SREBP1 is required for the induction by glucose of pancreatic β-cell genes involved in glucose sensing

Abstract

Previous studies have reported both positive and negative effects of culture of islets at high glucose concentrations on regulated insulin secretion. Here, we have reexamined this question in mouse islets and determined the role of changes in lipid synthesis in the effects of glucose. Glucose-stimulated insulin secretion (GSIS) and gene expression were examined in islets from C57BL/6 mice or littermates deleted for sterol regulatory element binding protein-1 (SREBP1) following four days culture at elevated glucose concentrations. Culture of control islets at 30 vs. 8 mmol/l glucose led to enhanced secretion at both basal (3 mmol/l) and stimulatory (17 mmol/l) glucose concentrations, and to enhanced triacylglycerol (TG) accumulation. These changes were associated with increases in the expression of genes involved in glucose sensing (Slc2a2, Gck, Abcc8, Kcnj11), differentiation (Pdx1), and lipogenesis (Srebp1, Fas, Acc1, Scd1). When cultured at either 8 or 30 mmol/l glucose, SREBP1^-/- islets displayed reduced GSIS and TG content compared to normal islets. Correspondingly, glucose induction of the above genes in control islets was no longer observed in SREBP1^-/- mouse islets. We conclude that enhanced lipid synthesis mediated by SREBP1c-dependent genes is required for the adaptive changes in islet gene expression and insulin secretion at elevated glucose concentrations.

Introduction

The effects of chronic hyperglycemia on the function of wild type β-cells have been investigated in several earlier studies (1; 2). Chronically-elevated glucose concentrations have been proposed to cause a progressive inhibition of GSIS in vivo, and in in vitro studies on islets from human (3; 4) and rat (5), as well as in insulinoma cells (6). By contrast, other studies have reported that chronic culture at high glucose concentrations can lead to a left shift in the response to glucose of mouse islets (7–9).

Elevated glucose concentrations stimulate the expression of several genes likely to impact on the differentiated function of β-cells. These include genes involved in regulating glycolytic flux (Slc2a2 coding for glucose transporter 2, (10); glucokinase, Gck (11)), lipogenesis (fatty acid synthase, Fas (12); acetyl-CoA carboxylase 1, Acc1 (13); stearoyl-CoA desaturase, Scd1 (14); carbohydrate-responsive element-binding protein, Chrebp (15; 16)) and electrical activity (Abcc8 and Kcnj11 coding for the ATP-sensitive potassium channel subunits and the sulfonylurea receptor1, (14)). Underlying these changes, high glucose concentrations increase the levels (17) and nuclear accumulation (18) of pancreatic duodenal homeobox 1 (PDX1). Furthermore, in rat islets (19) and clonal β-cell lines (20; 21) glucose increases the expression of the lipogenic transcription factor sterol regulatory element binding protein 1c (SREBP1c).

SREBP1c belongs to a family of sterol-regulated factors also including SREBP1a and SREBP-2 (22). Whereas SREBP-2 is involved in the regulation of genes implicated in the sterol synthesis (23), SREBP1c controls the expression of genes involved in triglyceride synthesis (24). SREBPs are helix-loop-helix leucine zipper (bHLH-Zip) factors, and are synthesised as a precursor protein bound to the endoplasmic reticulum (ER) and nuclear membranes. When required, a SREBP cleavage-activating protein (25) escorts SREBPs from the ER to the Golgi, where SREBPs are sequentially cleaved by Site-1 and 2 proteases. The processed, mature SREBPs then enter the nucleus to activate the promoters of specific genes.

Several in vitro studies have shown that over-expression of SREBP1c in β-cells induces the lipogenic genes Fas and Acc1, leading to an accumulation of triglycerides and an inhibition of glucose-stimulated insulin secretion (GSIS) (20; 26). Recent studies in a model cellular system implicated SREBP1 in β-cell glucolipotoxicity (21), and microarray gene expression profiles of rat islets over expressing SREBP1 using adenoviruses showed changes in the expression of a number of pro- but also anti-apoptotic genes (27).

The above observations have suggested that up-regulation of SREBP1 in hyperglycaemic states is likely principally to exert a deleterious effect on β-cell function. However, we have recently found that SREBP1c inactivation in Zucker diabetic fatty rat islets failed to normalise GSIS in this model of lipotoxicity β-cell dysfunction (28) implying that small increases in SREBP1 level and triglycerides content are not the principal cause of defective secretion.

Culture of mouse islets at high glucose concentrations has previously been shown to cause hypersecretion of insulin (29; 30), though the mechanisms involved are unclear. Here, we assessed whether SREBP1 induction in response to high glucose concentrations may be important for the enhanced expression of genes which then mediate the adaptive response to hyperglycaemia of mouse islets. We have also explored the impact of SREBP1 deletion on the ability of islets from this species to respond on an extended period at high glucose concentrations with enhanced insulin secretion. Specifically, we have used islets from wild type C57BL/6J mice or littermates deleted for SREBP1 by homologous recombination (31).

We show that culture for 96 h at 8 or 30 mmol/l glucose markedly (>50%) impairs GSIS, and triglyceride content, in islets from SREBP1^-/- versus wild type mice. This difference is associated with the loss, in islets lacking SREBP1, of the induction by high glucose not only of lipogenic genes (Fas, Acc1, Scd1) but, unexpectedly, of genes involved in β-cell differentiation, glucose sensing and electrical activity. Triacsin C, which prevents the synthesis and oxidation of fatty acyl-CoA (32), also blocked the induction of several of the above genes and decreased the triglyceride (TG) content and glucose responsiveness of cultured islets. We propose that adequate lipid synthesis is a requirement for the adaptive changes of mouse islets to high glucose concentrations.

Materials and Methods

Materials

Collagenase was obtained from Serva (Heidelberg, Germany). Culture medium (Dulbecco’s modified Eagles’ medium; DMEM), FCS (foetal calf serum) and glutamine were obtained from Gibco BRL (Paisley, Renfrewshire, Scotland, U.K.). Antibiotics were from Sigma (Poole, Dorset, U.K.).

Animals and genotyping

SREBP1^-/-, SREBP1^+/-, and SREBP1^+/+ mice were generated as described and bred in the animal facility of the University of Bristol. The mice were fed a normal rodent diet and were housed in colony cages, maintained on a 12-h light/12-h dark cycle. Mice were genotyped by PCR on tail genomic DNA with specific primers. For the triacsin C experiments (Figure 3 and 5), islets were isolated from 3-4 month old C57BL/6J mice from a separate colony (Harlan, Bicester, U.K.). All animal procedures were carried out in accordance with U.K. Home Office welfare guidelines and project license restrictions.

Figure 3. Effect of triacsin C on glucose-induced insulin secretion in islets exposed to long-term culture at high [glucose].

After isolation, islets from wild type mice (n=3/genotype) were cultured for 96 h at 8 or 30 mmol/l glucose in the presence or absence of triacsin C (10 μmol/l) before measuring GSIS (5 determinations/experiment). *p<0.05, **p<0.01 for effect of 17 mmol/l glucose effect. ## p<0.01; ### p<0.001 for the chronically elevated glucose effect.

Figure 5. Effect of Triacsin C on TG content in islets exposed to long-term culture at high [glucose].

After isolation, islets from wild type mice (n=3/genotype) were cultured for 96h at 8 or 30 mmol/l glucose in the presence or absence of Triacsin C (10 μmol/l). TG content was measured as described in Material and Methods. p<0.05 for the effect of chronically elevated [glucose]. # p<0.05 for the Triacsin C effect.

Blood glucose and plasma insulin measurements

Tail blood was assayed for glucose concentration using a Glucometer Accu-chek™ (Roche). Plasma insulin was measured using a rat insulin kit (Chrystal Chem Inc., Downers Grove, IL, U.S.A.).

Isolation and culture of pancreatic islets

Mice (3-4 month) were killed by cervical dislocation and islets isolated as previously described (33). Briefly, pancreata were digested with collagenase and hand-picked. The medium used for islet isolation was a bicarbonate-buffered solution (120 mmol/l NaCl, 4.8 mmol/l KCl, 2.5 mmol/l CaCl₂, 1.2 mmol/l MgCl₂, 24 mmol/l NaHCO₃, 10 mmol/l glucose and 1 mg/ml bovine serum albumin). It was gassed with O₂/CO₂ (95/5%) and equilibrated at pH 7.4. For culture in chronically elevated glucose concentrations, islets were incubated for 16 h in DMEM containing 10% (v/v) FCS, 11 mmol/l glucose, 2 mmol/l glutamine, 100 units/ml penicillin and 100 mg/ml streptomycin, incubated at 37°C with 95% air and 5% CO₂. Then islets were cultured for 96 h at 8 or 30 mmol/l glucose in presence or absence of triacsin C (10 μmol/l, Biomol, Exeter, UK) before use. Furthemore, previous studies have shown that such conditions of chronic high glucose culture had no effect on C57BL/6 mouse islets viability (30) or DNA content (34).

Insulin secretion by static incubation

Cultured islets were incubated for 60 min. in a shaking water bath at 37°C in 1 ml of Krebs Ringer bicarbonate buffer (KRBH; 130 mmol/l NaCl, 3.6 mmol/l KCl, 1.5 mmol/l CaCl₂, 0.5 mmol/l MgSO₄, 0.5 mmol/l KH₂PO₄, 2.0 mmol/l NaHCO₃ and 10 mmol/l Hepes) supplemented with 11 mmol/l glucose/ 0.1% (w/v) BSA. KRBH was equilibrated with O₂/CO₂ (95/5%), pH 7.4. Batches of three islets were handpicked and incubated for 30 min. in 0.5 ml of KRBH as above, containing either 3 or 17 mmol/l glucose. Medium was collected for insulin secretion measurement and islets were harvested with acidified ethanol to determine cellular insulin content. Insulin was measured by radio-immunoassay (Linco Research, St. Charles, MO, U.S.A.).

RNA extraction and TaqMan^® real-time PCR assay

Total RNA was isolated by cell lysis in TRIzol (Gibco) according to the manufacturer’s instructions. RNA samples were treated with DNA-free™ (Ambion, Austin, TX, U.S.A.) to remove any genomic DNA contamination, and quantified by RiboGreen assay (Molecular Probes). cDNA (100 μl) was synthesized from 1 μg of total RNA, using random hexamer primers and Moloney-murine-leukaemia virus reverse transcriptase (Applied Biosystems, Warrington, U.K.). Quantitative real-time PCR (Taqman^®) was performed using 25 ng of reverse-transcribed total RNA with 300 nmol/l of sense and antisense primers, 100 nmol/l of probe (Table 1), 12.5 μl of Master Mix (Qiagen, Crawley, U.K.) in a total volume of 25 μl in an ABI PRISM 7700 Sequence Detection System Instrument. Probes were labelled with 6-carboxyfluororescein (FAM) and 6-carboxy-N, N, N’, N”-tetramethylrhodamine (TAMRA). Standard curves were constructed by amplifying serial dilutions of untreated mice islet cDNA (50 ng-0.64 pg) and plotting cycle threshold (C_t) values as a function of starting reverse-transcribed RNA, the slope of which was used to calculate relative expression of the target gene.

Table 1.

Primer and probe sequences used in quantitative real time RT-PCR analysis (TaqMan®).

Probes were labelled with 6-carboxyfluororescein (FAM) and 6-carboxy-N, N, N’, N” Tetramethyl-rhodamine (TAMRA).

Genes	Accession number	Forward Primer (5’ - 3’)	Reverse Primer (5′ - 3′)	Probe (5′ - 3′)
Srebp1c	NM_011480	CCACTAGAGGTCGGCATGGT	TCCCTTGAGGACCTTTGTCATT	TGCTTGTCAGGCTCACCCTCTGGAA
Cyclophilin	NM_017101	TATCTGCACTGCCAAGACTGA	CCACAATGCTCATGCCTTCTTTCA	CCAAAGACCACATGCTTGCCATCCA
Gapdh	M32599	GTCGTGGATCTGACGTGCC	GATGCCTGCTTCACCACCTT	CCTGGAGAAACCTGCCAAGTATGATGACAT
Fas	NM_007988	CCCTTGATGAAGAGGGATCA	ACTCCACAGGTGGGAACAAG	TCTTTCTCACCAACCTTGGCAAGGT
Acc1	AY451393	TTCTGAATGTGGCTATCAAGACTG	TGCTGGGTGAACTCTCTGAACA	CGATATTGAGGATGACAGGCTTGCAGCT
Chrebp	NM_021455	CAACTCAGCACTTCCACAAG	TGGAAACTTTCACCAGGATT	CTGACTGACCCCAGCCTTGT
Scd1	NM_009127	CCTCCGGAAATGAACGAGAG	CAGGACGGATGTCTTCTTCCA	AGG TGA AGA CGG TGC CCC TCC AC
Scl2a2	NM_031197	CCCTGGGTACTCTTCACCAA	GCCAAGTAGGATGTGCCAAT	TGGCCCTTGTCACAGGCATTCT
Gck	L38990	TCCCTGTAAGGCACGAAGACAT	ATTGCCACCACATCCATCTCA	CTCTTGATAGCATCTCGGAGAAGTCCCA
Pdx1	NM_008814	GAAGAGCCCAACCGCGT	TTGTTTTCCTCGGGTTCCG	CTCCTGCCCACTGGCCTTTCCA
Abcc8	L40624	CCCTCTACCAGCACACCAAT	CAGTCAGCATGAGGCAGGTA	CTTTCTCGGCTCTGGATGTCCATCT
Kcnj11	D50581	TACCACGTCATCGACTCCAA	GTTTCTACCACGCCTTCCAA	ACCACCAGGACCTGGAGATCATTGT
Ngn3	NM_009719	TGCAGCCACATCAAACTCTC	GGTCACCCTGGAAAAAGTGA	TGAGTCTGCCCTCATTCAAATCTGC
NKx 6.1	NM_144955	TTCGGAGAATGAGGAGGATGA	ACCGCTCGATTTGTGCTTTT	ACAAACCTCTGGACCCGAACTCTGACG

Triglyceride measurements

Total lipids were extracted from 50 islets using chloroform/methanol (2:1, v/v) (35). Extracted lipids were air-dried and 10 μl of a detergent (Thesit; Fluka, Gillingham, Dorset, U.K.) was added to the dry pellet. Samples were air-dried again and resuspended in 30 μl of water (36). TG was measured using a commercial kit (Infinity™ Triglyceride Reagent, Sigma) and a standard curve of triolein (Sigma) treated in parallel with the samples.

Total islet protein assay

Total protein (10 islets) was extracted using radio-immunoprecipitation assay buffer, comprising PBS supplemented with 1.0% (v/v) Nonidet P40, 0.5% (w/v) sodium deoxycholate and 0.1% (w/v) SDS. Protein concentration was determined using BCA kit (Pierce, Rockford, IL, U.S.A.).

Statistics

Data are quoted as mean ± S.E.M and statistical analysis performed by one-way ANOVA followed by Newman-Keuls.

Results

Metabolic parameters

We observed no significant differences in body weight, blood glucose or insulin concentrations between SREBP1^-/-, SREBP1^+/- and wild type mice at 3-4 months of age in either the fasting or the fed state (Table 2). Other parameters are discussed below and in the Supplementary section.

Table 2.

Serum insulin and glucose levels in SREBP1-/-, SREBP1+/- and wild type mice at 18h fasted and fed state

	Mice genotype	n	Weight (g)	Insulin (ng/ml)	Glucose (mmol/l)
Fed state
	SREBP1 +/+	9	25.3 ± 0.55	1.27 ± 0.42	8.94 ± 0.46
	SREBP1 +/-	12	24.5 ± 0.54	0.82 ± 0.17	7.86 ± 0.56
	SREBP1 -/-	8	24.7 ± 0.54	1.09 ± 0.42	9.27 ± 0.68
Fasted state
	SREBP1 +/+	10	24.4 ± 1.1	0.40 ± 0.06	4.73 ± 0.28
	SREBP1 +/-	13	22.7 ± 0.8	0.34 ± 0.03	5.46 ± 0.30
	SREBP1 -/-	8	23.2 ± 1.0	0.53 ± 0.09	5.20 ± 0.27

Effects of culture of wild type or SREBP1 deficient islets at elevated glucose concentrations on glucose-stimulated insulin secretion, and TG content

Islets were cultured at glucose concentrations representing either severe hyperglycemia (30 mmol/l) or at level in the physiological range for fed mice (8 mmol/l) (see also Table 2); the effects of lower glucose concentrations (eg 5.5 mmol/l), which correspond to the starved state (Table 2), were not examined here, since our own (F. Diraison and G.A. Rutter, unpublished) and others’ (37; 38) observations indicate that these are associated with increased apoptosis during extended islet culture. Culture of wild type islets at 30 versus 8 mmol/l glucose concentrations increased basal (3 mmol/l) and high (17 mmol/l) glucose-stimulated insulin secretion (Figure 1). In contrast to freshly isolated islets, where a small increase in the extend of glucose-stimulated (17 versus 3 mmol/l) insulin secretion was apparent (supplementary data 1), SREBP1^-/- islets displayed a significantly lower fold change in the acute stimulation of insulin secretion by glucose after culture at either 8 or 30 mmol/l glucose (Figure 1A, 1B). A smaller and non-significant tendency towards impaired GSIS was also seen in SREBP1^-/+ islets (Figure 1A, 1B).

Figure 1. Effects of glucose and SREBP1 deletion on glucose-stimulated insulin secretion and triglyceride content after chronic exposure of mouse islets to high [glucose].

After isolation, islets (n=3/genotype) were cultured for 96 h at 8 or 30 mmol/l glucose before measuring GSIS (5 determinations/experiment) and TG content, as described in Material and Methods. A, B: Insulin release. C: Insulin content. D: TG content. *p<0.05; ** p<0.01; *** p<0.001 for the 17 mmol/l glucose effect. † p <0.05; †† p <0.01; ††† p <0.001 for the effect of chronically elevated [glucose].

However, if we compared GSIS between genotypes, we observed that there were no significant differences between the fold-stimulation of insulin secretion acutely by 17 mmol/l versus 3 mmol/l glucose for islets of the same genotype cultured at either 8 or 30 mmol/l (Figure 1A, 1B).

Culture for four days at 30 mmol/l compared to 8 mmol/l glucose also decreased total insulin content by > 85 % in each genotype (Figure 1C), presumably reflecting the sustained stimulation of insulin release under these conditions.

TG accumulation was significantly enhanced by culture of wild type or SREBP1^+/- islets at 30 vs. 8 mmol/l glucose (Figure 1D). Furthermore, with respect to islets from wild type or SREBP^+/- mice, SREBP1^-/- mouse islets displayed a substantially (60%) decreased TG content after culture at 8 mmol/l glucose, and no further TG increase was seen in these islets after culture at 30 mmol/l glucose (Figure 1D).

Effect of chronic exposure to elevated glucose concentrations on gene expression in wild type or SREBP1 deficient islets

To analyse in more detail the mechanisms that may be responsible for the decreases in glucose-stimulated insulin secretion in SREBP1^-/- vs. wild-type islets, we measured the expression of candidate genes using quantitative real time PCR (Taqman^®) (Figure 2). Deletion of SREBP1 had complex effects on the changes in the lipogenic and other gene expression observed during culture at elevated glucose concentrations. Thus, Fas and Gck gene expression was decreased in SREBP1-deleted compare to wild type islets after four days culture at 8 but not 30 mmol/l glucose (Figure 2D, 2G). By contrast, Acc1, Slc2a2, Abcc8, Kcnj11 and Pdx1 mRNA levels were decreased in SREBP1 knockout versus wild type islets at 30 mmol/l glucose but not at 8 mmol/l (Figure 2E, 2F, 2I, 2J, 2K). Scd1 mRNA levels were decreased at 30 and 8 mmol/l (Figure 2H) whereas SREBP 1 deletion had no effect on Chrebp or NKx6.1 gene expression (Figure 2C, 2M). In most cases, the levels of gene expression in heterozygote mice were intermediate between those in wild type and SREBP1^-/- islets at each glucose concentration.

Figure 2. Gene expression in islets cultured for 96 h at 8 or 30 mmol/l glucose.

After isolation, islets (n=3/genotype) were cultured for 96 h at 8 or 30 mmol/l glucose before RNA extraction. #p<0.05; ### p<0.001 for the genotype effect. *p<0.05; ***p<0.001 for the effect of chronically elevated [glucose].

When cultured at 8 mmol/l glucose, Ngn3 gene expression was significantly increased in SREBP1^+/- and SREBP1^-/- mouse islets (Figure 2L). We observed no changes in the expression of cyclophillin D (Figure 2A) to which other genes were normalised, or another ”housekeeping” gene, Gapdh (data not shown) excluding the effects of glucose as being non-specific.

Effect of triacsin C on glucose-stimulated insulin secretion, TG content and gene expression in islets cultured in chronic high glucose concentrations

To examine the hypothesis that there may be a potential role of acyl-CoA or TG synthesis in the long term regulation of gene expression and insulin secretion by glucose we used Triacsin C. This pharmacological agent is an inhibitor of long-chain acyl-CoA synthetase and thus of de novo triglyceride synthesis and acyl-CoA oxidation (32).

We first determined whether triacsin C may mimic the effects of SREBP1 deletion on glucose-stimulated insulin secretion observed in islets cultured in the same conditions (Figure 3). Islets from wild type mice were cultured for 96 h at 8 mmol/l or 30 mmol/l glucose in the presence or absence of 10 μmol/l triacsin C, before measuring GSIS. Addition of triacsin C decreased GSIS by 42.3% and 41.5% when islets were cultured for 96 h at 8 mmol/l or 30 mmol/l glucose respectively, but had no effect on basal insulin secretion (Figure 3).

Under the same conditions, triacsin C had no effect on Srebp1, Chrebp, Fas, Acc1, Scd1, Pdx1, Gck or Slc2a2 mRNA levels in islets cultured at 8 mmol/l glucose. However, with the exception of Slc2a2 and Chrebp mRNA, which was still induced by 30 mmol/l glucose, up-regulation of Acc1 (p<0.05), Gck (p<0.05), Srebp1, Fas, Scd1 and Pdx1 gene expression was decreased in the presence of triacsin C (Figure 4). Again, we observed no changes in the expression of Cyclophillin D (Figure 4) or Gapdh (data not shown).

Figure 4. Effect of triacsin C on gene expression in islets exposed to long-term culture at high [glucose].

(A-F): After isolation, islets from wild type mice (n=3/genotype) were cultured for 96 h at 8 or 30 mmol/l glucose in the presence or absence of triacsin C (10 μmol/l) before RNA extraction. *p<0.05 for the chronically elevated glucose effect. # p<0.05 for the triacsin C effect.

We also measured the effect of this drug on TG content in islets cultured under the same conditions. Triacsin C decreased TG content when islets (versus non-treated islets) were cultured for 96h at 8 mmol/l or 30 mmol/l glucose respectively (Figure 5).

Discussion

The principal aims of this study were (a) to re-examine the effects of extended culture at elevated glucose concentrations on basal and glucose-stimulated insulin secretion from mouse islets and (b) to determine whether the induction by glucose of SREBP1 (20), and enhanced fatty acid and/or triglyceride synthesis, might contribute to any effects observed.

In line with findings from Khaldi et al (7) of a “left shift” in the dose response to glucose of mouse islets incubated at high glucose concentrations, we show firstly that both basal and glucose-stimulated insulin secretion are enhanced by culture of C57BL/6 mouse islets at 30 versus 8 mmol/l glucose (Figure 1). Culture at 8 mmol/l glucose essentially preserved the secretory responses observed in freshly isolated islets (compare Figure 1A and supplementary data 1A), when rates of release were compared at 3 or 17 mmol/l glucose in each case. Whilst glucose has been shown to stimulate growth and proliferation of β-cells, especially in foetal islets (39), it would seem unlikely that the enhanced secretion of insulin observed in the present study simply reflects an increased in β-cell mass per islet after culture at 30 versus 8 mmol/l.

The present data thus confirm that, in the mouse, culture at mildly or strongly elevated glucose concentrations fails to elicit evident “glucotoxic” effects but rather elevates basal insulin secretion whilst preserving glucose-stimulated secretion. In this respect, the response to long term high glucose treatment of C57BL/6 mouse islets appears to be quite distinct to that of isolated rat islet β-cells, where even relatively short term (24 h) exposure to 30 mmol/l glucose caused marked decreases in glucose-stimulated insulin secretion (40; 7).

Although SREBP1^-/- mice displayed a slight increase in glycaemia following an intraperitoneal glucose tolerance test (supplementary data 3), it seems possible that this may reflect, at least in part, altered insulin sensitivity rather than defective insulin secretion. Indeed, GSIS was slightly enhanced in freshly isolated islets from mice deleted for both Srebp1 alleles versus wild type mice (supplementary data 1), consistent with earlier results (26), this difference was reversed upon culture at either 8 or 30 mmol/l glucose. Thus, a clear impairment of GSIS was apparent in SREBP1^-/- (but not SREBP1^+/-) islets after culture at either 8 or 30 mmol/l glucose (Figure 1) and this change was associated with decreased islet TG content in SREBP1^-/- islets (Figure 1D). These results also show that even if the fold-stimulation of insulin secretion for islets of the same genotype were similar when cultured at 8 or 30 mmol/l glucose (Figure 1A, 1B), SREBP1^-/- islets tolerated less well than wild type islets prolonged culture at either glucose concentration.

The above results thus challenge the physiological relevance of previous findings from ourselves (19) and others (21; 26) which showed that forced over-expression of SREBP1 in β-cells or islets increased lipogenic gene expression, leading to an accumulation of triglycerides and an inhibition of GSIS, as well as an ER stress response and enhanced cell death (41). Nevertheless, it might be argued that more substantial increases in SREBP1 expression, for example in the combined presence of elevated glucose and free fatty acid levels (ie “glucolipotoxic” conditions), might contribute to β-cell dysfunction. Arguing against this view, expression in ZDF islets (42) of a dominant-negative form of SREBP1c (28) failed to significantly reverse defective glucose-stimulated insulin secretion, whilst substantially decreasing islet TG content and reversing the expression of lipogenic genes.

We also show here that SREBP1 is required for the induction by 30 versus 8 mmol/l glucose, as expected, of lipogenic (Fas, Acc1, Scd1) genes (Figure 2) given the previously described role of this factor in the control of lipogenic genes (20, 43) consequently for enhanced TG accumulation (Figure 1D). More surprising was the apparent action of SREBP1 knockout to block the induction by 30 versus 8 mmol/l on several other genes involved in glucose sensing (Slc2a2, Gck, Abcc8, Kcnj11) (Figure 2).

It was also observed here that Pdx1 gene expression was increased in normal mouse islets cultured at elevated glucose concentrations (Figure 2), and that this effect was inhibited in islets from mice deleted for SREBP1. PDX1 is a key transcription factor involved in pancreatic development (44) and in the maintenance of the β-cell phenotype (45), serving to control insulin (46), Slc2a2 (47) and Nkx6.1 (48) gene expression. LXR (Liver X receptors, α and β) is a member of a nuclear receptor superfamily of ligand-activated transcription factors. In a recent study (49), down-regulation of SREBP1 expression in INS-1 cells by RNA interference blocked Liver X Receptor (LXR)-induced expression of Pdx1, compatible with the view that SREBP1 is involved in the regulation of Pdx1. Decreases in Pdx1 levels in SREBP1^-/- following culture at 30 mmol/l glucose islets may subsequently underlie the loss of glucose-stimulated expression of Slc2a2 and Nkx6.1. By contrast, Pdx1 gene expression was higher in freshly isolated islets from SREBP1^-/- versus SREBP1^+/+ mice (supplementary data 2) a finding consistent with a negative role for SREBP1c in the control of basal Pdx1 gene expression. Perhaps reconciling these observations, a recent study proposed that the effects of SREBP1 on β-cells function depend of the level and the duration of its activation (49).

Interestingly, SREBP1 deletion had no effect on Chrebp mRNA levels, confirming previous in vitro data in an insulinoma cell line (41) and showing that there were no compensatory increases in the expression of the latter transcription factor in SREBP1^-/- islets.

In a complementary approach, we also used Triacsin C here to study the potential role of acyl-CoA or TG synthesis in the long term regulation of gene expression and insulin secretion by high glucose. Blockage of acyl-CoA synthesis using Triacsin C affects both fatty acid oxidation and the synthesis of triglycerides (32). Importantly, using the same culture conditions (four days at 8 or 30 mmol/l glucose) we could mimic the effects of SREBP1 deletion on both glucose-stimulated insulin secretion (Figure 3) and TG content (Figure 5). Interestingly, the resistance of Slc2a2 mRNA induction to the effects of triacsin C (Figure 4H), compared to the complete abolition of glucose-induced increases in this gene in SREBP1^-/- islets (Figure 2F) may reflect a direct binding of SREBP1c to the Slc2a2 promoter, as reported in primary rat hepatocytes (50). Nevertheless, it seems reasonable to conclude that the augmentation of basal and glucose-stimulated insulin secretion by culture at elevated glucose concentrations (Figures 1, 3) may reflect enhanced fatty acyl-CoA synthesis resulting in the up-regulation of several genes involved in glucose metabolism or sensing.

In summary, the present results demonstrate a requirement for SREBP1 in the hypersecretion of insulin resulting from chronic exposure of mouse islets to high glucose concentrations in vitro. In addition to the requirement for SREBP1 in the induction of lipogenic genes, SREBP1 is also shown, unexpectedly, to be necessary for the up-regulation of genes directly involved in the expression of β-cell enriched genes (Pdx1) and in genes whose products are central to glucose sensing (Slc2a2, Gck, Kcnj11, Abcc81). Induction of SREBP1c and enhanced lipid synthesis may therefore play a key role in adaptive insulin hypersecretion observed in some models of hyperglycemia.

Abbreviations used

Acc1

acetyl-coenzyme A carboxylase 1

bHLH-Zip

basic helix-loop-helix leucine zipper

Chrebp

carbohydrate-responsive element-binding protein

ER

endoplasmic reticulum

Fas

fatty acid synthase

Gapdh

glyceraldehyde-3-phosphate dehydrogenase

Gck

glucokinase

Slc2a2

glucose transporter 2

GSIS

glucose-stimulated insulin secretion

IPGTT

intraperitoneal glucose tolerance test

K_ATP

ATP sensitive K+ channel

Kcnj11

inwardly rectifying K⁺ channel 6.2

KRBH

Krebs-Ringer bicarbonate buffer

LXR

liver X Receptors

Ngn3

neurogenin 3

Pdx1

pancreatic duodenal homeobox 1

Scd1

stearoyl-CoA desaturase 1

SRE

sterol response element

SREBP

sterol regulatory element-binding protein

TG

triglyceride