Skip to main content
NCBI home page
Cancer Medicine logoLink to Cancer Medicine
. 2018 Jul 18;7(8):3763–3772. doi: 10.1002/cam4.1607

CD164 promotes tumor progression and predicts the poor prognosis of bladder cancer

Xiao‐Guang Zhang 1,✉, Tong Zhang 2, Chang‐Ying Li 3, Ming‐Hao Zhang 1, Fang‐Min Chen 1,✉
PMCID: PMC6089154  PMID: 30022623

Abstract

CD164 was found to play a role in many malignant diseases. But the roles of CD164 in human bladder cancer have not yet been studied. The object of our study was to investigate the functions of CD164 in urothelial bladder carcinoma. The immunohistochemistry (IHC) was performed to evaluate the associations between the expression level of CD164 and clinical‐pathological features of patients, and IHC was used to analyze the relationship between CD164 and CXCR4 in tumor tissues. Real‐time qPCR and Western blot were used to measure the expression of relevant genes. The roles of CD164 in tumor cells and tissues were investigated by in vitro and in vivo experiments. The results of immunohistochemistry found that CD164 was associated with clinical and pathological features of patients. High level of CD164 was related to the distant metastasis and vascular invasion of bladder cancer patients. In vitro, by silencing of CD164, the proliferation, migration, and invasion of tumor cells were inhibited significantly by regulating related proteins such as Ki67, proliferating cell nuclear antigen, matrix metalloproteinases‐2, and matrix metalloproteinases‐9. In vivo, knocking‐down of CD164 could reduce the growth and metastasis of tumors in mice. In addition, a co‐expression was found between CD164 and CXCR4 in tumor tissues. In conclusion, our study demonstrated that CD164 was associated with the poor clinical outcomes of BC patients. Silencing of CD164 could inhibit the progression of tumors in vivo and in vitro, which may become an effective target in the treatment of bladder cancer.

Keywords: bladder cancer, CD164, CXCR4, prognosis, progression

1. INTRODUCTION

Bladder cancer (BC) is the ninth most common cancer and the thirteenth deadliest worldwide with 81190 newly diagnosed cases and 17240 deaths estimated in USA, 2018.1 Most of bladder cancers are derived from urothelial cells, and roughly 75% of patients are nonmuscle invasive bladder cancer (NMIBC) and 25% have muscle invasive (MIBC) or metastatic disease.2 Despite the continuous development of medical techniques, the diagnostics, treatments, and survivals for bladder cancer have been largely unchanged since the 1990s.3 Although NMIBC patients with a better prognosis than MIBC, and even through tumors can be successfully identified and removed before they become invasive, BC has a high rate of recurrence and progression.4 Cystoscopies are the gold standard for diagnosis of BC, but they are expensive and uncomfortable.5 And they sometimes fail to find types of tumor that have not yet become invasive but are aggressive, such as carcinoma in situ.6 With the limitations of present diagnosis and treatment, researching into cancer genomics, risk markers, and targeted therapies could hold the key to progress against this malignant disease.

CD164, also known as endolyn or MGC‐24v, is a member of sialomucin family, which is conversed and encoded by CD164 gene located on human chromosome 6q21.7, 8 CD164 was first identified in primitive CD34+ hemopoietic progenitor cells and bone marrow stromal cells and has been found to be involved in proliferation, migration, and adhesion of these cells.9, 10, 11 By facilitating the adhesion and migration of human CD34+ cells to bone marrow stroma, CD164 was proposed to regulate hematopoiesis.12 In human cancers, CD164 was reported played roles in many different cancers. For instance, CD164 has been reported for the maintenance and progression of human tumors, such as human glioma,13 lung cancer,14 ovarian cancer,15 and prostate cancer.16 Besides, some microRNAs such as miR‐124 and miR‐219 were found that could suppress the proliferation, migration, and invasion of tumor cells by targeting CD164.17, 18 However, the roles of CD164 in BC have not yet been studied and are still unclear.

In this study, we systematically researched the roles of CD164 in BC. The immunohistochemistry was used to investigate the associations between CD164 and clinical outcomes of BC patients. Then, the functions of CD164 in tumor proliferation, migration, and invasion were studied in vivo and in vitro. According to these, we hoped to find an effective marker which may become the potential therapeutic target of BC.

2. MATERIALS AND METHODS

2.1. Patients and samples

One hundred and fifteen patients clinically and pathologically diagnosed with urothelial carcinoma of bladder in third central hospital of Tianjin and provincial hospital affiliated to Shandong university were included in our study. Tumor tissues were obtained after the first surgical treatment (TURBt or Cystectomy). The clinical and pathological characters such as ages, genders, pTMN stage, tumor grade, tumor sizes, lymph metastasis, and vascular invasion were record. The tumor stage was classified by 2009 UICC TMN staging and tumor grade was determined according to the 2004 WHO/ISUP classification.19, 20 Written informed consents and approval from the institution ethics commission of third central hospital of Tianjin and provincial hospital affiliated to Shandong university were obtained.

2.2. Immunohistochemistry and scoring

Bladder tumor specimens were fixed by 10% v/v formalin solution, and embedded in paraffin. One hundred and fifteen paraffin‐embedded tissues collected from the third central hospital of Tianjin were sliced into 4‐μm sections and baked at 65°C for 30 minutes. Then, the sections were performed with EDTA (pH = 8.0) and 3% H2O2 in methanol. The tissues sections were cultured with: anti‐CD164 antibodies (rabbit; 1:200; sigma), anti‐CXCR4 antibodies (rabbit; 1:200; sigma) overnight at 4°C in a moist chamber. Then, the second antibody was added and incubated at room temperature for 1 hour. The sections were counterstained using hematoxylin and incubated with streptavidin‐horseradish peroxidase complex. For the results, CD164 cytoplasmic staining was scored by using 4‐point scales (0, no staining; 1+, light staining at high magnification; 2+, intermediate staining; 3+, dark staining of linear membrane at low magnification). Besides, an immunostaining score (H‐score) was measured by the multiplication of CD164 and CXCR4 stained cells and the corresponding intensity score.21 According to the distribution of H‐scores, the CD164 and CXCR4 were divided into high and low expression groups, respectively.

2.3. Cell culture

Human urothelial bladder cancer T24 and 5637 cell lines were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). According to the instructions, both of T24 and 5637 cells were cultured in RPMI‐1640 medium containing 1% penicillin streptomycin and 10% fetal bovine serum with 5% CO2 at 37°C.

2.4. Plasmid construction and Lentiviral transfection

CD164 short hairpin RNA oligonucleotide sequence (shRNA) was used to knock down the expression of CD164 gene. The sequence of CD164 shRNA was as follows: 5′‐TGAGAAAGC TCTCCACTCTGTTCAAGAGACAGAGTGGAGAGCTTTCTCTTTTTTC‐3′. And a scramble shRNA was performed as the negative control. The efficacy of knocking‐down was verified by RT‐qPCR and Western blot. Then, qualified cells were selected for using in later experiments.

2.5. RT‐PCR

Total RNA was extracted from tumor tissues and cells using TRIzol reagent (Thermo, American) according to the instructions. RNA was reversely transcripted to cDNA by the cDNA Reverse Transcription Kit (Sangon Biotech, China). Quantitative PCR was performed on a Smart Cycler using SGExcel FastSYBR Mixture (With Low ROX) Plus (Sangon biotech). A comparative threshold cycle (Ct) method, which compares differences in CT values between common control and target RNA, was used to process the real‐time PCR data.22 The primer sequences of CD164 were as follows: (Forward) 5′‐TGAGCCCTGAACACCAGAGAG‐3′, and (Reverse) 5′‐AAAGCCAGATGAGCGCTTCTA‐3′.

2.6. Western blot

Cells and tissues were lysed in RIPA lysis buffer, and proteins concentrations were measured by using the bicinchoninic acid (BCA) method. Cell/tissue lysates were separated by SDS‐PAGE gels and transferred to PVDF membranes (Thermo, American). Then, the blots were blocked by 5% dry milk and incubated with the primary antibodies: anti‐CD164 (rabbit; 1: 1000 dilution; Cambridge, UK), anti‐β‐actin (mouse; 1:1000 dilution; Cambridge, UK), anti‐Ki67 (rabbit; 1:1000; Cambridge, UK), anti‐PCNA (mouse; 1:500 dilution; Cambridge, UK), anti‐MMP2 (mouse; 1:1000 dilution; Cambridge, UK), and anti‐MMP9 (mouse; 1:1000 dilution; Cambridge, UK) monoclonal antibodies overnight at 4°C. Then, the samples were incubated with the secondary antibody (polyclonal goat anti‐rabbit/mouse, 1:10 000 dilutions, Rockland Immunochemicals Inc, PA) for 1 hour at room temperature and detected by chemiluminescence.

2.7. Colony formation array

Four hundred cells per well of T24 and 5637 cells were seeded into 60 mm dishes and cultured at 37°C in 5% CO2. After 10 days, cells were fixated with 10% formaldehyde for 5 minutes and stained 10‐30 minutes with Giemsa. Finally, the colonies were counted using an optional microscope and the colonies with diameters >2 mm were counted. The arrays were performed in triplicate.

2.8. MTT array

T24 and 5637 cells were seeded into 24‐well plates with a density of 2 × 103 cells/well and 10 μL of 5 mg/mL MTT reagent was added into each well for 4 hours at 37°C. Then, the media were removed, and dimethyl sulfoxide (DMSO, Sigma) was added. The absorbance was measured at 570 nm. The arrays were repeated in triplicate.

2.9. Wound and healing assay

2 ×  104/well of T24 and 5637 cells were seeded in 12‐well plates and grown to a confluence. Then a scratch was created using a sterile 200 μL pipette tip and cells were calculated at 37°C in 5% CO2. The distance between the edges of both sides was measured, which represented the ability of cell migration. Three repeated arrays were carried out.

2.10. Transwell array

The transwell membrane with Matrigel Substrate (BD, USA) was used to investigate the invasion of tumor cells. 2 × 105 cells were added into the upper chambers, and the low chambers were filled with the RPMI‐1640 supplemented with 10% FBS. The cells were calculated for 24 hours at 37°C in 5% CO2. The cells under the surface of the lower chamber were fixed and stained with 0.1% crystal violet. The number of cells was observed from 5 randomly selected photographs under a microscope (magnification, ×200). The arrays were performed in triplicate.

2.11. Animal study

All animal experiments in our study were approved by the Animal Care and Use Committee of the third central hospital of Tianjin. BALB/c nude mice (5‐weeks old) were purchased from Slac Laboratory Animal Co. Ltd. (Shanghai, China). 1 × 107 T24 cells transfected with CD164 shRNA and controls were subcutaneously injected into the right armpits of mice. The growth of tumors was monitored over a 7‐week period, and the tumor volumes were measured. After 49 days, tumors were harvested and mice were euthanized. Besides, to investigated the association between CD164 and metastasis of bladder tumor cells. T24 cells transfected with CD164 shRNA and controls were injected into mice tail vein. The metastatic tumors of lung were detected, after 4 weeks, the mice were euthanized, and tumors were harvested.

2.12. Statistic analysis

The data in this study were analyzed by SPSS.22.0. Quantitative dates were assessed by mean ± SD. According to the variance homogeneity or not, parametric test and nonparametric test were used respectively. Chi‐square tests were used to analyze the associations between the expression of CD164 and the clinicopathological features. Chi‐square tests and correlation analysis (Pearson and Spearman) were performed to analyze the associations between CD164 and CXCR4. Kaplan‐Meier method was performed to estimate the prognosis of patients. For the results, P < .05 for the difference was considered to be significant.

3. RESULTS

3.1. Association between CD164 and clinical‐pathological features of patients with BC

Immunohistochemistry of tumor tissues from 115 patients diagnosed with BC in third central hospital of Tianjin and provincial hospital affiliated to Shandong university was performed to investigated the association between the expression of CD164 and clinical‐pathological characters of patients. Both of the nucleuses and cytoplasm (mainly) of tumor cells were dyed and the typical strong and weak staining of CD164 was shown, while CD164 was negative in the normal bladder tissues (Figure 1A,B). The results showed that CD164 was significantly associated with distant metastasis and vascular invasion (P < .05). A high level of CD164 was related to the distant metastasis and vascular invasion of BC. However, no associations were found between CD164 and ages, genders, tumor grade, pTMN stage, and lymph node metastasis (Table 1).

Figure 1.

Figure 1

Open in a new tab

Immunohistochemistry of the expression level of CD164 in bladder tumor tissues and association between CD164 and survivals of patients. A, The typical strong and weak staining of CD164 in tumor tissues by immunohistochemistry. B and C, The associations between CD164 and prognosis of patients were performed by Kaplan‐Meier method, high level of CD164 was associated with short OS and RFS (P < .05)

Table 1.

Relationships of CD164 and clinicopathological characteristics in 115 patients with BC

Feature All n = 115 CD164 expression χ2 P
Low n = 36 High n = 79
Age (year) 2.184 .139
<65 46 18 28
≥65 69 18 51
Gender 0.332 .565
Male 99 30 69
Female 16 6 10
Tumor stage 0.208 .648
T2 35 12 23
T3/T4 80 24 56
Tumor grade 1.408 .235
Low 33 13 20
High 82 23 59
Lymph node metastasis 1.669 .196
Yes 35 8 27
No 80 28 52
Recurrence 1.948 .163
Yes 59 15 44
No 56 21 35
Distant metastasis 5.830 .016
Yes 51 10 41
No 64 26 38
Vascular invasion 5.967 .015
Yes 64 14 50
No 51 22 29
Open in a new tab

3.2. Association between CD164 and prognosis of BC patients

Kaplan‐Meier method was performed to estimate the association between CD164 and the prognosis of patients. Overall survival (OS) and relapse‐free survivals (RFS) were followed up by cystoscopy in our center with every 3 months during the first year, then every 6 months during the following years. The results found that CD164 was significantly associated with the survivals of patients (Figure 1C). As was shown, high level of CD164 was suggested to be related to the short PFS and OS (P < .05).

3.3. Stably knocking down CD164 in both T24 and 5637 cell lines

CD164 shRNA was used to knock down the expression of CD164 gene in both T24 and 5637 cell lines. The expression of CD164 in shRNA and control groups was detected in RT‐qPCR and Western blot. The results found that the expression of CD164 was dramatically decreased in shRNA group compared to controls (P < .05), which indicated that we have effectively knocked down the expression of CD164 in both cell lines (Figure 2).

Figure 2.

Figure 2

Open in a new tab

Stably knocking down CD164 by shRNA in both cell lines. The expression of CD164 in T24 and 5637 cell lines transfected by shRNA lentivirus was detected (A) in RT‐qPCR and (B) in Western blot. The expression of CD164 in shRNA group was significantly decreased compared to controls (P < .05)

3.4. Silencing of CD164 inhibited the proliferation of tumor cells by regulating Ki67 and PCNA

Colony formation and MTT arrays were performed to investigate the impact of CD164 on the proliferation of tumor cells. The results exhibited that comparing to controls, silencing of CD164 could inhibit the proliferation of both T24 and 5637 cells (P < .05; Figure 3A,B). Then, to further explore the mechanism of CD164 in tumor proliferation, some proliferation‐related proteins were identified and detected. The result found that the expressions of Ki67 and proliferating cell nuclear antigen (PCNA) were decreased when we silenced the expression of CD164 (P < .05; Figure 3C,D). In conclusion, the results revealed that silencing of CD164 could inhibit the proliferation of tumor cells by regulating the expression of proliferation‐related proteins such as Ki67 and PCNA.

Figure 3.

Figure 3

Open in a new tab

Silencing of CD164 inhibited the proliferation of tumor cells by regulating Ki67 and PCNA. A, The results of colony formation array found that colonies in shRNA group were less than controls (P < .05). B, MTT array showed that OD values in shRNA group were decreased (P < .05). C and D, The expression of proliferation related proteins Ki167 and PCNA was down‐regulated by silencing of CD164 (P < .05)

3.5. Silencing of CD164 inhibited the migration and invasion of tumor cells by regulating MMP2 and MMP9

Wound and healing assay and transwell array were used to investigate the associations of CD164 with migration and invasion of tumor cells. The data showed that by knocking down CD164, the abilities of migration and invasion of tumor cells were decreased (P < .05; Figure 4A,B). Regarding the mechanism, we examined the expression of proteins that reflected the invasion and migration of tumor cells. By silencing of CD164, the expressions of matrix metalloproteinases‐2 (MMP2) and matrix metalloproteinases‐9 (MMP9) protein were inhibited in our study (P < .05; Figure 4C,D). Taken together, we suspected that CD164 could promote the migration and invasion of bladder tumor cells through regulating relevant proteins including MMP2 and MMP9.

Figure 4.

Figure 4

Open in a new tab

Silencing of CD164 inhibited the migration and invasion of tumor cells by regulating MMP2 and MMP9. A, Wound and healing assay was used to investigate the influence of CD164 on tumor migration. The distance between edges in shRNA group were wider than controls (P < .05). B, Transwell array showed that the ability of invasion in shRNA group was decreased significantly (P < .05). C and D, The expression of migration and invasion‐related proteins MMP2 and MMP9 was reduced in shRNA group (P < .05)

3.6. Knocking down CD164 restrict the growth and metastasis of tumors in mice

To further demonstrate the roles of CD164 in tumor progression, we researched the influence of CD164 on tumor growth and metastasis in mice. Transfected T24 cells in CD164 shRNA and control groups were injected subcutaneously into the right armpits of mice separately. After 2 weeks, tumor volumes were measured every 7 days. From the growth curve, tumors in CD164 shRNA group were grow slower than controls. After 49 days, tumors were harvested and measured. The results demonstrated that by knocking down CD164, the growth of tumors were restricted obviously in mice (P < .05; Figure 5A). Besides, T24 cells in 2 groups were injected into mice tail vein to observe the difference of lung metastasis. The results suggested that the metastatic tumors in CD164 shRNA group were obviously smaller than controls (P < .05; Figure 5B). Western blot and immunohistochemistry were preformed to detect the expression of CD164 in mice tumors. We found CD164 was dramatically decreased in CD164 shRNA group (Figure 5C,D), which confirmed that an effective and stable knocking‐down of CD164 was built in mice tumors. In summary, our findings demonstrated that silencing of CD164 could restrict the growth and metastasis of tumors in mice.

Figure 5.

Figure 5

Open in a new tab

The influence of CD164 on tumor growth and lung metastasis of BC in mice. A, From growth curve, tumors in shRNA group grew more slowly than controls and tumor volumes were smaller in shRNA group (P < .05). B, To investigate the influence of CD164 on tumor metastasis of mice, the T24 cells were injected into mice tail vein. The pulmonary metastatic tumors in shRNA group were smaller than controls (P < .05). C and D, The expression of CD164 in mice tumors was dramatically decreased by immunohistochemistry and Western blot (P < .05), which suggested a successful construction of CD164 knocked down model in mice

3.7. Co‐expression existed between CD164 and CXCR4 in bladder cancer tissues

As CD164 acted as a CXCR4‐associated sialomucin, the relationship between CD164 and CXCR4 has been researched in many different cancers.15, 23 In our study, we used the immunohistochemistry to observe the association between the expression of CD164 and CXCR4 in tumor tissues by uninterrupted slicing. The typical staining was shown (Figure 6A). The results found that an obvious positive correlation was existed (Figure 6B). Therefore, we speculated that CD164 possibly played roles in bladder cancer through regulating the expression of CXCR4 and relevant pathways.

Figure 6.

Figure 6

Open in a new tab

Co‐expression between CD164 and CXCR4 in tumor tissues by immunohistochemistry. A, The immunohistochemistry of CD164 and CXCR4 in 115 samples were performed. The typical strong and weak staining was shown. B, Chi‐square tests, and correlation analysis (Pearson and Spearman) were performed to analyze the associations between CD164 and CXCR4. The results found that an obvious positive correlation was existed (P < .001)

4. DISCUSSION

As far as we know, there are no reports mentioned about the roles of CD164 in BC. Our study is the first experiment which systematically researched the associations between CD164 and progression of BC. As we know, BC is a common human carcinoma, although primary tumors can be successfully removed, the tumors recur easily and may progress to muscle‐invasive ones.24 The traditional standard therapies could restrict the growth and development of tumor. However, they could hardly prevent patients from recurrence and drug resistance.25 Therefore, researching on novel potential risk markers may provide new directions and progress for the treatment of BC.

CD164, a member of the sialomucin family, was a mucin that contained sialic acid.26, 27 As a multifunctional protein, CD164 acted as a surface marker of hematopoietic stem cells, a CXCR4 promoter activity‐enhancing transcription factor, and a stem cell‐specific marker inducer.9, 10, 11 High expression of CD164 was found in several malignant diseases and was associated with clinical outcomes of patients.13, 23, 28, 29, 30, 31 In lung cancer, the positive associations were significantly existed between CD164 expression and tumor size, tumor cell grading, and lymph node involvement.14 Besides, a high abundance of CD164 protein was significantly correlated with high‐grade of ovarian tumors.15 In our study, the results of immunohistochemistry from 115 patients showed that high expression of CD164 was associated with clinical‐pathological characters such as distant metastasis and vascular invasion. And high level of CG164 was related to the short OS and RFS of BC patients. All these results implied that CD164 may be a risk marker, which played a role in tumor progression.

Previous studies have revealed that CD164 was involved in tumor progression via the regulation of cell proliferation and apoptosis in several cancers.13, 14, 15, 23, 32 In addition, CD164 was implicated in regulating the migration and invasion of lung cancer and medulloblastoma cells.17, 18 In vivo, knocking down CD164 could significantly inhibit the tumor growth and metastasis of colon and ovarian cancer in nude mice.23 Similarly, in our study, silencing of CD164 could significantly inhibit the proliferation, migration, and invasion of tumor cells in vitro. By knocking down CD164, the growth of tumors subcutaneously injected into mice was dramatically restricted. Besides, the lung metastasis of mice in CD164 shRNA group was decreased compared to controls. In summary, the results in our study were consisted with most of previous studies, which revealed that CD164 functioned as a tumor promoter and could promote the progression of tumors in vivo and in vitro.

CXCR4, an upstream molecule of the PI3 kinase/Akt pathway, has been shown to play critical roles in several aspects of tumor progression, such as angiogenesis, metastasis, and survival.33, 34, 35, 36, 37 An earlier study suggested that CD164 acted as a component of a CXCR4 complex and regulated the migration of CD133+ cells. 38 In recent years, many studies have indicated that CD164 played a role in tumor progression by interacting with CXCR4 and regulating the downstream of CXCR4 pathway.23 Knocking‐down of CD164 could up‐regulate PTEN and inhibit the activities of PI3K/AKT pathway.13 Besides, CD164 promoted lung tumor‐initiating cells with stem cell activity and determined tumor growth and drug resistance through Akt/mTOR signaling pathway.14 Therefore, we suspected that CD164 may also play roles in tumor progression of BC through CXCR4/AKT signaling pathway. More studies in the future were needed to confirm the mechanism of CD164 in BC.

In conclusion, our study was the precedent experiment which systematically researched the roles of STK32C in tumor progression of BC. From the results, we speculated that CD164 was a tumor promoter which could promote the progression of several carcinomas possibly by regulating CXCR4 relevant proteins and activating CXCR4/AKT signaling pathway. The results were needed to be verified, and exact mechanism of the functions of CD164 in BC should be researched and confirmed in the future.

The results of our study showed that CD164 was associated with the poor clinical outcomes of BC patients. Silencing of CD164 could inhibit the proliferation, migration, and invasion of tumor cells. In vivo, knocking down CD164 hindered the growth and metastasis of tumors in mice. In all, our results revealed that CD164, as a tumor promoter, played an essential role in tumor progression, which may become a potential treatment target of BC patients.

COMPLIANCE WITH ETHICAL STANDARDS

All applicable international, national, and/or institutional guidelines for the care and use of animals were followed.

CONFLICT OF INTEREST

None declared.

Zhang X‐G, Zhang T, Li C‐Y, Zhang M‐H, Chen F‐M. CD164 promotes tumor progression and predicts the poor prognosis of bladder cancer. Cancer Med. 2018;7:3763–3772. 10.1002/cam4.1607

Xiao‐Guang Zhang and Tong Zhang are contributed equally to the article.

Contributor Information

Xiao‐Guang Zhang, Email: xiaoguang_zh@hotmail.com.

Fang‐Min Chen, Email: szxyycfm@sohu.com.

REFERENCES

  • 1. Siegel RL, Miller KD, Jemal A. Cancer Statistics, 2018. CA Cancer J Clin. 2018;68:7‐30. [DOI] [PubMed] [Google Scholar]
  • 2. Kamat AM, Hahn NM, Efstathiou JA, et al. Bladder cancer. Lancet. 2016;388:2796‐2810. [DOI] [PubMed] [Google Scholar]
  • 3. Grayson M. Bladder cancer. Nature. 2017;551:S33. [DOI] [PubMed] [Google Scholar]
  • 4. Babjuk M, Bohle A, Burger M, et al. EAU guidelines on non‐muscle‐invasive urothelial carcinoma of the bladder: update 2016. Eur Urol. 2017;71:447‐461. [DOI] [PubMed] [Google Scholar]
  • 5. Jacobs BL, Lee CT, Montie JE. Bladder cancer in 2010: how far have we come? CA Cancer J Clin. 2010;60:244‐272. [DOI] [PubMed] [Google Scholar]
  • 6. DeGeorge KC, Holt HR, Hodges SC. Bladder cancer: diagnosis and treatment. Am Fam Physician. 2017;96:507‐514. [PubMed] [Google Scholar]
  • 7. Watt SM, Buhring HJ, Rappold I, et al. CD164, a novel sialomucin on CD34(+) and erythroid subsets, is located on human chromosome 6q21. Blood. 1998;92:849‐866. [PubMed] [Google Scholar]
  • 8. Kurosawa N, Kanemitsu Y, Matsui T, Shimada K, Ishihama H, Muramatsu T. Genomic analysis of a murine cell‐surface sialomucin, MGC‐24/CD164. Eur J Biochem. 1999;265:466‐472. [DOI] [PubMed] [Google Scholar]
  • 9. Watt SM, Butler LH, Tavian M, et al. Functionally defined CD164 epitopes are expressed on CD34(+) cells throughout ontogeny but display distinct distribution patterns in adult hematopoietic and nonhematopoietic tissues. Blood. 2000;95:3113‐3124. [PubMed] [Google Scholar]
  • 10. Doyonnas R, Yi‐Hsin Chan J, Butler LH, et al. CD164 monoclonal antibodies that block hemopoietic progenitor cell adhesion and proliferation interact with the first mucin domain of the CD164 receptor. J Immunol. 2000;165:840‐851. [DOI] [PubMed] [Google Scholar]
  • 11. Zannettino AC, Buhring HJ, Niutta S, Watt SM, Benton MA, Simmons PJ. The sialomucin CD164 (MGC‐24v) is an adhesive glycoprotein expressed by human hematopoietic progenitors and bone marrow stromal cells that serves as a potent negative regulator of hematopoiesis. Blood. 1998;92:2613‐2628. [PubMed] [Google Scholar]
  • 12. Ihrke G, Gray SR, Luzio JP. Endolyn is a mucin‐like type I membrane protein targeted to lysosomes by its cytoplasmic tail. Biochem J. 2000;345:287‐296. [PMC free article] [PubMed] [Google Scholar]
  • 13. Tu M, Cai L, Zheng W, Su Z, Chen Y, Qi S. CD164 regulates proliferation and apoptosis by targeting PTEN in human glioma. Mol Med Rep. 2017;15:1713‐1721. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Chen WL, Huang AF, Huang SM, Ho CL, Chang YL, Chan JY. CD164 promotes lung tumor‐initiating cells with stem cell activity and determines tumor growth and drug resistance via Akt/mTOR signaling. Oncotarget. 2017;8:54115‐54135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Huang AF, Chen MW, Huang SM, Kao CL, Lai HC, Chan JY. CD164 regulates the tumorigenesis of ovarian surface epithelial cells through the SDF‐1alpha/CXCR4 axis. Mol Cancer. 2013;12:115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Havens AM, Jung Y, Sun YX, et al. The role of sialomucin CD164 (MGC‐24v or endolyn) in prostate cancer metastasis. BMC Cancer. 2006;6:195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Lin J, Xu K, Wei J, Heimberger AB, Roth JA, Ji L. MicroRNA‐124 suppresses tumor cell proliferation and invasion by targeting CD164 signaling pathway in non‐small cell lung cancer. J Gene Ther. 2016;2:6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Shi JA, Lu DL, Huang X, Tan W. miR‐219 inhibits the proliferation, migration and invasion of medulloblastoma cells by targeting CD164. Int J Mol Med. 2014;34:237‐243. [DOI] [PubMed] [Google Scholar]
  • 19. Webber C, Gospodarowicz M, Sobin LH, et al. Improving the TNM classification: findings from a 10‐year continuous literature review. Int J Cancer. 2014;135:371‐378. [DOI] [PubMed] [Google Scholar]
  • 20. Lokeshwar SD, Ruiz‐Cordero R, Hupe MC, Jorda M, Soloway MS. Impact of 2004 ISUP/WHO classification on bladder cancer grading. World J Urol. 2015;33:1929‐1936. [DOI] [PubMed] [Google Scholar]
  • 21. Lykkegaard Andersen N, Brugmann A, Lelkaitis G, Nielsen S, Friis Lippert M, Vyberg M. Virtual double staining: a digital approach to immunohistochemical quantification of estrogen receptor protein in breast carcinoma specimens. Appl Immunohistochem Mol Morphol 2017. [DOI] [PubMed] [Google Scholar]
  • 22. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real‐time quantitative PCR and the 2(‐Delta Delta C(T)) Method. Methods. 2001;25:402‐408. [DOI] [PubMed] [Google Scholar]
  • 23. Tang J, Zhang L, She X, et al. Inhibiting CD164 expression in colon cancer cell line HCT116 leads to reduced cancer cell proliferation, mobility, and metastasis in vitro and in vivo. Cancer Invest. 2012;30:380‐389. [DOI] [PubMed] [Google Scholar]
  • 24. Bryan RT, Collins SI, Daykin MC, et al. Mechanisms of recurrence of Ta/T1 bladder cancer. Ann R Coll Surg Engl. 2010;92:519‐524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Tada Y, Wada M, Migita T, et al. Increased expression of multidrug resistance‐associated proteins in bladder cancer during clinical course and drug resistance to doxorubicin. Int J Cancer. 2002;98:630‐635. [DOI] [PubMed] [Google Scholar]
  • 26. Zannettino AC. Cd164. J Biol Regul Homeost Agents. 2001;15:394‐396. [PubMed] [Google Scholar]
  • 27. Bae GU, Gaio U, Yang YJ, Lee HJ, Kang JS, Krauss RS. Regulation of myoblast motility and fusion by the CXCR4‐associated sialomucin, CD164. J Biol Chem. 2008;283:8301‐8309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Benoit BM, Jariwala N, O'Connor G, et al. CD164 identifies CD4(+) T cells highly expressing genes associated with malignancy in Sezary syndrome: the Sezary signature genes, FCRL3, Tox, and miR‐214. Arch Dermatol Res. 2017;309:11‐19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Guenova E, Ignatova D, Chang YT, et al. Expression of CD164 on malignant T cells in sezary syndrome. Acta Derm Venereol. 2016;96:464‐467. [DOI] [PubMed] [Google Scholar]
  • 30. Chen JH, Chen WL, Chan JY, et al. Overexpression of CD164 in oral cavity squamous cell carcinoma predicts a favourable prognosis. Oncol Lett. 2017;14:6103‐6108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Wysocka M, Kossenkov AV, Benoit BM, et al. CD164 and FCRL3 are highly expressed on CD4+CD26‐ T cells in Sezary syndrome patients. J Invest Dermatol. 2014;134:229‐236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Chirumbolo S. CD164 and other recently discovered activation markers as promising tools for allergy diagnosis: what's new? Clin Exp Med. 2011;11:255‐257. [DOI] [PubMed] [Google Scholar]
  • 33. Sakai N, Yoshidome H, Shida T, et al. CXCR4/CXCL12 expression profile is associated with tumor microenvironment and clinical outcome of liver metastases of colorectal cancer. Clin Exp Metas. 2012;29:101‐110. [DOI] [PubMed] [Google Scholar]
  • 34. Uchida D, Onoue T, Kuribayashi N, et al. Blockade of CXCR4 in oral squamous cell carcinoma inhibits lymph node metastases. Eur J Cancer. 2011;47:452‐459. [DOI] [PubMed] [Google Scholar]
  • 35. Righi E, Kashiwagi S, Yuan J, et al. CXCL12/CXCR4 blockade induces multimodal antitumor effects that prolong survival in an immunocompetent mouse model of ovarian cancer. Can Res. 2011;71:5522‐5534. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Ping YF, Yao XH, Jiang JY, et al. The chemokine CXCL12 and its receptor CXCR4 promote glioma stem cell‐mediated VEGF production and tumour angiogenesis via PI3K/AKT signalling. J Pathol. 2011;224:344‐354. [DOI] [PubMed] [Google Scholar]
  • 37. Yu X, Chen D, Zhang Y, et al. Overexpression of CXCR4 in mesenchymal stem cells promotes migration, neuroprotection and angiogenesis in a rat model of stroke. J Neurol Sci. 2012;316:141‐149. [DOI] [PubMed] [Google Scholar]
  • 38. Forde S, Tye BJ, Newey SE, et al. Endolyn (CD164) modulates the CXCL12‐mediated migration of umbilical cord blood CD133+ cells. Blood. 2007;109:1825‐1833. [DOI] [PubMed] [Google Scholar]

Articles from Cancer Medicine are provided here courtesy of Wiley

RESOURCES