Transforming growth factor‐β1 (TGF‐β1) induces mouse precartilaginous stem cell differentiation through TGFRII‐CK1ε‐β‐catenin signalling

Summary

Precartilaginous stem cells (PSCs) are adult stem cells which could self‐renew or differentiate into chondrocytes to promote bone growth. In this study, we aimed to understand the role of transforming growth factor‐β1 (TGF‐β1) in precartilaginous stem cell (PSC) differentiation and to study the mechanisms that underlie this role. We purified PSCs from the neonatal murine perichondrial mesenchyme using immunomagnetic beads, and primary cultured them. Their phenotype was confirmed by the PSC marker fibroblast growth factor receptor‐3 (FGFR‐3) overexpression. TGF‐β1 was added to induce PSCs differentiation. TGF‐β1 increased mRNA expression of chondrogenesis‐related genes (collagen type II, Sox 9 and aggrecan) in the cultured PSCs. This was abolished by TGF‐β receptor II (TGFRII) and Casein kinase 1 epsilon (CK1ε) lentiviral shRNA depletion. Meanwhile, we found that TGF‐β1 induced CK1ε activation, glycogen synthase kinase‐3β (GSK3β) phosphorylation and β‐catenin nuclear translocation in the mouse PSCs, which was almost completely blocked by TGFRII and CK1ε shRNA knockdown. Based on these results, we suggest that TGF‐β1 induces CK1ε activation to promote β‐catenin nuclear accumulation, which then regulates chondrogenesis‐related gene transcription to eventually promote mouse PSC differentiation.

1. INTRODUCTION

The applications of chondrocytes in scientific researches and clinical applications are restrained due to their poor renewal capacity.1 Precartilaginous stem cells (PSCs) are a form of adult stem cell that exists in the most peripheral layer of the epiphyseal organ within perichondrial mesenchyme in embryonic limbs. This is known as the ring of La Croix, and it plays a key role in cartilage growth, endochondral ossification and in the healing process of damaged articular cartilage.2 Robinson et al3 first separated PSCs from perichondrial mesenchyme (the ring of La Croix) of rat neonates by immunomagnetic beads conjugated with fibroblast growth factor receptor‐3 (FGFR‐3) antibody. These PSCs have potential to differentiate directionally to chondrocytes and eventually promote bone growth.2, 3 Transforming growth factor‐β1 (TGF‐β1) was tested to induce chondrocyte differentiation from stem cells,4, 5 but its role in relationship to the PSCs, and the underlying signalling mechanisms have not been studied previously.

TGF‐β1 initiates signal transduction by binding to type I and type II receptor serine/threonine kinases on the cell surface. TGF‐β receptor II (TGFRII) then phosphorylates the TGF‐β receptor I (TGFRI) kinase domain, leading to Smad protein phosphorylation and activation.6 The activated Smad complexes translocate into the nuclei and regulate the transcription of target genes.6, 7 Besides activating the traditional Smad‐transcription pathway, TGF‐β1 could also activate other signalling pathways (so‐called “non‐Smad pathways”).8 For example, TGF‐β1 is known to activate the Erk/MAPK9 pathway and the phosphoinositide 3‐kinase (PI3K)/Akt10, 11 pathway. These non‐Smad pathways work independently or together with Smad complexes to regulate TGF‐β1′s functions.6, 7, 11

Wnt/β‐catenin signalling is implicated in embryonic development, stem cell biology and disease. The transcription factor β‐catenin is the key player in Wnt signalling. Without Wnt ligand stimulation, cytosol β‐catenin is phosphorylated and degraded through ubiquitination.12, 13, 14 Upon Wnt stimulation, Wnt molecules bind to its membrane‐bound receptor (Frizzled) and the co‐receptor (LRP5/6)13, 15 and then the kinases (ie glycogen synthase kinase‐3β (GSK3β) and adenomatous polyposis coli (APC)16 that phosphorylate and destabilize β‐catenin are inhibited; thus, β‐catenin accumulates in the nucleus, where it associates with transcription factors to activate transcription of Wnt‐responsive genes, which are important for self‐renewing and differentiation.17 The Wnt/β‐catenin signalling cascade is regulated at different levels by a wide range of effectors. Among them, Casein kinase 1 (CK1) members are of significant importance, as they phosphorylate and thus regulate the activity of key pathway components. Casein kinase 1 epsilon (CK1ε) is well known as a positive regulator of the Wnt/β‐catenin signalling pathway.18

Recent studies have identified a cross‐talk between the TGF‐β and β‐catenin signalling pathways in both adult and embryonic stem cells; it was found that TGF‐β1 could directly promote β‐catenin nuclear translocation without affecting β‐catenin stability or phosphorylation.19 In this study, we isolated, purified and cultured PSCs from the perichondrial mesenchyme of neonatal mice and then explored the potential role of TGF‐β1 in mouse PSC differentiation by focusing on the signalling mechanisms. We discovered that TGF‐β1 induces mouse PSC differentiation through TGFRII‐CK1ε‐β‐catenin signalling.

2. MATERIAL AND METHODS

2.1. Chemicals, reagents and antibodies

TGF‐β1 was obtained from Selleck (Shanghai, China). Anti‐CK1ε, GSK3β, FGFR‐3, β‐catenin and glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). All other kinase antibodies used in this study were obtained from Cell Signaling Technology (Shanghai, China).

2.2. Precartilaginous stem cells isolation, purification and culture

Similar to previous reports,2, 3 neonatal C57BL/6J mice were provided by the animal centre of Nanjing Medical University. The tissues located around the perichondrial mesenchyme (the La Croix rings) were cut out and digested sequentially with Complete™ Trypsin Solution (Chemicon International Inc., CA) and 0.05% collagenase type I (Sigma Chemical Co., MO). After the cells were dispersed and suspended as a single cell suspension in 0.1 M phosphate buffer saline (PBS), they were incubated with FGFR‐3 antibody (c‐15) (1:500, Santa Cruz Biotechnology Inc., Santa Cruz, CA)2 and then the FGFR‐3 expressing cells were purified using an immunomagnetic separation system (Miltenyi Biotec, Bergisch Gladbach, DE). Immuno‐selected PSCs were then cultured in DMEM/F12 medium (Thermo Fisher Scientific Inc., CA), supplemented with 20% foetal calf serum (FCS, Gibco, Shanghai, China), 100 units/mL penicillin and streptomycin in a 5% CO₂/37°C incubator. The detailed procedures have been described.2, 3 The medium was switched every two days. The protein and mRNA expressions of FGFR‐3 were tested by Western blots and RT‐PCR to verify the phenotype of the mouse PSCs.

2.3. FGFR‐3 immunofluorescence

The purified PSCs were seeded into six‐well plates with 5 × 10⁵ cells/well. After attachment, PSCs were fixed with 4% paraformaldehyde for 20 minutes at room temperature. The cells were then permeabilized with 0.2% Triton X‐100 solution for five minutes. Cells were then incubated with the rabbit anti‐FGFR‐3 (1:200 dilution, sc‐82, Santa Cruz) at 4°C overnight. Next, detection of the bound primary antibodies was enabled by incubating cells with goat anti‐rabbit IgG‐Cy3 (Cellular Signaling Tech, Shanghai, China) for one hour at 37°C, the cells were then observed and images recorded under an Olympus fluorescence microscope (CX41, Olympus, Tokyo, Japan).

2.4. Protein isolation, Western blots and data quantification

After treatment, PSCs were washed twice with ice‐cold PBS and then lysed using lysis buffer containing 1% Nonidet P‐40, 1% deoxycholate, 0.1% sodium dodecyl sulphate, 150 mmol/L sodium chloride and 10 mmol/L Tris‐HCl (pH, 7.4). The lysates were collected and centrifuged. The concentration of the extracted protein was measured by bicinchoninic acid assay kit (Sigma). The extracted protein was boiled for five minutes in loading buffer. Samples (20 μg/well) were separated on 10% SDS‐polyacrylamide gel, and after electro‐blotting onto polyvinylidene fluoride (PVDF) membranes (Millipore, Shanghai, China), the blots were blocked with blocking solution [10% (w/v) milk in Tris‐buffered solution plus Tween‐20 (TBST), incubated overnight at 4°C with primary antibodies and then incubated with HRP‐conjugated anti‐rabbit/mouse secondary antibodies]. The detection was performed by Super‐signal West Pico Enhanced Chemiluminescent (ECL) Substrate. The band intensity was quantified by ImageJ software (NIH) after normalization to the corresponding loading controls. And the quantification number was expressed as fold change vs the band labelled with “1.00.”

2.5. Total RNA isolation and real‐time reverse transcriptase polymerase chain reaction (RT‐PCR)

Total RNA was prepared by RNA‐TRIZOL extraction (Gibco). Concentration and purity of the extracted RNA were measured spectrophotometrically at A260 and A280. Real‐time reverse transcription‐polymerase chain reaction (real‐time PCR) was performed using TOYOBO ReverTra Ace RT‐PCR kit according to the manufacturer's instructions. Primers were F:5′‐GTGGGAGCGACAACTTTACC‐3′/ R:5′‐GAGAACGAAACCAGGGCTACT‐3′ for Sox9; F:5′‐aCAAGAGCAAGGGAA GAAGCA‐3′/R:5′‐TGGACAGTAGACGGAGGAAAG‐3′ for Collagen type II; F:5′‐A GAATCCATAACTGCCCCAAC‐3′/R:5′‐GTCACGCCC TCCACTAACTCT‐3′ for Aggrecan; F:5′‐GAAGGTGAAGGTCGGAGTC‐3′/R:5′‐GAAGATGGTGATGGGA TTTC‐3′ for GAPDH; F:5′‐ATGGAGTTGCGTGTTGGA‐3′/R:5′‐GTCAACATACA ACACTTTCTG‐3′ for CK1ε and F:5′‐CGCTTTGCTGAGGTCTATAAGGC‐3′/R:5′‐ GATATTGGAGCTCTTGAGGTCCCT‐3′ for TGFRII. A typical reaction (50 μL) contained 1/50 of reverse transcription‐generated cDNA and 200 nM of primer in 1 × SYBR Green RealTime Master Mix (Toyobo, Shanghai, China) buffer. The PCR reactions were carried out on a Bio‐Rad IQ5 multicolour detection system using 2 μg of synthesized cDNA under the following conditions: 95°C for 5 minutes, 40 cycles at 95°C for 15 seconds, 60°C for 15 seconds and 72°C for 30 seconds. All real‐time PCRs were performed at least in triplicate. The value was always normalized to the control group.

2.6. Target protein shRNA knockdown through lentiviral infection

Four different non‐overlapping lentiviral shRNAs against the same targeted protein (TGFRII or CK1ε) were designed, synthesized and verified by the Shanghai Kaiji Biotech (Shanghai, China). The pre‐experiments were performed to test the knocking‐down efficiency of these four shRNAs. The two most efficient shRNAs were selected for further experiments. PSCs were seeded in a six‐well plate in the growth medium. The lentiviral shRNAs were added to the cells (15 μL/mL), after 12 hours, the medium was replaced by fresh growth medium, and cells were further cultured for additional 48 hours. The expression of target protein (TGFRII or CK1ε) and the equal loading in infected cells were always detected by Western blots. Control cells were infected with same amount of lentiviral scramble non‐sense shRNA (labelled as “sc‐shRNA”) (Shanghai Kaiji Biotech).

2.7. Data analysis

Data were collected using a minimum of three experiments and used to calculate the mean ± SD. Statistical differences were analysed by one‐way ANOVA followed by multiple comparisons performed with post hoc Bonferroni test (SPSS version 18). Values of P < .05 were considered statistically significant.

3. RESULTS

3.1. Mouse precartilaginous stem cells (PSCs) isolation, purification and verification

Using the methods described above, we successfully isolated and purified PSCs from perichondrial mesenchyme (the La Croix rings) of the neonate mice. Morphological images in Figure 1A showed PSCs at Day 4 of culture. FGFR‐3 was recognized as a marker for PSCs. Thus, we tested its expression in the cultured PSCs. The immunofluorescence image in Figure 1B confirmed FGFR‐3 expression in PSCs plasma membrane. Further, RT‐PCR and Western blotting results confirmed FGFR‐3 mRNA and protein expression in the mouse PSCs (Figure 1C,D). Note that RT‐PCR and Western blotting results showed no FGFR‐3 expression in the cells left after immunomagnetic separation (non‐PSCs) (Figure 1C,D).

Figure 1.

Mouse precartilaginous stem cells (PSCs) isolation, purification and verification. PSCs isolation and culture. The morphology of mouse PSCs at Day 4 of culture is shown (A). Immunofluorescence microscopy (B), Western blotting (C) and RT‐PCR (D) results showed the expression of FGFR‐3 in cultured mouse PSCs (Day 4 of culture), while the cells left after immunomagnetic separation (termed “non‐PSCs”) were negative for FGFR‐3. GAPDH was tested as the loading control (C and D). Magnification: 1:200 (A). Bar = 15 μm (B). Experiments in this figure were repeated three times, and similar results were obtained [Colour figure can be viewed at http://wileyonlinelibrary.com]

3.2. TGF‐β receptor II is required for TGF‐β1‐induced expression of chondrogenesis‐related genes in primary cultured mouse PSCs

In this study, we tested the potential role of TGF‐β1 on PSCs differentiation. We found that the mRNA expression of chondrogenesis‐related genes, including Sox 9, collagen II and aggrecan,2 was significantly upregulated after TGF‐β1 stimulation in primary cultured PSCs (Figure 2C‐E). We then explored the involvement of TGFRII in the process. The lentiviral TGFRII‐shRNAs were utilized to knockdown TGFRII in cultured PSCs. Note that we utilized two different shRNAs (TGFRII siRNA‐a and TGFRII siRNA‐b) against non‐overlapping gene sequence of mouse TGFRII, aiming to exclude off‐target effects (same for all the shRNA experiments in the paper). Western blots and real‐time PCR results showed that protein and mRNA expressions of TGFRII were dramatically downregulated in PSCs by both lentiviral TGFRII‐shRNAs, while cells infected with scramble‐shRNA virus showed equivalent TGFRII expression to that found in the parental cells (Figure 2A,B). Significantly, real‐time PCR results clearly showed that TGFRII was required for TGF‐β‐induced chondrogenesis genes expression in PSCs, as mRNA expression of collagen II, Sox 9 and aggrecan by TGF‐β1 was largely inhibited by the two TGFRII lentiviral shRNAs in the PSCs (Figure 2C‐E). Thus, TGFRII is required for TGF‐β‐induced chondrogenesis in primary cultured mouse PSCs.

Figure 2.

TGF‐β receptor II is required for TGF‐β1‐induced expression of chondrogenesis‐related genes in primary cultured mouse PSCs.TGFRII lentiviral shRNAs (‐a/‐b) or scramble lentiviral shRNA (15 μL/mL each) was added to PSCs (Day 4) for 48 hours. Afterwards, the protein and mRNA expressions of TGFRII and GAPDH were tested by Western blots (A) and real‐time PCR (B) respectively. TGFRII protein expression was quantified. Above PSCs (infected with TGFRII lentiviral shRNAs or scramble lentiviral shRNA) and the parental PSCs were treated with TGF‐β1 (25 ng/mL) for 24 and 48 hours, mRNA expression of collagen II (C), Sox 9 (D) and aggrecan (E) was tested by real‐time PCR, GAPDH was also tested as a internal control and was equivalent among different groups (not shown). Experiments in this figure were repeated three times, and similar results were obtained. *P < .05 vs scramble‐shRNA group (B‐E) [Colour figure can be viewed at http://wileyonlinelibrary.com]

3.3. CK1ε activation is important for TGF‐β1‐induced chondrogenesis‐related genes expression in primary cultured mouse PSCs

Next, we explored the cellular signalling mechanisms of TGF‐β1‐induced chondrogenesis‐related genes expression. To explore the role of CK1ε in TGF‐β1‐induced chondrogenesis genes expression, the lentiviral CK1ε‐shRNAs were utilized to knockdown CK1ε in cultured PSCs. Note that we utilized two different shRNAs (CK1ε siRNA‐a and CK1ε siRNA‐b). Western blots and real‐time PCR results showed that protein and mRNA expressions of CK1ε were dramatically downregulated in PSCs by both lentiviral CK1ε‐shRNAs, while cells infected with scramble‐shRNA virus showed equivalent CK1ε expression as the parental cells (Figure 3A,B). Significantly, real‐time PCR results clearly showed that CK1ε was required for TGF‐β1‐induced chondrogenesis genes expression in PSCs, as mRNA expression of collagen II, Sox 9 and aggrecan by TGF‐β1 was largely inhibited by the two CK1ε lentiviral shRNAs in the PSCs (Figure 3C‐E), indicating that CK1ε activation is important for TGF‐β1‐induced expression of chondrogenesis in mouse PSCs.

Figure 3.

CK1ε activation is important for TGF‐β1‐induced chondrogenesis‐related genes expression in primary cultured mouse PSCs. CK1ε lentiviral shRNAs (‐a/‐b) or scramble lentiviral shRNA (15 μL/mL each) was added to PSCs (Day 4) for 48 hours. Afterwards, the protein and mRNA expressions of CK1ε and GAPDH were tested by Western blots (A) and real‐time PCR (B) respectively. CK1ε protein expression was quantified. Above PSCs (infected with CK1ε lentiviral shRNAs or scramble lentiviral shRNA) and the parental PSCs were treated with TGF‐β1 (25 ng/mL) for 24 and 48 hours, mRNA expression of collagen II (C), Sox 9 (D) and aggrecan (E) was tested by real‐time PCR, GAPDH was also tested as a internal control and was equivalent among different groups (not shown). Experiments in this figure were repeated three times, and similar results were obtained. *P < .05 vs scramble‐shRNA group (B‐E) [Colour figure can be viewed at http://wileyonlinelibrary.com]

3.4. TGF‐β1 Receptor II Is Required for TGF‐β1‐Induced CK1ε activation, GSK3β Phosphorylation and β‐Catenin Nuclear Translocation

Here, we first tested the potential role of TGF‐β1 on PSC differentiation. We examined the response of mouse PSCs to TGF‐β1. Western blotting results in Figure 4A show that TGF‐β1 induced significant CK1ε activation, GSK3β phosphorylation in cultured mouse PSCs. Meanwhile, the same concentration of TGF‐β1 promoted β‐catenin nuclear translocation (Figure 4C), without affecting its overall expression (Figure 4B). We then explored the involvement of TGFRII in TGF‐β1 signalling. The TGFRII‐shRNA containing lentiviral particles were applied to selectively knockdown TGFRII in cultured mouse PSCs. Western blotting results demonstrated that TGFRII was dramatically downregulated in PSCs after TGFRII‐shRNA lentiviral infection, while cells infected with scramble‐shRNA lentivirus showed intact TGFRII expression (Figure 4D). Significantly, TGFRII knockdown dramatically inhibited TGF‐β1‐induced CK1ε activation, GSK3β phosphorylation (Figure 4D) and β‐catenin nuclear translocation (Figure 4E), indicating the requirement of TGFRII in TGF‐β1 signalling in mouse PSCs.

Figure 4.

TGF‐β1 Receptor II Is Required for TGF‐β1‐Induced CK1ε activation, GSK3β Phosphorylation and β‐Catenin Nuclear Translocation. TGFRII is required for TGF‐β1‐induced CK1ε activation, GSK3β phosphorylation and β‐catenin nuclear translocation. Mouse PSCs (Day 4) were treated with TGF‐β1 (25 ng/mL) for the indicated time point; cytosol and nuclear fractions were isolated, and the expression of indicated proteins in the corresponding fraction was tested by Western blotting (A‐C). The lentiviral particles containing TGFRII‐shRNA or scramble‐shRNA (15 μL/mL each) were added to mouse PSCs (Day 4) for 48 hours. Afterwards, mouse PSCs were treated with TGF‐β1 (25 ng/mL) for the indicated time point; cytosol and nuclear fractions were isolated, and the expression of indicated proteins in the corresponding fraction was tested by Western blotting (D and E). Experiments in this figure were repeated three times, and similar results were obtained. “C” stands for the PBS control

3.5. CK1ε Is Required for TGF‐β1‐Induced GSK3β Phosphorylation and β‐Catenin Nuclear Translocation

The β‐catenin level is kept low by a continued process of phosphorylation‐dependent ubiquitination and degradation.13, 14, 20 When the kinases that phosphorylate and destabilize β‐catenin are inhibited, β‐catenin will travel to and accumulate in the nuclei, where it associates with TCF/LEF transcription factors to activate its responsible genes. CK1ε is known to phosphorylate and inhibit GSK3β, which could allow β‐catenin to translocate to the nuclei. We have shown that TGF‐β1 induces GSK3β in‐activation (phosphorylation) in mouse PSCs (Figure 4); we then tested the involvement of CK1ε in this process. The CK1ε‐shRNA containing lentiviral particles were applied to selectively knockdown CK1ε in cultured mouse PSCs. As expected, which blocked TGF‐β1‐induced CK1ε activation in mouse PSCs (Figure 5A). Significantly, TGF‐β1‐induced GSK3β phosphorylation and β‐catenin nuclear translocation were also suppressed (Figure 5A,B), indicating that CK1ε activation is important for TGF‐β1‐induced β‐catenin nuclear translocation.

Figure 5.

CK1ε Is Required for TGF‐β1‐Induced GSK3β Phosphorylation and β‐Catenin Nuclear Translocation. The CK1ε‐shRNA inhibits TGF‐β1‐induced GSK3β phosphorylation and β‐catenin nuclear translocation in mouse PSCs. Mouse PSCs were pretreated with the lentiviral particles containing CK1ε‐shRNA or scramble‐shRNA (15 μL/mL each) for one hour, followed by TGF‐β1 (25 ng/mL) stimulation. Cells were further cultured for the indicated time point; cytosol and nuclear fractions were isolated, and the expression of the indicated proteins in the corresponding fraction was tested by Western blotting (A and B). Experiments in this figure were repeated three times, and similar results were obtained

4. DISCUSSIONS

Robinson3 isolated a type of stem cells from the La Croix ring of the thigh bone of guinea pigs and found that the stem cells have the potential to differentiate in multiple ways: they can differentiate into osteoblasts and chondroblasts under the appropriate circumstances and therefore are dubbed PSCs. PSCs are found to assume a role in the growth of animal limbs at developmental stage. Removal of the La Croix ring in which PSCs reside can result in growth arrest of animal limbs, which suggests that PSCs are intimately related to chondrogenesis and may act as seeding cells for biological therapy, such as stem cell‐mediated cell transplantation. In the current study, we successfully isolated, purified and cultured PSCs from the perichondrial mesenchyme of neonatal mice using immunomagnetic beads.

Transforming growth factor‐β₁ is known to regulate cell proliferation and differentiation, extracellular matrix synthesis and apoptosis. Studies have revealed that several stem cells can be differentiated by TGF‐β₁.21, 22, 23 We tested the biological functions of TGF‐β1 in the mouse PSCs and demonstrated that TGF‐β1 activated TGFRII to increase mRNA expression of selected chondrogenesis‐related genes (collagen type II, Sox 9 and aggrecan). Using shRNA strategies, our evidence suggests that TGFRII is important for TGF‐β1‐induced chondrogenesis gene expression in primary cultured mouse PSCs, indicating that TGF‐β1 could induce mouse PSCs differentiation.

It is now well known that TGF‐β1 can activate via non‐Smad pathways.8 Of these non‐Smad signalling cascades, CK1 members, especially CK1ε, play an important role in regulating the Wnt/β‐catenin signalling pathway.18 In the current study, we discovered that TGF‐β1 could activate CK1ε to increase mRNA expression of chondrogenesis‐related genes (collagen type II, Sox 9 and aggrecan) and induced mouse PSC differentiation. Using shRNA strategies, our results showed that CK1ε is important for TGF‐β1‐induced chondrogenesis genes expression, indicating that CK1ε activation is important for TGF‐β1‐induced differentiation of mouse PSCs.

Wnt/β‐catenin signalling is required for normal development and proliferation; the activation of β‐catenin is reported to be associated with enhanced self‐renewing and differentiation.24, 25 In our mechanism studies, we hypothesised the existence of signalling cross‐talk between the TGF‐β1 and β‐catenin signalling pathways in cultured mouse PSCs. We discovered that TGF‐β1 induces GSK3β phosphorylation through CK1ε activation, which induces β‐catenin stabilization and nuclear translocation, which was required for mouse PSCs differentiation. TGF‐β1 failed to change the expression of β‐catenin in PSCs. Rather, we found that the effector of TGF‐β1 signalling, in particular the activation of CK1ε, plays an essential role in shuttling β‐catenin into the nucleus. One possible mechanism is that TGF‐β1 activates the CK1ε to inhibit GSK3β through phosphorylation, which allows β‐catenin to translocate to the nucleus, activating TCF/LEF‐dependent transcription. To support this hypothesis, we observed GSK3β phosphorylation/in‐activation by TGF‐β1, while CK1ε‐shRNA inhibited TGF‐β1‐induced GSK3β phosphorylation and β‐catenin nuclear translocation. Significantly, we confirmed that TGF‐β1‐induced β‐catenin nuclear accumulation, and mouse PSCs differentiation was surprisingly due to the activation of a non‐canonical TGF‐β1 signalling pathway: TGFRII‐CK1ε‐β‐catenin signalling.

In summary, the results of this study suggest that TGF‐β1 activates CK1ε to promote β‐catenin nuclear accumulation and then regulates downstream genes transcription to eventually promote mouse PSCs differentiation.

CONFLICT OF INTERESTS

The authors declare no conflict of interest.

Qiong W, Xiaofeng G, Junfang W. Transforming growth factor‐β1 (TGF‐β1) induces mouse precartilaginous stem cell differentiation through TGFRII‐CK1ε‐β‐catenin signalling. Int J Exp Path. 2018;99:113–120. 10.1111/iep.12275