaxone (CRO, 30 μg), cefixime (CFM, 5 μg), ciprofloxacin (CP, 5 μg), cephalothin (CF, 30 μg), and imipenem (IPM, 10 μg).
Statistical analysis.
The data were analyzed with SSPS version 17.0 software (SPSS). The χ2 test was used to determine the statistical significance of the data. A p value of ≤ 0.05 was considered as significant.
RESULTS
Out of 102 E. coli isolates (five colony from each stool sample; 510 colonies) which were identified by biochemical tests, a total of 52 isolates were identified as diarrheagenic E. coli by PCR: 13 (25%) EPEC (eaeA, and/or bfp and/or EAF positive), 26 (50%) STEC (stx1 and/or stx2, positive) and 13 (25%) EHEC (stx1 and/or stx2 and eaeA positive). Among 26 STEC isolates, 15 (57.7%) strains were stx1+, 3 (11.5%) isolates were stx2+, and 8 (30.8%) isolates were positive for stx1 and stx2. The results of our study showed that among 13 EHEC isolates, 8 (61.54%) strains were eaeA+ and stx1+, 3 (23.08%) isolates were eaeA+, stx1+, stx2+, and 2 (15.38%) isolates were eaeA+, stx2+. The results showed that among 13 EPEC isolates, 11 (84.62%) strains were eaeA+, and 2 (15.38%) isolates were eaeA+ and bfp+.
Totally, 20 (55.5%) diarrheagenic E. coli were isolated from 36 children and 32 (48.4%) of 66 adult with acute diarrhea. The sex distribution was 33 (56%) male and 19 (44%) female. The most prevalent pathotype in the diarrheal patients was STEC (50%) isolates, followed by EHEC (25%) and EPEC (25%).
The results showed that EPEC has the highest incidence in the autumn (11.53), followed by EHEC in the summer (15.38), and STEC in the winter (23.07%). The isolates of E. coli were detected in all age groups, and there was no statistical significant difference between the frequency of isolation, age and sex.
Antimicrobial susceptibility testing.
The results of antimicrobial susceptibility testing of 52 E. coli strains isolated from diarrheal patients to 12 antibiotics are shown in Table 2. The most prevalent resistance profiles were ampicillin and amoxicillin (40 isolates, 76.9%) followed by cephalothin (36 isolates, 69.2%). Imipenem was found to be the most effective antibiotic with a susceptible rate of 100% (52 isolates, 100%), followed by gentamicin (40 isolates, 76.9%). Of the 52 strains tested, 42 (80.77%) were multidrug resistant (resistant to more than six antimicrobial drugs).
Table 2.
Results of antimicrobial resistance of E. coli isolates using disk diffusion method.
| Antimicrobial agents | Resistant No (%) | |||
|---|---|---|---|---|
| EHEC | STEC | EPEC | Total | |
| Nalidixic Acid | 11 (84.61) | 16 (61.53) | 6 (46.15) | 33 (63.5) |
| Gentamicin | 2 (15.38) | 6 (23.07) | 1 (7.69) | 10 (19.2) |
| Ampicillin | 11 (84.61) | 21 (80.76) | 8 (61.53) | 40 (76.9) |
| Amoxi-Clav | 4 (30.76) | 7 (26.92) | 1 (7.69) | 13 (25) |
| Amoxicillin | 11 (84.61) | 20 (76.92) | 9 (69.23) | 40 (76.9) |
| Co-trimoxazole | 8 (61.53) | 6 (23.07) | 5 (38.46) | 32 (61.5) |
| Tetracycline | 10 (76.92) | 18 (69.23) | (46.15)6 | 34 (65.4) |
| Ceftriaxone | 4 (30.76) | 5 (19.23) | 2 (15.38) | 1 (21.2) |
| Cefixime | 6 (46.15) | 7 (26.92) | 3 (23.07) | 14 (26.9) |
| Ciprofloxacin | 7 (53.84) | 7 (26.92) | 4 (30.76) | 18 (34.6) |
| Cephalothin | 12 (92.30) | 18 (69.23) | 6 (46.15) | 36 (69.2) |
| Imipenem | 0 (0) | 0 (0) | 0 (0) | 0 (0) |
DISCUSSION
Studies in Iran showed that DEC, such as EPEC and STEC strains, are among the most prevalent causative agents in acute diarrhea, particularly in children (15, 16). In our research blood was reported in all feces of patients with the EHEC pathotype, but none of them belonged to the O157:H7 serotype. These data reconfirmed geographical variation and showed absence of the O157:H7 serotype among STEC isolates in our areas (15). Similar results were found in France and in Switzerland (17, 18). Non-O157 STEC may also play a more important role in disease compared to STEC O157:H7 as shown in Argentina, Australia, Chile and South Africa (19–21). In Canada, United States, Japan, England and Scotland, in contrast, prevalence of non-O157 is very low (22). In our study, the highest rate of EHEC (30.77%) isolation was detected in Gilan province, north of Iran, with a higher incidence in summer (61.54%). Some studies have suggested that there is an interesting phenomenon in developing countries in which EHEC is much less frequently isolated than other diarrheagenic E. coli (16, 23).
In the present study, the highest rate of diarrhea causing E. coli belonged to STEC (50%) isolates. The STEC isolates had higher incidence in Gilan province (30.7%) in the winter season. The least frequency (3.8%) belonged to Hamadan, Zanjan (west of Iran), and East Azerbaijan provinces (northwest of Iran). Our finding show that STEC strains were detected significantly more (76.9%) in adult man with diarrhea. Vilchez et al. identified a few EHEC strains from children with diarrhea, therefore, our findings were in concurrence with the low prevalence of EHEC infection in developing countries (24). Some studies have suggested that there is an interesting phenomenon in developing countries in which EHEC is isolated much less frequently than other DEC strains such as ETEC or EPEC (25). In the present study, STEC was found in 23.08% of diarrheic children. Pourakbari et al. and Jafari et al. reported that prevalence of STEC strains in children with diarrhea in Tehran, Iran, was 17% and 18.9%, respectively (13, 26). In another report, STEC strains were isolated in 15.5% of children with diarrhea in Tehran (27). Our findings are approximately similar to reports from Tehran. Also, outbreaks and sporadic cases of EHEC have been reported in developed countries such as North America, Japan, Europe and even Australia (28).
Our results showed that the prevalence of STEC strains was higher than EPEC strains, like another report in Iran (29, 30). EPEC strains still remain a major cause of mortality in infants in developing countries (19, 31). In our study, none of the E. coli isolates carried the EAF gene, thus, we did not find any typical EPEC strains. Generally, EPEC divided into two types; typical and atypical. Atypical EPEC contain the LEE but do not contain the EAF plasmid. In industrialized countries, atypical EPEC are more frequently isolated from diarrheal cases than are typical EPEC that contain the EAF plasmid although typical EPEC dominate in developing countries (32). The results of our study revealed that all the EPEC strains isolated in the diarrhea patients were atypical EPEC (i.e. eaeA+ and EAF−), in accordance with recent findings in developing and developed countries which show increased isolation of atypical EPEC (11, 33).
We discovered higher incidence of EPEC in East Azerbaijan province (30.7%), whereas we did not see any EPEC isolate in Kurdistan province, west of Iran (0.0%). In the present study, EPEC were detected in 53.9% of diarrheic children, despite some previous studies showing higher prevalence of STEC in Iran (34). Similar to this study, Alikhani et al. reported high prevalence of EPEC compared with other pathogenic E. coli strains in children with diarrhea in Iran (15). In Brazil, EPEC was more frequent than STEC (35). The results of the present study and most previous research suggest that geographical area and time of sampling are the most important criteria in epidemiology of diarrhea in children in developing countries. We demonstrated high incidence of EPEC isolates in autumn despite findings of Momtaz et al. which showed that the higher incidence of EPEC strains is in the summer (36).
The antimicrobial resistance results for the DEC strains are shown in Table 2. The high incidence of antibiotic-resistant isolates of DEC may be due to the widespread use of antibiotics. Transfer of resistance genes that may occur between species could lead to construction of diverse resistance to usual antibiotics. These transfers have effectively changed the ecological and pathogenic character of bacterial species (37). In our study, the high incidence of antibiotic-resistant isolates of EHEC was seen to cephalothin (92.30%). Some results showed high resistance rates against the commonly used antimicrobial agents; ampicillin, amoxicillin, chloramphenicol, tetracycline, cotrimoxazole and nalidixic acid (38, 39). Further search into the drug sensitivity pattern of our isolates demonstrated a good response to imipenem (100%), gentamicin (76.9%), cefixime (73.1%) and ceftriaxone (71.2%) but resistance to ampicillin, and amoxicillin (76.9%), cephalothin (69.2), and tetracycline (65.4%) was noticeable. Our findings are in agreement with reports in Iran indicating DEC and Shigella isolates are resistant to trimethoprim-sulfamethoxazole, and tetracycline (13, 40). In addition, a report from Iran cited by the World Health Organization indicates that sulfamethoxazole-trimethoprim, tetracycline and chloramphenicol were the least effective antibiotics for treatment of DEC isolates (41). We also found that 80.8% of diarrheic E. coli isolates were multidrug resistant (MDR), which was considerably high. The incidence of diarrhea due to MDR E. coli has increased in developing countries in the last decade (42, 43). At present, because of the increased frequency of MDR DEC, fluoroquinolones are considered as first-line drugs for treatment of diarrhea. Indeed, several studies have documented the emergence and spread of fluoroquinolone resistant enteric pathogens (44) and thus, monitoring of drug susceptibility of DEC seems to be a critical issue in Iran.
In conclusion, this study reveals that DEC strains contribute to the burden of infant to adult diarrheal diseases, and STEC is the most commonly identified DEC strain in our study. To stop the increasing prevalence rate of MDR DEC, the indiscriminate use of antibiotics needs to be avoided and the guidelines for proper use of antibiotics for treatment of diarrhea in this region needs to be established.
ACKNOWLEDGEMENTS
We would like to thank the deputy of research and technology of Hamadan University of Medical Sciences, Hamadan, Iran, for financial support.
REFERENCES
- 1.Badouei MA, Lotfollahzadeh S, Arman M, Haddadi M. Prevalence and resistance profiles of Enteropathogenic and Shiga toxin-producing Escherichia coli in diarrheic calves in Mashhad and Garmsar districts, Iran. Avicenna J Clin Microb Infect 2014;1(3):e22802. [Google Scholar]
- 2.Haghi F, Zeighami H, Hajiahmadi F, Khoshvaght H, Bayat M. Frequency and antimicrobial resistance of diarrhoeagenic Escherichia coli from young children in Iran. J Med Microbiol 2014;63:427–432. [DOI] [PubMed] [Google Scholar]
- 3.Velayati AA, Ghazi Saidi K, Taravati M. A study of Salmonella, Shigella and enteropathogenic Escherichia coli serotypes in acute gastroenteritis children under the age of five. Med J Islam Repub Iran 1987;1:22–31. [Google Scholar]
- 4.Abbasi P, Kargar M, Doosti A, Mardaneh J, Ghorbani-Dalini S, Dehyadegari MA. Characterization of Shiga-toxin producing E. coli (STEC) and enteropathogenic E. coli (EPEC) using multiplex Real-Time PCR assays for stx1, stx2, eaeA. Iran J Microbiol 2014;6:169–174. [PMC free article] [PubMed] [Google Scholar]
- 5.Osawa K, Raharjo D, Wasito EB, Harijono S, Shigemura K, Osawa R, et al. Frequency of diarrheagenic Escherichia coli among children in Surabaya, Indonesia. Jpn J Infect Dis 2013;66:446–448. [DOI] [PubMed] [Google Scholar]
- 6.Nweze E. Virulence properties of diarrheagenic E. coli and etiology of diarrhea in infants, young children and other age groups in southeast, Nigeria. Am-Euras J Sci Res 2009;4:173–179. [Google Scholar]
- 7.Aly ME, Hanora A, Essam TM, Amin MA. Genotypic detection of Enterohaemoragic E. coli (EHEC) among diarrheagenic patients in Egypt. Int J Microbiol Res 2014;5:61–64. [Google Scholar]
- 8.Jerse AE, Yu J, Tall BD, Kaper JB. A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells. Proc Natl Acad Sci U S A 1990;87:7839–7843. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Bakhshi B, Fallahzad S, Pourshafie MR. The occurrence of atypical enteropathogenic Escherichia coli strains among children with diarrhea in Iran. J Infect Chemother 2013;19:615–620. [DOI] [PubMed] [Google Scholar]
- 10.Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev 1998;11:142–201. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol 2004;2:123–140. [DOI] [PubMed] [Google Scholar]
- 12.Aslani MM, Alikhani MY, Zavari A, Yousefi R, Zamani AR. Characterization of enteroaggregative Escherichia coli (EAEC) clinical isolates and their antibiotic resistance pattern. Int J Infect Dis 2011;15(2):e136–139. [DOI] [PubMed] [Google Scholar]
- 13.Jafari F, Hamidian M, Rezadehbashi M, Doyle M, Salmanzadeh-ahrabi S, Derakhshan F, et al. Prevalence and antimicrobial resistance of diarrheagenic Escherichia coli and Shigella species associated with acute diarrhea in Tehran, Iran. Can J Infect Dis Med Microbiol 2009;20(3):e56–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Bardbari AM, Arabestani MR, Karami M, Keramat F, Aghazadeh H, Alikhani MY, Bagheri KP. Highly synergistic activity of melittin with imipenem and colistin in biofilm inhibition against multidrug-resistant strong biofilm producer strains of Acinetobacter baumannii. Eur J Clin Microbiol Infect Dis 2018;37:443–454. [DOI] [PubMed] [Google Scholar]
- 15.Alikhani MY, Mirsalehian A, Fatollahzadeh B, Pourshafie MR, Aslani MM. Prevalence of enteropathogenic and Shiga toxin-producing Escherichia coli among children with and without diarrhoea in Iran. J Health Popul Nutr 2007:25;88–93. [PMC free article] [PubMed] [Google Scholar]
- 16.Alikhani MY, Mirsalehian A, Aslani MM. Detection of typical and atypical enteropathogenic Escherichia coli (EPEC) in Iranian children with and without diarrhoea. J Med Microbiol 2006;55:1159–1163. [DOI] [PubMed] [Google Scholar]
- 17.Burnens A, Boss P, Ørskov F, Ørskov I, Schaad U, Müller F, et al. Occurrence and phenotypic properties of verotoxin producing Escherichia coli in sporadic cases of gastroenteritis. Eur J Clin Microbiol Infect Dis 1992;11:631–634. [DOI] [PubMed] [Google Scholar]
- 18.Desmarchelier PM. Enterohemor rhagic Escherichia coli—the Australian perspective. J Food Prot 1997;60:1447–1450. [DOI] [PubMed] [Google Scholar]
- 19.Blanco J, Blanco M, Alonso M, Mora A, Dahbi G, Coira M, et al. Serotypes, virulence genes, and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from human patients: prevalence in Lugo, Spain, from 1992 through 1999. J Clin Microbiol 2004;42:311–319. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Kehl SC. Role of the laboratory in the diagnosis of enterohemorrhagic Escherichia coli infections. J Clin Microbiol 2002;40:2711–2715. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Mathusa EC, Chen Y, Enache E, Hontz L. Non-O157 Shiga toxin–producing Escherichia coli in foods. J Food Prot 2010;73:1721–1736. [DOI] [PubMed] [Google Scholar]
- 22.Bokete T, OCallahan C, Clausen C, Tang N, Tran N, Moseley S. Shiga-like toxin-producing Escherichia coli in Seattle children: A prospective study. Gastroenterology 1993;105:1724–1731. [DOI] [PubMed] [Google Scholar]
- 23.Güney C, Aydogan H, Saracli MA, Basustaoglu A, Doganci L. No isolation of Escherichia coli O157: H7 strains from faecal specimens of Turkish children with acute gastroenteritis. J Health Popul Nutr 2001;19:336–337. [PubMed] [Google Scholar]
- 24.Vilchez S, Reyes D, Paniagua M, Bucardo F, Möllby R, Weintraub A. Prevalence of diarrhoeagenic Escherichia coli in children from Leon, Nicaragua. J Med Microbiol 2009;58:630–637. [DOI] [PubMed] [Google Scholar]
- 25.Nguyen TV, Le Van P, Le Huy C, Gia KN, Weintraub A. Etiology and epidemiology of diarrhea in children in Hanoi, Vietnam. Int J Infect Dis 2006;10:298–308. [DOI] [PubMed] [Google Scholar]
- 26.Pourakbari B, Heydari H, Mahmoudi S, Sabouni F, Teymuri M, Ferdosian F, et al. Diarrhoeagenic E. coli pathotypes in children with and without diarrhoea in an Iranian referral paediatrics centre. East Mediterr Health J 2013;19:617–621. [PubMed] [Google Scholar]
- 27.Salmanzadeh-Ahrabi S, Habibi E, Jaafari F, Zali M-R. Molecular epidemiology of Escherichia coli diarrhoea in children in Tehran. Ann Trop Paediatr 2005;25:35–39. [DOI] [PubMed] [Google Scholar]
- 28.Nweze E. Aetiology of diarrhoea and virulence properties of diarrhoeagenic Escherichia coli among patients and healthy subjects in southeast Nigeria. J Health Popul Nutr 2010;28:245–252. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Dormanesh B, Siroosbakhat S, Goudarzi PK, Afsharkhas L. Shiga toxigenic Escherichia coli in Iranian pediatric patients with and without diarrhea: O-serogroups, vir ulence factors and antimicrobial resistance properties. Iran Red Crescent Med J 2015;17(10):e29706. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 30.Jafari A, Aslani M, Bouzari S. Escherichia coli: a brief review of diarrheagenic pathotypes and their role in diarrheal diseases in Iran. Iran J Microbiol 2012;4:102–117. [PMC free article] [PubMed] [Google Scholar]
- 31.Ishii S, Meyer KP, Sadowsky MJ. Relationship between phylogenetic groups, genotypic clusters, and virulence gene profiles of Escherichia coli strains from diverse human and animal sources. Appl Environ Microbiol 2007;73:5703–5710. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Trabulsi LR, Keller R, Gomes TAT. Typical and atypical enteropathogenic Escherichia coli. Emerg Infect Dis 2002;8:508–513. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Strockbine NA, Faruque SM, Kay BA, Haider K, Alam K, Alam A, et al. DNA probe analysis of diarrhoeagenic Escherichia coli: detection of EAF-positive isolates of traditional enteropathogenic E. coli serotypes among Bangladeshi paediatric diarrhoea patients. Mol Cell Probes 1992;6:93–99. [DOI] [PubMed] [Google Scholar]
- 34.Badouei MA, Jajarmi M, Mirsalehian A. Virulence profiling and genetic relatedness of Shiga toxin-producing Escherichia coli isolated from humans and ruminants. Comp Immunol Microbiol Infect Dis 2015;38:15–20. [DOI] [PubMed] [Google Scholar]
- 35.Franzolin MR, Alves RCB, Keller R, Gomes TAT, Beutin L, Barreto ML. Prevalence of diarrheagenic Escherichia coli in children with diarrhea in Salvador, Bahia, Brazil. Mem Inst Oswaldo Cruz 2005;100:359–363. [DOI] [PubMed] [Google Scholar]
- 36.Momtaz H, Dehkordi FS, Hosseini MJ, Sarshar M, Heidari M. Serogroups, virulence genes and antibiotic resistance in Shiga toxin-producing Escherichia coli isolated from diarrheic and non-diarrheic pediatric patients in Iran. Gut Pathog 2013;5:39. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Ochman H, Lawrence JG, Groisman EA. Lateral gene transfer and the nature of bacterial innovation. Nature 2000;405:299–304. [DOI] [PubMed] [Google Scholar]
- 38.Ahmed AA, Osman H, Mansour AM, Musa HA, Ahmed AB, Karrar Z, et al. Antimicrobial agent resistance in bacterial isolates from patients with diarrhea and urinary tract infection in the Sudan. Am J Trop Med Hyg 2000;63:259–263. [PubMed] [Google Scholar]
- 39.Al-Hussaini M, Saadabi A, Abdallah RM. Occurrence of multiple antibiotic resistances in Escherichia coli isolated from children of diarrheal symptoms. Int J Sci Res 2014;3:12–17. [Google Scholar]
- 40.Fazeli H, Salehi R. Antibiotic resistance pattern in Shiga toxin-producing Escherichia coli isolated from diarrheal patients in Al-zahra Hospital, Isfahan, Iran. Res Pharm Sci 2008;2:29–33. [Google Scholar]
- 41.Bouzari S, Jafari A, Zarepoor M. Distribution of genes encoding toxins and antibiotic resistance patterns in diarrhoeagenic Escherichia coli isolates in Tehran. East Mediterr Health J 2007;13:287–293. [PubMed] [Google Scholar]
- 42.Alikhani MY, Hashemi SH, Aslani MM, Farajnia S. Prevalence and antibiotic resistance patterns of diarrheagenic Escherichia coli isolated from adolescents and adults in Hamedan, Western Iran. Iran J Microbiol 2013;5:42–47. [PMC free article] [PubMed] [Google Scholar]
- 43.Oberhelman RA, Laborde D, Mera R, Starszak E, Saunders P, Mirza A. Colonization with enteroadherent, enterotoxigenic and enterohemorrhagic Escherichia coli among day-care center attendees in New Orleans, Louisiana. Pediatr Infect Dis J 1998;17:1159–1162. [DOI] [PubMed] [Google Scholar]
- 44.Samal SK, Khuntia HK, Nanda PK, Satapathy CS, Nayak SR, Sarangi AK. Incidence of bacterial enteropathogens among hospitalized diarrhea patients from Orissa, India. Jpn J Infect Dis 2008;61:350–355. [PubMed] [Google Scholar]